ID: 1049693270

View in Genome Browser
Species Human (GRCh38)
Location 8:143971997-143972019
Sequence GGAAAGACAGCCCTGGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049693265_1049693270 -10 Left 1049693265 8:143971984-143972006 CCCAGGAGGTAGAGGAAAGACAG No data
Right 1049693270 8:143971997-143972019 GGAAAGACAGCCCTGGGGCCAGG No data
1049693257_1049693270 18 Left 1049693257 8:143971956-143971978 CCCTGGATGAATCAGAAGTAGTT No data
Right 1049693270 8:143971997-143972019 GGAAAGACAGCCCTGGGGCCAGG No data
1049693264_1049693270 -9 Left 1049693264 8:143971983-143972005 CCCCAGGAGGTAGAGGAAAGACA No data
Right 1049693270 8:143971997-143972019 GGAAAGACAGCCCTGGGGCCAGG No data
1049693262_1049693270 -5 Left 1049693262 8:143971979-143972001 CCCACCCCAGGAGGTAGAGGAAA No data
Right 1049693270 8:143971997-143972019 GGAAAGACAGCCCTGGGGCCAGG No data
1049693256_1049693270 19 Left 1049693256 8:143971955-143971977 CCCCTGGATGAATCAGAAGTAGT No data
Right 1049693270 8:143971997-143972019 GGAAAGACAGCCCTGGGGCCAGG No data
1049693263_1049693270 -6 Left 1049693263 8:143971980-143972002 CCACCCCAGGAGGTAGAGGAAAG No data
Right 1049693270 8:143971997-143972019 GGAAAGACAGCCCTGGGGCCAGG No data
1049693258_1049693270 17 Left 1049693258 8:143971957-143971979 CCTGGATGAATCAGAAGTAGTTC No data
Right 1049693270 8:143971997-143972019 GGAAAGACAGCCCTGGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049693270 Original CRISPR GGAAAGACAGCCCTGGGGCC AGG Intronic