ID: 1049693278

View in Genome Browser
Species Human (GRCh38)
Location 8:143972031-143972053
Sequence ACAATGCCCAGAACAGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049693265_1049693278 24 Left 1049693265 8:143971984-143972006 CCCAGGAGGTAGAGGAAAGACAG No data
Right 1049693278 8:143972031-143972053 ACAATGCCCAGAACAGGCTGGGG No data
1049693271_1049693278 1 Left 1049693271 8:143972007-143972029 CCCTGGGGCCAGGAAAGCCTCAG No data
Right 1049693278 8:143972031-143972053 ACAATGCCCAGAACAGGCTGGGG No data
1049693262_1049693278 29 Left 1049693262 8:143971979-143972001 CCCACCCCAGGAGGTAGAGGAAA No data
Right 1049693278 8:143972031-143972053 ACAATGCCCAGAACAGGCTGGGG No data
1049693263_1049693278 28 Left 1049693263 8:143971980-143972002 CCACCCCAGGAGGTAGAGGAAAG No data
Right 1049693278 8:143972031-143972053 ACAATGCCCAGAACAGGCTGGGG No data
1049693273_1049693278 -7 Left 1049693273 8:143972015-143972037 CCAGGAAAGCCTCAGCACAATGC No data
Right 1049693278 8:143972031-143972053 ACAATGCCCAGAACAGGCTGGGG No data
1049693272_1049693278 0 Left 1049693272 8:143972008-143972030 CCTGGGGCCAGGAAAGCCTCAGC No data
Right 1049693278 8:143972031-143972053 ACAATGCCCAGAACAGGCTGGGG No data
1049693266_1049693278 23 Left 1049693266 8:143971985-143972007 CCAGGAGGTAGAGGAAAGACAGC No data
Right 1049693278 8:143972031-143972053 ACAATGCCCAGAACAGGCTGGGG No data
1049693264_1049693278 25 Left 1049693264 8:143971983-143972005 CCCCAGGAGGTAGAGGAAAGACA No data
Right 1049693278 8:143972031-143972053 ACAATGCCCAGAACAGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049693278 Original CRISPR ACAATGCCCAGAACAGGCTG GGG Intronic