ID: 1049693850

View in Genome Browser
Species Human (GRCh38)
Location 8:143974200-143974222
Sequence AGCCCCGGCGCGGAAGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049693843_1049693850 15 Left 1049693843 8:143974162-143974184 CCAGGAATCGGTCCTAAGGAAAC 0: 1
1: 0
2: 5
3: 13
4: 101
Right 1049693850 8:143974200-143974222 AGCCCCGGCGCGGAAGGTGCTGG No data
1049693841_1049693850 21 Left 1049693841 8:143974156-143974178 CCGCTTCCAGGAATCGGTCCTAA 0: 1
1: 1
2: 9
3: 45
4: 287
Right 1049693850 8:143974200-143974222 AGCCCCGGCGCGGAAGGTGCTGG No data
1049693846_1049693850 -7 Left 1049693846 8:143974184-143974206 CCGTCAGAGGACGCAGAGCCCCG 0: 1
1: 0
2: 2
3: 17
4: 229
Right 1049693850 8:143974200-143974222 AGCCCCGGCGCGGAAGGTGCTGG No data
1049693845_1049693850 3 Left 1049693845 8:143974174-143974196 CCTAAGGAAACCGTCAGAGGACG 0: 1
1: 0
2: 0
3: 0
4: 58
Right 1049693850 8:143974200-143974222 AGCCCCGGCGCGGAAGGTGCTGG No data
1049693840_1049693850 22 Left 1049693840 8:143974155-143974177 CCCGCTTCCAGGAATCGGTCCTA 0: 1
1: 0
2: 1
3: 7
4: 97
Right 1049693850 8:143974200-143974222 AGCCCCGGCGCGGAAGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049693850 Original CRISPR AGCCCCGGCGCGGAAGGTGC TGG Intronic
No off target data available for this crispr