ID: 1049694625

View in Genome Browser
Species Human (GRCh38)
Location 8:143977258-143977280
Sequence TGGGCTCTGCTGACCCCTGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 533
Summary {0: 1, 1: 2, 2: 10, 3: 79, 4: 441}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049694613_1049694625 24 Left 1049694613 8:143977211-143977233 CCGACTCGGGCGAGGTCTGGGAG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1049694625 8:143977258-143977280 TGGGCTCTGCTGACCCCTGGTGG 0: 1
1: 2
2: 10
3: 79
4: 441

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049694625 Original CRISPR TGGGCTCTGCTGACCCCTGG TGG Exonic
900124899 1:1064888-1064910 TGGGGTCTGCGGGGCCCTGGGGG + Intergenic
900124927 1:1064948-1064970 TGGGGTCTGCGGGGCCCTGGGGG + Intergenic
900124942 1:1064978-1065000 TGGGGTCTGCGGGGCCCTGGGGG + Intergenic
900124957 1:1065008-1065030 TGGGGTCTGCGGGGCCCTGGGGG + Intergenic
900124985 1:1065068-1065090 TGGGGTCTGCGGGGCCCTGGGGG + Intergenic
900125013 1:1065128-1065150 TGGGGTCTGCGGGGCCCTGGGGG + Intergenic
900125028 1:1065158-1065180 TGGGGTCTGCGGGGCCCTGGGGG + Intergenic
900125043 1:1065184-1065206 TGGGGTCTGCGGGGCCCTGGGGG + Intergenic
900125056 1:1065215-1065237 TGGGGTCTGCGGGGCCCTGGGGG + Intergenic
900125083 1:1065275-1065297 TGGGGTCTGCGGGGCCCTGGGGG + Intergenic
900380560 1:2381908-2381930 AGGGCTGGGCTGCCCCCTGGTGG + Intronic
900419175 1:2548179-2548201 TGGATTTTGCTGCCCCCTGGTGG + Intergenic
900478015 1:2885157-2885179 GGGGCTCTGGTGACCACTGCAGG - Intergenic
900482759 1:2907215-2907237 GGGGCGCTGCGGACCCCTGTGGG + Intergenic
900505191 1:3026801-3026823 TGGGCTGGGCTAAGCCCTGGAGG + Intergenic
900522198 1:3111166-3111188 TGGGCCCTGCTGGCCACTGCTGG + Intronic
900932469 1:5745965-5745987 ATGGGCCTGCTGACCCCTGGTGG + Intergenic
901413850 1:9103834-9103856 CGGGCTGTGCTTGCCCCTGGTGG + Exonic
901762755 1:11481194-11481216 TGGGCACAGCTGACCCTTAGGGG + Intronic
901829273 1:11882169-11882191 TGGCCTCTGCCGGCCTCTGGTGG - Intergenic
902123009 1:14183893-14183915 TGTGCTCTGCTGACCTAAGGAGG + Intergenic
902406687 1:16187915-16187937 TGGGCTCTGCCGCCCTCTGGTGG + Intergenic
902733055 1:18382650-18382672 TGGGCTCCACTGACCCCTGAGGG + Intergenic
902923974 1:19683468-19683490 TGGGCTCTGCACACCCACGGTGG - Intronic
903123478 1:21232146-21232168 TTGCCTCTGGTGCCCCCTGGTGG - Intronic
903246256 1:22017724-22017746 GAGGCTCTGCTAACCCCTGATGG + Intergenic
903342940 1:22665940-22665962 TGGTGTCTGCTCCCCCCTGGTGG - Intergenic
903383923 1:22914735-22914757 TGGGCTTTGGTGAGGCCTGGTGG - Intronic
903662834 1:24989214-24989236 TGGACTCTGCTGTCATCTGGAGG + Intergenic
903788378 1:25875874-25875896 TGGGCCCGGCTGACCCTGGGAGG + Intergenic
904469652 1:30728497-30728519 TGGGGTCTTCTGATCCCTGCAGG - Intergenic
904599070 1:31664014-31664036 GGGGCTCTGCTGACCCCTCCTGG - Intronic
904715759 1:32466299-32466321 TGGCATCTGCTGTCTCCTGGAGG + Intronic
905168492 1:36097274-36097296 TGGCCTCTGCTGGGCCCTGAAGG - Exonic
905212192 1:36381994-36382016 GGGGCTCTGCTGGGTCCTGGGGG - Intronic
905432721 1:37936163-37936185 TGCTCTCTGCTGACCCCTCCTGG + Intronic
905885754 1:41491020-41491042 TGGGCACAGCTGGGCCCTGGTGG + Intergenic
905913127 1:41667436-41667458 TGGGGCCTGCTGAGCCCTGTGGG - Intronic
906530949 1:46523735-46523757 TGGGCTCTGCAGGCCCCTGGTGG - Intergenic
906606917 1:47179312-47179334 TGGCCTCGGCTGCCACCTGGTGG - Intergenic
906707193 1:47903504-47903526 CTGGCTCTGCTGGGCCCTGGGGG - Intronic
907049784 1:51322162-51322184 TGGGCTCTGCTGCCCCCCCAGGG + Intronic
908007115 1:59738506-59738528 TGGGCCCTGGTGACTCCAGGTGG - Intronic
908595813 1:65687847-65687869 TGTGCTCTGCTGCCACCTGCTGG + Intergenic
912489472 1:110054005-110054027 GGGGCTGTGCTGCCACCTGGTGG - Exonic
912682959 1:111740367-111740389 TGGGCTCCGCAGACCGGTGGGGG + Intronic
912752683 1:112298753-112298775 GGTGCTCTGCTGCCCCCTGGGGG - Intergenic
915030070 1:152871547-152871569 TTGGCTTTGCTGCCTCCTGGTGG - Intergenic
915891798 1:159780679-159780701 CGGGCTCTGCTGCACCCTGGCGG - Intergenic
916214183 1:162381999-162382021 TGGGCTCTGGTGAGCCTGGGGGG + Exonic
917032354 1:170707334-170707356 TGTGTTCTGCAGACCCCTGCTGG - Intronic
917976875 1:180245401-180245423 TGGCCCCTGATGGCCCCTGGAGG + Intronic
918118531 1:181517348-181517370 TGGCCCCTGCTGACCTCTGCAGG - Intronic
919829545 1:201530927-201530949 GGGACACTGCTGACCCCTGCTGG - Intergenic
920180211 1:204127811-204127833 TGGGCACCACTGTCCCCTGGTGG + Intergenic
920647816 1:207816161-207816183 AGGGCTCAGCTGTCCTCTGGAGG - Intergenic
920933120 1:210407397-210407419 GGGGCACTGCTGCCCCCTGGTGG - Intronic
923707500 1:236356439-236356461 TGGGGTCTGGGGATCCCTGGGGG - Intronic
1062833204 10:619728-619750 AGGGCTCTGCTGGGCCATGGAGG - Intronic
1067174090 10:43930404-43930426 TGGGATTTGCTGAGGCCTGGAGG + Intergenic
1067280144 10:44864993-44865015 GGGCCTCTGCTGCCCCCTGGCGG + Intergenic
1067448316 10:46366632-46366654 TGGGCTCAGGTGACTCCTGCAGG - Intergenic
1067569247 10:47359704-47359726 AGGGCTGAGCTGACTCCTGGGGG - Intergenic
1067589061 10:47494134-47494156 TGGGCTCAGGTGACTCCTGCAGG + Intergenic
1067636186 10:48002225-48002247 TGGGCTCAGGTGACTCCTGCAGG + Intergenic
1069614944 10:69801252-69801274 CCAGCTCTGCTGCCCCCTGGAGG + Intergenic
1069719495 10:70540649-70540671 TGCGGTCTGCTGCCTCCTGGTGG + Intronic
1069826322 10:71257163-71257185 GGGGCTCTGCTGGGCCCTGAGGG + Intronic
1069899864 10:71701212-71701234 TGGGCTCTGCTTTCTCCTTGTGG + Intronic
1070132747 10:73666230-73666252 TGGGCTCAGGTGACTCCTGCAGG + Intergenic
1070749549 10:78955817-78955839 AGGCATCTGCTGAGCCCTGGCGG + Intergenic
1070762782 10:79035162-79035184 TGGTGTCTGCTGAACCATGGAGG - Intergenic
1070856442 10:79611189-79611211 TAGGCCCTGCTGAACCCTGTAGG - Intronic
1071608935 10:87017844-87017866 TGGGCTCAGGTGACTCCTGCAGG - Intergenic
1071718603 10:88120763-88120785 GGGGAGCTGCTGACTCCTGGAGG - Intergenic
1073532702 10:104246602-104246624 TAGGCTCAGCTAACCCCGGGAGG + Intronic
1074983417 10:118637540-118637562 TTTGTTCTGCTGATCCCTGGAGG - Intergenic
1075427945 10:122356482-122356504 TGGGCTCTGTGGATTCCTGGTGG - Intergenic
1076616435 10:131758526-131758548 TGGGCTCCGCTGGCCCCAGCAGG - Intergenic
1076699750 10:132265268-132265290 TGGGCTCTGCAGCCACCCGGGGG + Intronic
1076720360 10:132389706-132389728 TGGCCTCTCCTGGCCACTGGAGG + Intergenic
1076802516 10:132837090-132837112 GTGCCTCTGCTGCCCCCTGGTGG - Intronic
1076882630 10:133247135-133247157 TGGGCTCTGGGGCCGCCTGGTGG - Intergenic
1076998454 11:310742-310764 TGGGCCCTGCTCCCCCGTGGTGG + Intronic
1077000289 11:319017-319039 TGGGCCCTGCTCCCCCGTGGTGG - Intergenic
1077101258 11:823623-823645 TCGGCTCTGCTACCCCCTGCGGG + Intronic
1078994063 11:16678979-16679001 TGGGCCTTGCTGAGCTCTGGTGG - Intronic
1079005423 11:16788558-16788580 AGGCCTGTGCTGCCCCCTGGTGG - Exonic
1079173191 11:18115678-18115700 GGGGCTCTACTGCCCCCTAGTGG - Intronic
1079403895 11:20128429-20128451 TGGGCTTTGCTGCCCTCTTGTGG - Intergenic
1081207762 11:40294251-40294273 GTGGCTCTGCTGCCACCTGGAGG + Intronic
1081580291 11:44347207-44347229 AGGCCTCTGCTCAGCCCTGGGGG + Intergenic
1083272797 11:61580649-61580671 GGGGCTGGGATGACCCCTGGGGG + Intronic
1083860240 11:65416525-65416547 TGAGCTCAGCTGCCCCCTGCTGG - Intergenic
1084123193 11:67081626-67081648 TGGGCCCTGCTGCCCTCTGGTGG - Intergenic
1084477799 11:69398809-69398831 GGGGCTCTGCAGGCCCCCGGTGG - Intergenic
1084494097 11:69494188-69494210 TGGCCTCTGCTTAGACCTGGCGG - Intergenic
1084517478 11:69644558-69644580 CGGGCTCAGCTGAGCCCTGAGGG + Intronic
1084538767 11:69774260-69774282 TGGGCTCTGGAGGCCCTTGGGGG - Intronic
1084540285 11:69782224-69782246 TGGGCTCAGCTCACCCCATGGGG + Intergenic
1084771567 11:71345810-71345832 TGCGGTCTGCTGTGCCCTGGGGG + Intergenic
1084833849 11:71788862-71788884 TGGGTACTGCTGATCCATGGTGG - Intronic
1085289109 11:75384652-75384674 TGTGCTCTGCCGCCCCCTAGCGG + Intergenic
1086983668 11:93225816-93225838 TGGGCTTTGCTGTCACCTAGTGG + Intergenic
1087828632 11:102794632-102794654 GGGTCTCTGTTGCCCCCTGGAGG - Intronic
1088335375 11:108698052-108698074 TGGCCTCTGCTGTCCCCTAGTGG - Intronic
1088919955 11:114253580-114253602 TGGGCCCTGCAGACCCCAGTAGG + Intergenic
1089023525 11:115243212-115243234 TGCGCTCTGCAAACCCATGGTGG + Intronic
1089388402 11:118083086-118083108 AGGGCTCTGAGCACCCCTGGGGG - Intronic
1089397424 11:118145476-118145498 TGGGTTGGGGTGACCCCTGGTGG - Intronic
1089535897 11:119160680-119160702 TGGCCTCTGCTCCTCCCTGGAGG + Intronic
1090827392 11:130397399-130397421 TGGGCTCTGTGGGACCCTGGTGG + Intergenic
1091297201 11:134482297-134482319 AGGGCTCTGCAGACCCCCGCAGG - Intergenic
1091391548 12:129224-129246 TGGGCTATGCAGCACCCTGGAGG - Intronic
1091493143 12:949954-949976 GGATCTCTGCTGCCCCCTGGTGG + Intronic
1091780625 12:3212607-3212629 AGAGCTCAGCTGAACCCTGGGGG - Intronic
1091963322 12:4717968-4717990 TGGCCTCCACTGACACCTGGTGG + Intronic
1092161166 12:6316248-6316270 GGGTCTCAGCTGACACCTGGAGG - Exonic
1095917898 12:47498276-47498298 AGGTGTCTGCTGACCCCTGCTGG - Intergenic
1095986401 12:48002407-48002429 TTGGGTCCGCTGACCCCAGGCGG + Intronic
1096041140 12:48518586-48518608 GGAGCTCTGCTGAACCTTGGAGG - Intronic
1096188338 12:49598698-49598720 CTGGCTGTGCTGACCCCAGGAGG + Intronic
1096705878 12:53421741-53421763 TCTCCTCTGCTGACCTCTGGTGG + Intergenic
1097085395 12:56464477-56464499 TGGGCCATGCTGACCCCTGGTGG + Intronic
1097195208 12:57239211-57239233 TGGGCTCGGGCGCCCCCTGGAGG + Intronic
1097248966 12:57621903-57621925 TGGCCGCTGCCGCCCCCTGGTGG + Intronic
1101083165 12:101209431-101209453 GGGACTCTGCAGACCTCTGGAGG - Intronic
1102074418 12:110048441-110048463 TGGCCTCTGCAGCCTCCTGGTGG - Intronic
1102252500 12:111397094-111397116 GGGGCTCTGGCGCCCCCTGGTGG - Intergenic
1103013081 12:117472873-117472895 GGGGCTCTGCTGACCCTGGAGGG + Intronic
1103247885 12:119473616-119473638 TGGACTCTGGGGACTCCTGGGGG - Intronic
1103446802 12:121000114-121000136 TCGGCTCCAATGACCCCTGGCGG + Intronic
1103578080 12:121893607-121893629 TGGCCTCTGGTGACTGCTGGCGG + Intronic
1103923877 12:124413202-124413224 TGGGCGCTGTTGACCCTGGGAGG + Intronic
1104641560 12:130470398-130470420 TGTGGTCTGCTGTCCTCTGGTGG - Intronic
1105202242 13:18190669-18190691 TGGGCTCTGCAGAGCTGTGGCGG - Intergenic
1105422689 13:20266835-20266857 TGAGCTCTCCCGGCCCCTGGTGG + Intergenic
1106378730 13:29215801-29215823 TGGTGTCTGTTGACCCCTGCTGG + Intronic
1106783045 13:33079006-33079028 TGTGGTCTGCAGATCCCTGGAGG - Intergenic
1107573088 13:41684468-41684490 TGGGCACTGTTGTCCACTGGTGG + Intronic
1108072202 13:46639781-46639803 TGGGCTCTTCTGCACCCTTGGGG + Intronic
1108506973 13:51121047-51121069 TGACCTCTTCTGCCCCCTGGTGG + Intergenic
1110520809 13:76473721-76473743 CAGCCTCTGCTGCCCCCTGGTGG + Intergenic
1113847634 13:113401663-113401685 CGGGCTGTGCTGAGCTCTGGGGG - Intergenic
1114318034 14:21525201-21525223 TGGCCACTGCCTACCCCTGGGGG + Exonic
1114419641 14:22570561-22570583 TGGGCTTTGCTGCCACCTAGTGG - Intronic
1118940553 14:70332470-70332492 TGGGATCTGCTGTGGCCTGGAGG - Intronic
1119985518 14:79132851-79132873 TGGGCTCAGCTAACCCCACGAGG + Intronic
1120997502 14:90427781-90427803 TTGGCTCTGCTGAGCCAAGGTGG + Intergenic
1121089780 14:91173315-91173337 TGGCTTCTGCTGCCCTCTGGTGG + Exonic
1121515241 14:94545299-94545321 TGGGCTGATCTGACCCCTGTGGG + Intergenic
1121632648 14:95432372-95432394 TGGGCTGGGCTGACACCTAGTGG + Intronic
1122157187 14:99756654-99756676 TGGGCACTGCAGTCGCCTGGAGG + Intronic
1122272810 14:100575911-100575933 TGGGGGCTGCTGGGCCCTGGGGG - Intronic
1122612987 14:102998762-102998784 TGTGCCGTGCTGACCCCTGAAGG - Intronic
1122717985 14:103706802-103706824 TGGGCTCAGCTGACAGCAGGAGG - Intronic
1122800094 14:104225102-104225124 GGGGCGTTGCTGACCCATGGTGG + Intergenic
1124886469 15:33692004-33692026 TGTGATCTGCAGAGCCCTGGGGG - Intronic
1125508216 15:40279566-40279588 TGATCTCTGGTGCCCCCTGGTGG - Intronic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1126301021 15:47196166-47196188 TGGGCCATGCTGCCACCTGGAGG - Intronic
1127664706 15:61134348-61134370 TGGGCTCTGCAGACTGCTGCTGG + Intronic
1127996066 15:64153710-64153732 TGGCCCCTGCTGCCCCCTAGTGG + Intronic
1128111409 15:65078383-65078405 TGGGCTCTGCTGAGAGCTGGTGG + Intergenic
1128154648 15:65385003-65385025 CGGGCCCTGCTGCCCCCTGCTGG - Exonic
1128346275 15:66854477-66854499 TGGCCTCTGCTTACACCTTGCGG + Intergenic
1129325936 15:74800320-74800342 TGGCCTCTGCCGCCCTCTGGTGG + Intronic
1129456153 15:75677088-75677110 AGGCCCCTGCTGGCCCCTGGAGG + Exonic
1129776599 15:78241101-78241123 GGGCCTCTGCTGACCCCTGCTGG + Intronic
1129823221 15:78618578-78618600 TAGGCACTGCTGCCCCCTGGTGG - Intronic
1129923056 15:79336979-79337001 TGGGCTGTGGTGGACCCTGGTGG + Intronic
1130111636 15:80970214-80970236 TGGTCTCTGCTGCCCCCTAGTGG + Intronic
1130116153 15:81006167-81006189 TGGGTTCTTCTGACTCCTGAGGG + Intergenic
1130664566 15:85858953-85858975 TGGGCAATGCTGCCCCCTAGAGG - Intergenic
1131075377 15:89492191-89492213 TGGGTACTGGTGCCCCCTGGAGG - Intronic
1131109519 15:89756321-89756343 TGGGCTCTGCTGACAGCTGCAGG - Intergenic
1131258335 15:90875840-90875862 TGGGCTGTGCGCATCCCTGGAGG + Exonic
1131670482 15:94614604-94614626 TGGACTCTGCACACCCCTGGAGG - Intergenic
1132079155 15:98850409-98850431 TGGGTTCTGCAGACACCTGGGGG + Intronic
1132469961 16:97052-97074 CAGCCTCTGCTGCCCCCTGGTGG + Intronic
1132735622 16:1384414-1384436 TGGGCTGTGGGGACCCGTGGGGG - Intronic
1132764504 16:1527353-1527375 AGGGTTCTGCAGAGCCCTGGAGG + Intronic
1132863755 16:2083836-2083858 TGGACCCTGCTGACCTCGGGGGG + Intronic
1133035596 16:3032362-3032384 TCGGCTCTGCTGATGCCTTGTGG + Intronic
1133232650 16:4373775-4373797 AGGGCCCTGCTGAGCCCAGGAGG + Intronic
1133239973 16:4408434-4408456 AGGGCCCTGCTGACCCAGGGTGG + Intronic
1134230711 16:12427145-12427167 TAGGCTCTGCAGACCCCAAGGGG - Intronic
1134521019 16:14919291-14919313 TGGGCACTGCTACCGCCTGGTGG + Intronic
1134708695 16:16317942-16317964 TGGGCACTGCTACCGCCTGGTGG + Intergenic
1134950910 16:18350703-18350725 TGGGCACTGCTACCGCCTGGTGG - Intergenic
1135323622 16:21512562-21512584 TGGGCTGTGCAGACCCCCGAGGG - Intergenic
1135329838 16:21551777-21551799 TTGACACTGCTGACTCCTGGTGG + Intergenic
1135420391 16:22301973-22301995 TGGGAACTGCTGAGGCCTGGGGG + Intronic
1135962069 16:27003331-27003353 TGGCCTCTGTTGACACCTGGTGG - Intergenic
1136608421 16:31352032-31352054 TGGGCTCTGAGCACCCCAGGAGG + Intergenic
1137537466 16:49338174-49338196 TGGCATCTGCTGACCACTGGAGG + Intergenic
1137559215 16:49492379-49492401 GTGCCTCTGCTGACCCCTGGCGG - Intronic
1138345657 16:56318480-56318502 TGTGCACTCCTGCCCCCTGGTGG + Intronic
1138535472 16:57657624-57657646 TGGGGTAAGCTGACCCTTGGGGG + Intronic
1139532040 16:67547146-67547168 GCGGATCTGCTGCCCCCTGGTGG - Intergenic
1139942013 16:70612185-70612207 TGGAACCAGCTGACCCCTGGGGG + Intronic
1140041773 16:71412899-71412921 TTGTCTCTGCTGCCCCCTTGTGG - Intergenic
1140405671 16:74709598-74709620 CGGCCTCTGCTGCCCTCTGGTGG - Intergenic
1140663036 16:77206342-77206364 TGGGCTCTGCAGACACCCGTGGG - Intronic
1140774209 16:78235369-78235391 CCGGCTCATCTGACCCCTGGTGG + Intronic
1141197088 16:81868159-81868181 TTGGCTGTTCTGAGCCCTGGGGG + Intronic
1141551584 16:84809986-84810008 TGGTGACTGCAGACCCCTGGAGG - Intergenic
1141569422 16:84925319-84925341 GGTGCTCTGCTGCCCCCTGGTGG - Intergenic
1141649339 16:85384866-85384888 TGGGCTTTTCTGCACCCTGGGGG + Intergenic
1142042860 16:87906300-87906322 TTGACACTGCTGACTCCTGGTGG + Intronic
1142401492 16:89860981-89861003 TGGTCTCTGCTGCCGCCTGCTGG + Intronic
1143019146 17:3907668-3907690 TGGTCACTGCTGTCCCCTGCAGG + Intronic
1143046929 17:4088845-4088867 AGCGCTCTGCTGACTCCTGACGG + Exonic
1143368209 17:6422182-6422204 TGGTCTCTGCTGCCACCTGCTGG + Intronic
1143501483 17:7342037-7342059 TGGGCTCTGGTGGACCCAGGCGG - Exonic
1144494643 17:15738548-15738570 TGGGCTCTGCTGACCCTCCCTGG + Intronic
1144578509 17:16444668-16444690 TGGCAGCTGCTGACTCCTGGAGG + Intronic
1144639354 17:16929031-16929053 TGGGCTCTGCTGACCCTCCCTGG - Intergenic
1144640672 17:16934920-16934942 TGGGCCCTGCTGACCCAGGCGGG - Intronic
1144703898 17:17355085-17355107 GGGGCTGTGCTGCCACCTGGTGG - Intergenic
1144829125 17:18121860-18121882 TGGTCTCTGCTGGCAGCTGGGGG - Exonic
1144905613 17:18638128-18638150 TGGGCTCTGCTGACCCTCCCTGG - Intronic
1145941090 17:28743830-28743852 TGGGCTTTTCTTTCCCCTGGGGG - Intergenic
1146058265 17:29591804-29591826 GACACTCTGCTGACCCCTGGTGG + Intronic
1146279502 17:31536101-31536123 CTGGCCCTGCTGGCCCCTGGAGG - Exonic
1146738319 17:35258832-35258854 TGTGCTCTGCTGAATTCTGGTGG + Exonic
1146761120 17:35479989-35480011 TGTGCTCTGCTGAATTCTGGAGG - Exonic
1146793758 17:35767099-35767121 TGCCCTCTGCTGACACCTGCTGG - Intronic
1147426947 17:40350471-40350493 TGGGCTCAGCTGAGGCCTGATGG + Intronic
1148025965 17:44587811-44587833 TGTCCTCTGCTGACCCACGGTGG + Intergenic
1148845971 17:50530141-50530163 AGGGCTCTGAGGACCCATGGGGG + Intronic
1150288011 17:63964760-63964782 GGGGCTCTGCTTACCCATGCGGG - Intronic
1150292655 17:63990556-63990578 GGGGCTCTGGTGACCCCTGGTGG + Intergenic
1150535372 17:66033589-66033611 TGAGCTATGCAGGCCCCTGGAGG - Intronic
1150796086 17:68238154-68238176 TGGCCTCAGTTGAACCCTGGAGG - Intergenic
1151480632 17:74368440-74368462 CAGGCCCTGCTGCCCCCTGGTGG - Intronic
1152543176 17:80987299-80987321 TGGGCTCTGCTGGACCCTGCAGG - Intergenic
1152543192 17:80987353-80987375 TGGGCTCTGCTGGACCCTGCAGG - Intergenic
1152612326 17:81321988-81322010 TGGGGTCTCCTGAGCCCCGGTGG - Intronic
1152681959 17:81673062-81673084 TCGGCTCTGCTGACTCCCGGGGG - Exonic
1153984567 18:10340885-10340907 TGGGCTCTGCAGACACCCTGAGG - Intergenic
1154212503 18:12391838-12391860 AGGGCTCTCCTGACGCCTAGTGG - Intergenic
1155322981 18:24637190-24637212 TGGGCTCAGCTGAGCTCTGATGG - Intergenic
1156527280 18:37778700-37778722 TGTGCTCCACTGCCCCCTGGTGG - Intergenic
1157379959 18:47205093-47205115 TGACCTCTGCTGTCCCCTGGTGG + Intergenic
1157384140 18:47247751-47247773 TGGCCGCCGCGGACCCCTGGCGG - Intronic
1157446335 18:47749265-47749287 TGAGCTCTGCTGACCCCTGGCGG + Intergenic
1159109272 18:64037989-64038011 TGTACACTGCTGACCTCTGGTGG - Intergenic
1159387337 18:67742736-67742758 AGGTGTCTGCTGACCCCTGTTGG - Intergenic
1160375659 18:78409922-78409944 TGGGCTCAGCTGTCCCCTGATGG + Intergenic
1160776186 19:857159-857181 CTGGCTGTGCTGCCCCCTGGTGG - Intergenic
1161169376 19:2805329-2805351 GGGGCTCTGCCGTGCCCTGGAGG + Intronic
1161316178 19:3618712-3618734 TGCCCGCTGCTGCCCCCTGGTGG + Intronic
1162117805 19:8442134-8442156 TGAGCTCTCCTGCCCCTTGGGGG + Intronic
1162615465 19:11797591-11797613 TAGGCTCTGCTGCCCCCTACAGG - Intergenic
1162625263 19:11880046-11880068 CGGGCTCTGCTGCCCCCTGCAGG - Intronic
1162630499 19:11923812-11923834 TGGGCTCTGCTGCCCCCTGCAGG - Intergenic
1162635412 19:11964054-11964076 GGGGCTCTGCTGCCCCCTGCAGG - Intronic
1162637939 19:11985098-11985120 CAGGCTCTGCTGCCCCCTGTAGG - Intergenic
1162651292 19:12091011-12091033 TGGGCTCTGCTGCCCCCTGCAGG - Intergenic
1162657415 19:12141313-12141335 CGGTCTCTGCTGCCCCCTGCAGG + Intronic
1162741415 19:12775703-12775725 TGGGCCAGGCTGACCCCTAGCGG - Intronic
1162910025 19:13843387-13843409 TGGGCACTGCAGACCCCTCCCGG + Intergenic
1162913505 19:13862414-13862436 TGGACTCTGCTGCCCCCTGCTGG + Intronic
1162946758 19:14048731-14048753 TGCTCTCTGCTGGCCCCTAGAGG + Intronic
1163237741 19:16039164-16039186 TGGGCCCTGCTGACCCATGCAGG - Intergenic
1163576366 19:18113158-18113180 GTGGCTCTGCTGCCCCCCGGTGG - Intronic
1163645173 19:18485225-18485247 TGGGCTCTCCTCTCCCCAGGAGG + Intronic
1163762738 19:19146206-19146228 CGGCCGCTGCTGACCCCTGGTGG - Intronic
1164457489 19:28420865-28420887 TGGGTTCTGCTCATCCCTGGAGG - Intergenic
1164675161 19:30095805-30095827 TGTGCTCTGCTGTTCCCTGGAGG - Intergenic
1165406968 19:35636987-35637009 GGAGCTCTGCTGGCACCTGGAGG - Intronic
1165937425 19:39397820-39397842 TGGCCTCTGCTGCCCCCTGCTGG - Exonic
1166267206 19:41691559-41691581 GGGACTCTGCTGCCCTCTGGGGG + Intronic
1166340318 19:42133241-42133263 TGGGCGCTGCCGCCCTCTGGCGG - Intronic
1166395106 19:42433841-42433863 TGGCCTCTGGCGACCCCTGTCGG + Exonic
1166667399 19:44689345-44689367 GGTGCTCTGCTGCCCCCTGCTGG - Intergenic
1166686700 19:44800664-44800686 TGCCCTCTGCTGCCCCCTGCTGG - Intergenic
1166694495 19:44844925-44844947 CGGTCTCTGCTGCCCCCTGGCGG + Intergenic
1166862901 19:45819987-45820009 TAGGCCCTGCTGACCCCTCTGGG + Intronic
1167039287 19:47013137-47013159 GGCGCTCTGCTGACCCCTGGTGG - Intergenic
1168354235 19:55691935-55691957 CGGCCTCTGGGGACCCCTGGAGG + Exonic
925237433 2:2292063-2292085 TGGGCTCTGCTTCCCTCTGTTGG + Intronic
926323456 2:11765066-11765088 TGGGCTGTGATGGACCCTGGTGG + Intronic
927246805 2:20963135-20963157 TGTGCACTGCTGCCCTCTGGTGG + Intergenic
927857180 2:26535095-26535117 TGTGCACTGCTGACCATTGGTGG + Intronic
927888080 2:26730645-26730667 TAGTCTCTGGGGACCCCTGGGGG + Exonic
932001510 2:67889304-67889326 TGCCCTCTGATGTCCCCTGGAGG - Intergenic
932417715 2:71583867-71583889 TTGGCTCTGGGGACCCCTGGGGG + Intronic
932746124 2:74335021-74335043 TGCTCTCTGCTGCCCTCTGGAGG + Intronic
934491287 2:94763293-94763315 TGGGGACTGCTGAGCCCTGATGG - Intergenic
934494940 2:94788633-94788655 TGGGCCCTGTTGACCCATGCAGG - Intergenic
935127760 2:100239374-100239396 TGGACTGTGCTGACCCTTGGAGG - Intergenic
937679388 2:124627289-124627311 TGGTTTCTGGTGACCCCTGTTGG - Intronic
937905356 2:127050316-127050338 GGGCCTCTGCTGCCCCCTGCTGG + Intronic
937907265 2:127058440-127058462 AGGGCCCTGCAGACACCTGGAGG + Intronic
938104269 2:128519652-128519674 AGGGCTCTGTGGACCCCTGGAGG - Intergenic
938501457 2:131833069-131833091 TGGGTGCTGCTGACAGCTGGAGG + Intergenic
939118474 2:138088478-138088500 TGTGCTCTGCTGCCCACTGCAGG - Intergenic
944890057 2:204108439-204108461 GGGCCTGTGCTGACACCTGGAGG - Intergenic
946334863 2:219029855-219029877 GGGTGTCTGCTGCCCCCTGGTGG - Intronic
947748703 2:232522253-232522275 TGGTCTCTGCTGCCCCCTGGCGG + Intronic
948094068 2:235319803-235319825 CTGGCTATGCTGATCCCTGGAGG - Intergenic
948326076 2:237122390-237122412 CGGCCTCTGCTGACCCCCAGTGG - Intergenic
948468205 2:238162167-238162189 TGGGCTTCTCTGTCCCCTGGGGG + Intronic
1169786018 20:9359876-9359898 AGGGCTCTACTGACACCTGCTGG + Intronic
1170684725 20:18559146-18559168 TGGCCTCTGTTGACACCTCGGGG + Intronic
1171014031 20:21523621-21523643 TGGGGTCTCCTGAGCCCTGAGGG + Intergenic
1171444873 20:25196040-25196062 TGGGCTCCGCTGACCGGTGGGGG + Intronic
1171985987 20:31661719-31661741 TGGGCTTCACTGCCCCCTGGTGG - Intergenic
1172787116 20:37475703-37475725 TGGGGCCTGCGGACACCTGGGGG - Intergenic
1172901831 20:38340791-38340813 TGGGCTCTGGAGTCACCTGGCGG + Intergenic
1172943453 20:38670533-38670555 TGGGCTCTGCTGAGCACCGATGG + Intergenic
1173092080 20:39982629-39982651 TGGGCTCAGCTGATCCCAGCTGG - Intergenic
1173741840 20:45407028-45407050 TGGGCTCCGCGGCCCCCCGGGGG + Intronic
1173873138 20:46354109-46354131 AGGGCTCTCCTCATCCCTGGAGG + Intronic
1173897648 20:46563004-46563026 TGGGCCCTGCTGAAAGCTGGTGG + Intronic
1173942187 20:46920896-46920918 TGGGCTCTGCTCACCTCTTTTGG + Intronic
1173945867 20:46950529-46950551 TGGGCTTTCCTGCCCCTTGGTGG - Intronic
1174072574 20:47909303-47909325 TGTGCACTCCTGGCCCCTGGTGG - Intergenic
1174149506 20:48476208-48476230 TGGGATCTGGTGACCCGGGGAGG - Intergenic
1175426464 20:58870457-58870479 AGCTCTCTGCTGACCTCTGGTGG - Intronic
1176012366 20:62905740-62905762 TGGGCTCTGCTTCCCGCTGATGG + Intronic
1176150495 20:63588389-63588411 AGGGCTCTCCTGACCCCCGTAGG + Exonic
1176229997 20:64027728-64027750 TGGGCTGTGGTGAGTCCTGGAGG + Exonic
1176519459 21:7813696-7813718 TGGGTGCTGCTGCCCCCTGGTGG - Intergenic
1176715705 21:10347339-10347361 TGGGCTCTGCAGAGCTGTGGCGG + Intergenic
1178488680 21:33034248-33034270 TGAGCCCTGCTGAGTCCTGGAGG + Intergenic
1178653487 21:34443709-34443731 TGGGTGCTGCTGCCCCCTGGTGG - Intergenic
1178690417 21:34745660-34745682 TGGGATTTGCTGACTCCTGGAGG - Intergenic
1178980266 21:37257856-37257878 TGGGCTCTGCTGCCTCCGGGTGG + Intronic
1179718957 21:43304786-43304808 GGGGCTCTGCTGACCCCTCCCGG - Intergenic
1179787299 21:43737250-43737272 TGGGCTCTGCAGGCACTTGGGGG - Intronic
1180088176 21:45517480-45517502 TGGTCTCTGCTGACTCCTTGGGG - Intronic
1180088201 21:45517581-45517603 TGGTCTCTGCTGACTCCGTGAGG - Intronic
1180257578 21:46643093-46643115 TGGGCTCTGCTGCCTCGTGGAGG + Intronic
1180602637 22:17032614-17032636 TGGGCTCTGCAGAGCTGTGGCGG - Intergenic
1180641716 22:17304327-17304349 AGGCCGCTGCTGACTCCTGGAGG + Intergenic
1180899522 22:19360364-19360386 TGAACGCTGCTGACCACTGGAGG + Intronic
1181027440 22:20134114-20134136 TGGCCTATGCTGACCTCTGCCGG + Intronic
1181051854 22:20241701-20241723 TGGGCCCTGCTGACCCCCAGCGG - Exonic
1181056079 22:20261118-20261140 GAGCCTCTGCTGAACCCTGGTGG - Intronic
1181312546 22:21952940-21952962 GGACCTCTGCTGCCCCCTGGCGG + Intergenic
1181409802 22:22710899-22710921 TACTCTCTGCTGCCCCCTGGTGG - Intergenic
1182758324 22:32699319-32699341 TGGGCTCCCCTGAACCCTGCTGG + Intronic
1183062470 22:35344627-35344649 TGGGCTCTGCTCCTGCCTGGGGG + Intronic
1183457386 22:37930201-37930223 TTGGCTCTGCTGGCCCCTCTGGG + Intronic
1184147787 22:42621697-42621719 GGGCCAGTGCTGACCCCTGGTGG - Intronic
1184669757 22:46006510-46006532 TCCCCTCTGCTGCCCCCTGGTGG - Intergenic
1184744889 22:46450452-46450474 TGGACTGTGCTCACCTCTGGAGG - Intronic
1184903923 22:47465927-47465949 AGTGCCCTGCTGACCCCTGAGGG - Intronic
1185019913 22:48367990-48368012 TGGGCTCTGCTCTCCCTTGAAGG - Intergenic
1185055946 22:48578362-48578384 GGGGCTCTGCTGTCCCCCTGAGG + Intronic
1185310500 22:50151660-50151682 AGAGCTCTGCTGTCCCCCGGAGG + Intronic
1185315289 22:50176414-50176436 TGGGCTCTGCCCACCCTTGAGGG - Intronic
949421949 3:3875328-3875350 TGGGCTCTGAGGAGCCCTGGAGG + Intronic
949511672 3:4771962-4771984 TGGGCCCTGCAGAACCCTGGGGG - Intronic
950123384 3:10496510-10496532 TGGCCTCAGCTGATCCCTTGGGG - Intronic
953054846 3:39379906-39379928 TGGGTCCTGCTTACCCCTGTGGG + Intergenic
953196276 3:40737370-40737392 CAGGCTCTGTTGACCTCTGGTGG + Intergenic
953996321 3:47522722-47522744 CGTGCTCTGCAGACACCTGGGGG - Intergenic
954382298 3:50226234-50226256 AGGCCTCTGCTGACCCCTGGCGG + Intergenic
954392056 3:50273075-50273097 CGGTCTCTGCTGCCCCCTCGCGG + Intronic
954938859 3:54352608-54352630 TGGGCTCTACTGCTCCCTGGGGG - Intronic
956716658 3:72085670-72085692 TCGGCTCTGCTGACTCCCAGGGG - Intergenic
959871423 3:111332846-111332868 TGGCCTTTGCTGACCTCTGGGGG + Intronic
960450958 3:117807381-117807403 TGGGCTGTGCTTTCCTCTGGAGG - Intergenic
960531442 3:118770010-118770032 TGGCCTCTCCTGCCCCCAGGAGG + Intergenic
961330279 3:126134324-126134346 TGGCCTCTGCTGCCATCTGGTGG - Intronic
962479802 3:135788463-135788485 TGGGCTCTGCACCACCCTGGGGG + Intergenic
965834041 3:172831023-172831045 TGGGCTCTGCTGAGCTTTTGAGG + Intergenic
967878537 3:194282740-194282762 TGTGCTCCTCTGAGCCCTGGAGG - Intergenic
968045897 3:195623860-195623882 AGGTCTCTGCTCAGCCCTGGGGG + Intergenic
968093989 3:195915189-195915211 TGCGCTCTGGTGCCCCCTGGTGG + Intergenic
968308757 3:197666227-197666249 AGGTCTCTGCTCAGCCCTGGGGG - Intergenic
968573971 4:1356375-1356397 CGCCCTCTGCTGGCCCCTGGGGG - Intronic
969109703 4:4836323-4836345 GGGCCTCTGCTTACCACTGGAGG + Intergenic
969342271 4:6549634-6549656 TGGGCTCTGATGACACCTGCTGG + Intronic
969614103 4:8242352-8242374 AGCTCTCTGCTGCCCCCTGGTGG - Intergenic
975044181 4:69782761-69782783 TGGGCTGGGCTGACCTCTGATGG + Intronic
976586383 4:86801779-86801801 TGGGCTCTGCTGACCCATGGAGG - Intronic
977508939 4:97937821-97937843 TGGTGTCTGCTGACCCCTGTTGG + Intronic
978108351 4:104931276-104931298 AGGTGTCTGCTGACCCCTGCTGG - Intergenic
981750570 4:148089780-148089802 TTGGCACTGCTGACTCATGGTGG - Intronic
981817952 4:148852500-148852522 AGGGCTTTGCTGGCTCCTGGGGG - Intergenic
982024101 4:151234835-151234857 TGGGATCTCCTGAGCCCAGGAGG - Intronic
982707894 4:158730139-158730161 GAGACTCTGCTGTCCCCTGGTGG - Intergenic
983469260 4:168136637-168136659 TGAGCTCTGCAGAGCCATGGGGG - Intronic
985649184 5:1099376-1099398 CGGGCCCTGCTGTCCCCCGGAGG - Intronic
987047115 5:14118720-14118742 TGGCTTCAGCTGACCCCTGAAGG + Intergenic
990827802 5:59921987-59922009 TGGCCACTGCTGACGCATGGGGG - Intronic
990951412 5:61302158-61302180 AGGGCTCAGCTCACCCCTGCAGG + Intergenic
991090914 5:62693078-62693100 TGGGCGCTGCAGGCCCTTGGTGG + Intergenic
991093799 5:62718557-62718579 TTGGCAGTGCTGACCCCTGGAGG + Intergenic
992792549 5:80226552-80226574 TGGGCTCTTCTGACTGCTGTAGG - Intronic
993119208 5:83754178-83754200 AGGTGTCTGCTGACCCCTGCTGG - Intergenic
994840622 5:104920725-104920747 TGGGCTCTGTTGACACCTAGTGG - Intergenic
995470875 5:112500929-112500951 TTGGCTCTTCTGACTTCTGGTGG + Intergenic
996820878 5:127626204-127626226 TGAGCACTGCTCAACCCTGGGGG - Intergenic
997398175 5:133581239-133581261 CTAGCTCTGCTGACCACTGGGGG - Intronic
997661552 5:135593034-135593056 TGGGTCCTGCTGAGCTCTGGTGG - Intergenic
999261807 5:150243042-150243064 GGGGCTCTGCTGGCCACTGCAGG - Intronic
999328569 5:150658141-150658163 TTGGCTCAGATGACCCCTGAGGG + Intronic
999502947 5:152165042-152165064 TGTGCTCTGCTCTCCCCTGGTGG + Intergenic
1002159553 5:177307308-177307330 TTGGCTCTGCTGCCCCCAAGGGG - Exonic
1002181740 5:177434286-177434308 TGGGCTCTGCTGGACCCACGGGG + Intronic
1002337390 5:178489313-178489335 TGGACTCTGCAACCCCCTGGGGG + Intronic
1002372526 5:178766818-178766840 TGGGTTCTGCTGAGCCCTTGGGG - Intergenic
1002549337 5:179975360-179975382 TGGGCGCTACTGACACCTAGTGG + Intronic
1002836372 6:868591-868613 TCTGCTCTGCTGTCCCCGGGTGG - Intergenic
1003412306 6:5876423-5876445 TGGGATCTGCTGTCACCTTGAGG - Intergenic
1004705825 6:18122732-18122754 TGCGATCTGCTGCCCCTTGGTGG + Intergenic
1005811235 6:29518020-29518042 TGGGCCCTGCTGACCCAGGCAGG + Intergenic
1005811656 6:29520561-29520583 TGGGCTCTGGTGACCCTCAGTGG + Intergenic
1006078020 6:31546795-31546817 TGGTCTCTGCTGCTCCCAGGCGG - Exonic
1006248873 6:32763448-32763470 ATGGCTCTGCAGATCCCTGGAGG - Exonic
1006913294 6:37578258-37578280 TCAGCTCTGCAGACGCCTGGGGG + Intergenic
1007246283 6:40465628-40465650 TGGGCTCTCCTGACCCATGTAGG + Intronic
1007247823 6:40475094-40475116 GGGGCCATACTGACCCCTGGAGG - Intronic
1007512138 6:42381761-42381783 TGGGCTCTGCTTCTCCCAGGAGG - Intronic
1010254175 6:73739290-73739312 TTGGTTATACTGACCCCTGGTGG - Intronic
1010771167 6:79832625-79832647 TGGGCTCAAGTGACCCCAGGAGG - Intergenic
1010786672 6:80010480-80010502 TGGCCTTTGCTGTCCCCTGTTGG + Intronic
1013025117 6:106263571-106263593 AGGTGTCTGCTGACCCCTGTTGG - Intronic
1013038067 6:106405600-106405622 AGGTGTCTGCTGACCCCTGCGGG - Intergenic
1014105478 6:117556077-117556099 TGGAATCTGCTGCCCCCTGCTGG + Intronic
1015905001 6:138107583-138107605 TGGGTTCTGGTGACACCGGGCGG + Intergenic
1017898645 6:158702415-158702437 TGGTCTCTTCTGCCTCCTGGAGG + Intronic
1018109283 6:160520030-160520052 TGGGGTCTGCTGCCCCCTGCCGG - Intergenic
1018125655 6:160679604-160679626 TGGGGTCTGCTGCCCCCTGTCGG + Intergenic
1018134669 6:160767556-160767578 TGGGGTCTGCCGCCCCCTGCCGG + Intergenic
1018623143 6:165751051-165751073 TGAGCTGTGCTGTCTCCTGGGGG + Intronic
1018805874 6:167259005-167259027 AGGTGTCTGTTGACCCCTGGTGG - Intergenic
1018972073 6:168536712-168536734 TGGGCTGTGCCACCCCCTGGGGG + Intronic
1019303650 7:322272-322294 GGCGCTCTGCTGCCACCTGGTGG - Intergenic
1019386247 7:757806-757828 GGGCCTCAGCTCACCCCTGGAGG + Intronic
1019538541 7:1541138-1541160 TGTGCTCTGGTGACCCGAGGAGG + Exonic
1019546527 7:1579666-1579688 TGGCCTCTGCTGCCCCCCAGAGG - Intergenic
1020246831 7:6435797-6435819 GGGGCTCTGCTGCCCCCTGGCGG + Intronic
1021958617 7:25851778-25851800 TGGGCTCTATTGCCCCCTGGTGG + Intergenic
1022098746 7:27156886-27156908 TGGGGTCTGCGGACGCCAGGCGG + Intronic
1023982103 7:45076274-45076296 AGGGCTTGGCTGAGCCCTGGTGG - Exonic
1024063813 7:45717034-45717056 TGGGCTCCACTCACGCCTGGAGG - Exonic
1024137576 7:46426286-46426308 TGGTCTCTGCTGACCCCTGAGGG - Intergenic
1025265864 7:57456462-57456484 TGGTCTGTGCTGACTCCGGGTGG + Intronic
1025747310 7:64254727-64254749 TGGTCTGTGCTGACTCCAGGTGG + Intronic
1026759437 7:73115407-73115429 CTGGCCCTGCTGACACCTGGAGG + Intergenic
1026809599 7:73451964-73451986 TGGGCTTTGCTGTCCTCTAGTGG + Intronic
1027087973 7:75278066-75278088 CTGGCCCTGCTGACACCTGGAGG - Intergenic
1027768445 7:82375871-82375893 CGGGCTCTCCTGACTCCAGGAGG + Intronic
1029346087 7:99979938-99979960 TGGCCTCTGCTGCCCCCTGCTGG - Intergenic
1029394084 7:100295199-100295221 CTGGCCCTGCTGACACCTGGAGG - Intergenic
1029559099 7:101290580-101290602 TGGCCTCTGCTGCCCCCTGCTGG + Intergenic
1030082813 7:105792066-105792088 TGGGCTCTGCAGGTCTCTGGAGG - Intronic
1032068669 7:128791119-128791141 TGGGCACAGCAGACCCCGGGGGG + Intronic
1032410248 7:131689303-131689325 TGGTCTCTCCTGCCCTCTGGTGG - Intergenic
1032727722 7:134606495-134606517 GGGGCTCTGCTGCCACCTAGTGG + Intergenic
1032965413 7:137091577-137091599 TGGTCTCTGCTGACCCCTCTTGG + Intergenic
1033233341 7:139619055-139619077 TGGTATCTGCTGCCCTCTGGGGG - Intronic
1033742142 7:144283905-144283927 TGTCCACTGCTGTCCCCTGGTGG + Intergenic
1033751760 7:144365709-144365731 TGTCCACTGCTGTCCCCTGGTGG - Exonic
1034116500 7:148588600-148588622 TGAGATATGCTGAACCCTGGCGG + Intergenic
1034892837 7:154855648-154855670 TGGCCTCTGCGGCCTCCTGGAGG - Intronic
1036176224 8:6540951-6540973 TGGGGACTGCTGTCCCCAGGGGG + Intronic
1036590845 8:10166798-10166820 TGGGCTCTGCTGACAGATGAGGG - Intronic
1037945533 8:22987348-22987370 TGGGCTTTGCACAGCCCTGGAGG + Intronic
1038317682 8:26501718-26501740 TGGGTTCTGCTGACCAGCGGTGG - Intronic
1038522392 8:28244391-28244413 TGGGAGCTGCTGAGTCCTGGGGG - Intergenic
1039100372 8:33935043-33935065 GAGACCCTGCTGACCCCTGGAGG + Intergenic
1039442501 8:37604978-37605000 AGGGCTCTGCAGAGCCCTGCTGG - Intergenic
1041873518 8:62661759-62661781 TGGTATCTGCTGAAACCTGGTGG + Intronic
1042167598 8:65960678-65960700 TGGGCTCAGCTGACCTCAGCTGG - Intergenic
1044929159 8:97235163-97235185 GGGGCTCTGAAGCCCCCTGGAGG - Intergenic
1045416101 8:101969095-101969117 TGTGCTCGGCTCAGCCCTGGGGG - Intronic
1048901002 8:139037851-139037873 TGCTCTCTGCTGCCCCCTGCGGG - Intergenic
1049197753 8:141324874-141324896 AGGTCTCTGCTCATCCCTGGAGG + Intergenic
1049537565 8:143189457-143189479 TGGGCTCTCCCCACCCCTGTGGG + Intergenic
1049610822 8:143553956-143553978 TGGGCTCTTCACACCCCTGCTGG + Intronic
1049694625 8:143977258-143977280 TGGGCTCTGCTGACCCCTGGTGG + Exonic
1049697113 8:143989872-143989894 TGGGCGCTGAAGACCCCTGGAGG - Intronic
1049835068 8:144730242-144730264 TGGGCTCTGCTGCCGCCCAGAGG + Intronic
1049991848 9:998580-998602 CCGGCTCTGCTGCCCCCTGGAGG + Intergenic
1049991869 9:998678-998700 CCGGCTCTGCTGCCCCCTGGAGG + Intergenic
1049991890 9:998776-998798 CCGGCTCTGCTGCCCCCTGGAGG + Intergenic
1049991911 9:998874-998896 CCGGCTCTGCTGCCCCCTGGAGG + Intergenic
1049991932 9:998972-998994 CCGGCTCTGCTGCCCCCTGGAGG + Intergenic
1053248620 9:36556001-36556023 TGGGGTCTGCTGCCACCGGGTGG + Intergenic
1053339293 9:37309204-37309226 TGGGCTCTACTGACTCCTTGTGG + Intronic
1053509139 9:38672521-38672543 AGGGCCCTGCTGCCCCCTGCTGG + Intergenic
1053662185 9:40291727-40291749 TGGGCGCTGTTGACCCATGCAGG + Exonic
1053903996 9:42823038-42823060 TGGACTCTCCAGACCCCTGTGGG + Intergenic
1053912630 9:42921895-42921917 TGGGCCCTGCTGACCCATGCAGG + Intergenic
1054374310 9:64437956-64437978 TGGGCCCTGTTGACCCATGCAGG + Intergenic
1054522425 9:66084557-66084579 TGGGCGCTGTTGACCCATGCAGG - Intergenic
1054903033 9:70389483-70389505 TTGGCTGTCCTGACTCCTGGGGG + Intronic
1057217117 9:93235205-93235227 TGGGCAGTGCTTACCCATGGAGG + Intronic
1057700449 9:97360164-97360186 TTGGCTCTACTGAGCCCTGCAGG - Intronic
1057927994 9:99170084-99170106 GCAGCTCTGCTGACCCCTGAGGG + Intergenic
1058082507 9:100714798-100714820 TGGTCTCTACTGCCCCCTGCTGG - Intergenic
1059403086 9:114082664-114082686 AGTTCTCTGCTGCCCCCTGGTGG - Intergenic
1059456539 9:114403418-114403440 TGAGCTCTGCTGACCCAGGGTGG - Intronic
1060213301 9:121723521-121723543 TGGGCTCAGGGGAGCCCTGGAGG + Intronic
1060415129 9:123424642-123424664 TGGGCTCTCCCCACCCCAGGTGG - Intronic
1060794109 9:126503232-126503254 CGGGATCTGCTGACACCTGGTGG - Exonic
1061149005 9:128818509-128818531 TGGGCTCTGCTGCTCCCTTCTGG + Exonic
1061201101 9:129138995-129139017 GGGGGTCTGCGGAGCCCTGGGGG + Intronic
1061675729 9:132214468-132214490 TGGGCTGGGCTCTCCCCTGGAGG + Intronic
1061808101 9:133147671-133147693 TGGGCACTGCCTCCCCCTGGTGG + Intronic
1061817472 9:133205635-133205657 TGGGCTGAGCTGACACCTGAGGG + Exonic
1061864788 9:133486478-133486500 TGGTCTTTGCTGCCACCTGGTGG + Intergenic
1061912001 9:133729888-133729910 TCAGCTCTGCTGACACCTGGTGG + Intronic
1062354404 9:136154815-136154837 TGGGCCCTTCTGACCCTGGGGGG - Intergenic
1062398898 9:136363829-136363851 TGCGCTATGCCGCCCCCTGGCGG + Intronic
1062457380 9:136646070-136646092 TGGGCCCAGCTGCCCTCTGGTGG - Intergenic
1062498200 9:136841454-136841476 TGGGCGCTGCTGACAGCTGGAGG - Intronic
1203768150 EBV:37128-37150 TGGTCGTTGATGACCCCTGGAGG - Intergenic
1203368502 Un_KI270442v1:279251-279273 CTGGCTCTGCAGACTCCTGGGGG + Intergenic
1186965924 X:14786039-14786061 TGGCCTCAGCTGAGCCCAGGTGG + Intergenic
1188197243 X:27251596-27251618 TAGTCTCTGCTGACACCGGGGGG + Intergenic
1189293326 X:39901249-39901271 TGGGGTCTGCTGAACTCTGCTGG + Intergenic
1189503067 X:41582648-41582670 TGGCCTCTGCTGACCTCTCTTGG + Intronic
1191153118 X:57242172-57242194 AGGTGTCTGCTGACCCCTGCTGG - Intergenic
1191766505 X:64704659-64704681 AGGTGTCTGCTGACCCCTGTTGG + Intergenic
1192215679 X:69156609-69156631 TGGGTTTTGCTGATCCCTGGAGG - Intergenic
1195778812 X:108438262-108438284 TGGGCTCTGCTGATGCTTGGAGG + Intronic
1196735427 X:118977309-118977331 GGGGCTTTCCTGGCCCCTGGGGG - Intronic
1197715013 X:129700335-129700357 TGGTCTCTGGAAACCCCTGGAGG + Intergenic
1198645420 X:138801508-138801530 TGGTGTCTGTTGACCCCTGCTGG + Intronic
1198807819 X:140507182-140507204 TGGGCTTTTCTGGGCCCTGGAGG + Intergenic
1199700342 X:150371047-150371069 TGGGCTCTTCATACCCCTGGAGG + Intronic
1199868575 X:151876215-151876237 TGTGCTCTGCTGACGTCTGCAGG - Intergenic
1200091010 X:153635963-153635985 TGGGCCCAGCTGCCCCCAGGTGG - Intergenic
1200100030 X:153685706-153685728 TGGGCTTTTCTGTGCCCTGGAGG - Intronic