ID: 1049694816

View in Genome Browser
Species Human (GRCh38)
Location 8:143977961-143977983
Sequence GTACCACGGCACGACGGCAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 35}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049694816_1049694819 -6 Left 1049694816 8:143977961-143977983 CCGGTGCCGTCGTGCCGTGGTAC 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1049694819 8:143977978-143978000 TGGTACAGCACCTGCTCCACCGG 0: 1
1: 0
2: 0
3: 19
4: 152
1049694816_1049694824 19 Left 1049694816 8:143977961-143977983 CCGGTGCCGTCGTGCCGTGGTAC 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1049694824 8:143978003-143978025 GCCGCTCGCATCGCTGCAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 79
1049694816_1049694820 -5 Left 1049694816 8:143977961-143977983 CCGGTGCCGTCGTGCCGTGGTAC 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1049694820 8:143977979-143978001 GGTACAGCACCTGCTCCACCGGG 0: 1
1: 0
2: 1
3: 22
4: 178
1049694816_1049694826 28 Left 1049694816 8:143977961-143977983 CCGGTGCCGTCGTGCCGTGGTAC 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1049694826 8:143978012-143978034 ATCGCTGCAGCAGGCGCTCCCGG 0: 1
1: 0
2: 0
3: 14
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049694816 Original CRISPR GTACCACGGCACGACGGCAC CGG (reversed) Exonic
900342864 1:2197035-2197057 GTCCCATGGCAGGAGGGCACTGG - Intronic
902561440 1:17280043-17280065 GTACAACTGCCCGAGGGCACTGG - Intronic
903712803 1:25338432-25338454 GAACCACTGCACGACGGGGCTGG + Exonic
924437507 1:244055157-244055179 GCACCACGGCATGGCGGCTCAGG - Exonic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1089536593 11:119164166-119164188 GTACCACTGCACTACAGCCCAGG - Intergenic
1096744863 12:53719481-53719503 GTACCACTGCACTTCAGCACAGG + Intronic
1114461492 14:22888799-22888821 GTACCACTGCACTGCAGCACGGG + Intergenic
1119864283 14:77960360-77960382 GTACCACTGCACTCCGGCATGGG - Intergenic
1161140670 19:2645905-2645927 CTACCATGGCACGAAGACACCGG + Intronic
1162950696 19:14070670-14070692 GTACCACGCCACGCAGGCTCTGG - Intergenic
1166971033 19:46568007-46568029 GTACCACTGCACGCCAGCCCAGG + Intronic
929019347 2:37536124-37536146 GCACCACTGCACTCCGGCACAGG + Intergenic
937321504 2:120963662-120963684 GTATGACGGCAGGAAGGCACAGG - Intronic
1175732438 20:61362957-61362979 GTGACACGGCACAAGGGCACAGG - Intronic
955596444 3:60595692-60595714 CTATAACTGCACGACGGCACTGG - Intronic
971129651 4:23792672-23792694 TTACCACGGCATGAAGGCAATGG + Exonic
972902411 4:43700911-43700933 GTACCATAGCAAGACAGCACCGG - Intergenic
990956443 5:61344760-61344782 GCACCAGGCCACGACGGCACAGG + Intronic
997209800 5:132070579-132070601 GTACCATGGCACCCCCGCACAGG - Intergenic
999141445 5:149365032-149365054 GAACCAGGGCAGGAGGGCACAGG - Intronic
1012010472 6:93778288-93778310 GTACCACTGCACTCCAGCACGGG - Intergenic
1013244847 6:108276717-108276739 GTACCACTGCACTTCAGCACGGG - Intergenic
1026083327 7:67241573-67241595 GTACCACTGCACTCCGGCATGGG - Intergenic
1029381746 7:100219740-100219762 GTAACAAGGCAGGGCGGCACAGG - Exonic
1029401911 7:100352190-100352212 GTAACAAGGCAGGGCGGCACAGG - Exonic
1034697575 7:153067469-153067491 GTACCACGGCACTCCAGCCCGGG + Intergenic
1037864012 8:22428483-22428505 GTACCACGGCACTACAGCCTGGG - Intronic
1042990330 8:74632243-74632265 GGACCACAGCATGACTGCACAGG + Intronic
1044861459 8:96527503-96527525 GTGCCACAGCAGTACGGCACTGG - Intronic
1049694816 8:143977961-143977983 GTACCACGGCACGACGGCACCGG - Exonic
1053824127 9:42002927-42002949 GTACCACTGCACTACAGCATGGG - Intronic
1054606446 9:67184437-67184459 GTACCACTGCACTACAGCATGGG + Intergenic
1057373216 9:94493011-94493033 GTACCACTGCACCACAGCATGGG + Intergenic
1060393867 9:123302056-123302078 GCACCACTGCACGACAGCCCGGG - Intergenic
1062502476 9:136857393-136857415 ATACCACGGCACCATGGCGCTGG + Exonic
1189848675 X:45158239-45158261 GCAGCACGGCAGGAGGGCACTGG + Intronic