ID: 1049695969

View in Genome Browser
Species Human (GRCh38)
Location 8:143984487-143984509
Sequence TTGAGTCCCCAGTAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049695962_1049695969 24 Left 1049695962 8:143984440-143984462 CCATTGCAGAGATGGAGTTTGCA 0: 1
1: 0
2: 1
3: 21
4: 216
Right 1049695969 8:143984487-143984509 TTGAGTCCCCAGTAGGAGGAGGG 0: 1
1: 0
2: 1
3: 12
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049695969 Original CRISPR TTGAGTCCCCAGTAGGAGGA GGG Intronic
901065666 1:6493050-6493072 TGGAGTTCCCACTGGGAGGAGGG - Intronic
902359151 1:15932613-15932635 GAGAGTCCCCAAAAGGAGGATGG + Exonic
902782700 1:18714994-18715016 TGGGGTCCCCTGCAGGAGGAAGG + Intronic
903374208 1:22855511-22855533 CTGAGTCCCCAGTAGGTGCCAGG - Intronic
903543178 1:24108190-24108212 CTGAGACCCCAGTATGAGGAGGG - Intronic
904629763 1:31832064-31832086 TGGATTCCCCAGATGGAGGAAGG - Intergenic
906034478 1:42741768-42741790 TTGCGGCCCCAGTAGGATGGAGG - Intergenic
907482924 1:54757164-54757186 CTGAGGCCCCAGCAGGGGGAGGG + Exonic
908316392 1:62937024-62937046 TTGTGTTGACAGTAGGAGGAAGG + Intergenic
909676946 1:78249231-78249253 ATGACTCTTCAGTAGGAGGAAGG + Intergenic
912474806 1:109928615-109928637 CTGATTCCCCAGGAGGAGGTAGG + Intronic
913128435 1:115815051-115815073 TTTATTCTCTAGTAGGAGGAGGG - Intergenic
916739271 1:167634025-167634047 TTGAGTCTCCAGAATGAGCACGG + Intronic
919797983 1:201332702-201332724 TTGGGTCCCCAGGAGGAGTGTGG - Exonic
920054256 1:203181139-203181161 GTGAGTTCCCAGAAGGAGGGAGG - Intronic
922953357 1:229578077-229578099 TTGAGTCCCCACTATGAGCAAGG + Intergenic
922973839 1:229766984-229767006 TTGGGACTCCAGTAGGAGGATGG + Intergenic
923310270 1:232728255-232728277 TAGGGTCCCCATTAGCAGGAAGG - Intergenic
1062809643 10:452930-452952 CTGAGGCCCCAGTGCGAGGAAGG + Intronic
1063563969 10:7155842-7155864 TTGAGTGCACAGCAGGTGGAAGG - Intergenic
1063716597 10:8533531-8533553 CTGAGGCCACAGTACGAGGAGGG + Intergenic
1065128791 10:22600009-22600031 TGGAGCCCCCAGAAGGGGGAAGG + Intronic
1066547068 10:36511184-36511206 GTGAGTCCCCAGCGGGAAGACGG + Intergenic
1067465511 10:46495292-46495314 TAAAGCCCCCAGCAGGAGGAAGG + Intergenic
1067621676 10:47889309-47889331 TAAAGCCCCCAGCAGGAGGAAGG - Intergenic
1067965682 10:50910180-50910202 TGGAGTCCACAGAAAGAGGATGG + Intergenic
1070457018 10:76627336-76627358 TCCCTTCCCCAGTAGGAGGAAGG - Intergenic
1071495280 10:86163749-86163771 TTGAGTCCCCACTCGGTGGCAGG + Intronic
1072633848 10:97164882-97164904 TTGAGTTCCCTGGAGGAAGAAGG + Exonic
1075229199 10:120658369-120658391 TTGAGTAGCCAGGAGGAGCAGGG + Intergenic
1077539572 11:3140180-3140202 TTGAGTCCTCAGAAGGAGGGAGG + Intronic
1079459072 11:20663966-20663988 TAGAGTCCCCACTAGCAAGAAGG - Intergenic
1079675680 11:23223409-23223431 CTGAGTCCCCTGTAGGTTGAGGG + Intergenic
1080654233 11:34245965-34245987 TTGTGGCCCCAGGATGAGGAGGG - Intronic
1082772261 11:57217205-57217227 CTGCTTCCCCAGGAGGAGGAAGG - Intergenic
1083827131 11:65210248-65210270 TTGGGTCCCCAGGAGGGGGCTGG - Intronic
1084683567 11:70680842-70680864 GAGAGTCCCCACAAGGAGGACGG - Intronic
1084898880 11:72294967-72294989 TTGAGTCCTGACTTGGAGGAAGG + Intronic
1085535749 11:77216325-77216347 CTGATTCCCCAGTAAGAGGGTGG - Intergenic
1085593183 11:77784106-77784128 TTGAGATCCTAGAAGGAGGATGG - Intronic
1086869638 11:92021473-92021495 TTGAAACTCCAGAAGGAGGAGGG - Intergenic
1087071512 11:94086103-94086125 GTGAGTCCCTCGTAGGTGGATGG - Exonic
1087272012 11:96121391-96121413 ATGATTCCCCAGTAACAGGAAGG + Intronic
1087281799 11:96219169-96219191 TTGAGTGCCCAGTATGTGAAGGG - Intronic
1087714016 11:101585866-101585888 TTGAGTACCCAGAAGGAATAAGG + Intronic
1091587305 12:1823527-1823549 AGGAGGCCCCAGTAGGAGCAGGG - Intronic
1094116019 12:26913778-26913800 TTAAGTACCAAGTAAGAGGAAGG - Intronic
1095611776 12:44137400-44137422 TTGATTTCCTAGTAGGAGGAGGG + Intronic
1097978466 12:65712609-65712631 TTGAGTCCCCCAGAGAAGGAAGG - Intergenic
1097996082 12:65888990-65889012 CTGTGTCCACACTAGGAGGAAGG + Intronic
1098833102 12:75387659-75387681 CAGAGTCCCCAGTAGCAAGAAGG - Intronic
1100971506 12:100075941-100075963 TGGAGACCCCAAAAGGAGGATGG + Intronic
1103969410 12:124660666-124660688 GTGAGCCCCCAGTGGCAGGAGGG - Intergenic
1113523388 13:110955860-110955882 TTGAGTACCCAGAAAGTGGACGG + Intergenic
1113701916 13:112394636-112394658 TTGAGTACCCAGAAAGTGGACGG - Intronic
1114051482 14:18922050-18922072 CTCAGTCACCAGCAGGAGGAGGG - Intergenic
1114111079 14:19479874-19479896 CTCAGTCACCAGCAGGAGGAGGG + Intergenic
1114631764 14:24163866-24163888 CTGTGTCCGCAGGAGGAGGAGGG + Exonic
1118922089 14:70158815-70158837 TTGGGTCCCCAGTAAGTGGTAGG + Intronic
1119291960 14:73502405-73502427 TTGAGTGCCCAGTAGGTGTGAGG - Intronic
1120964968 14:90158905-90158927 GTGGGTCCCCAGTTGGAAGAGGG + Intronic
1121526251 14:94621450-94621472 CTGAGTCCCCTGAAGGAGGAAGG - Intronic
1122276416 14:100592983-100593005 GGGACTCCCCAGAAGGAGGAGGG - Intergenic
1128263723 15:66251223-66251245 TTGAGTCCTAAGAAGGAGGCAGG - Intronic
1128692656 15:69737015-69737037 TTGTATCCACAGAAGGAGGAAGG + Intergenic
1129261093 15:74367721-74367743 TTGAGCCTGCAGCAGGAGGAAGG - Exonic
1132031695 15:98443969-98443991 TTGAGTCCCTTGAAGGAAGAAGG - Intronic
1137037311 16:35577711-35577733 TTGAGCCCCCACTAGGAGCCAGG + Intergenic
1137532438 16:49287906-49287928 TTGAGTCCAGGGGAGGAGGATGG - Intergenic
1141532966 16:84659517-84659539 CTGAGTCCCCAAAAGGGGGATGG - Intronic
1144579236 17:16448764-16448786 TTGAGGACACAGGAGGAGGAGGG + Intronic
1147878598 17:43639360-43639382 TTGAGTTTCCAGCAGGAGGGTGG + Intergenic
1148227538 17:45909331-45909353 TTGTGGGCCCAGTAGGAGGCAGG - Intronic
1149680385 17:58503015-58503037 ATGGGTTCCCAGCAGGAGGATGG - Intronic
1151716552 17:75834133-75834155 TTGTGTCTCCAGTTGGAGGTGGG - Exonic
1152089566 17:78239248-78239270 CTGAGTCCCCAGCAGGTGGGAGG + Exonic
1152703590 17:81831926-81831948 TTGGGTCCCCTGGAGGAGGAAGG - Intronic
1152824569 17:82456560-82456582 TTGAGTCCTGAGTAGCAGGTTGG - Intergenic
1153732133 18:8024921-8024943 TTGAGGCCAAAGCAGGAGGATGG - Intronic
1153873795 18:9346657-9346679 GGGAGGCCACAGTAGGAGGATGG + Intronic
1155921816 18:31611060-31611082 TTCACTCCCCAGGAGGGGGAGGG + Intergenic
1157401864 18:47395453-47395475 CTGTGTTCCCAGCAGGAGGAAGG + Intergenic
1157762518 18:50275106-50275128 GTGAGGCCCCAGTGGGTGGAGGG - Intronic
1159017087 18:63110168-63110190 CTGAGTCCCAAGTGGGAGAAAGG - Intergenic
1159564260 18:70031359-70031381 ATGTGTCCCCAGAAGGAGAAAGG - Intronic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1160178232 18:76613096-76613118 TTGAGTCCCCAGTAGCAAGAAGG - Intergenic
1162646418 19:12053252-12053274 TTGTGTCCCGTGTAGGATGAAGG - Intergenic
1162685991 19:12384816-12384838 TAGAGTCCCCACCAGCAGGAAGG + Intronic
1164712795 19:30369957-30369979 TTGTGTCCACAGTGGGGGGATGG + Intronic
1164745191 19:30606922-30606944 TGGAGGCCCCAGCAGGAGAAAGG + Intronic
1167149919 19:47702479-47702501 TCGAGTCCCCAGGAGGCTGAGGG - Exonic
1167677997 19:50900489-50900511 AGGAGTCCCCAGTGGTAGGAAGG - Intergenic
1167893694 19:52563426-52563448 TGGAGTCTGCAGTGGGAGGATGG + Intronic
1167932609 19:52878787-52878809 TGGAGTCTGCAGTGGGAGGATGG - Exonic
1168412482 19:56148336-56148358 CTGAGTCCCCAGTGGCAGGAGGG + Intronic
927213339 2:20651735-20651757 TTGGGTCCCCAGCTGGAGCAGGG + Intergenic
931447793 2:62341397-62341419 TTGAGTCTCCAGTGAGAGGGAGG + Intergenic
932057071 2:68456550-68456572 TTGAGGACCCAGTAGAGGGAAGG - Intergenic
936111924 2:109671570-109671592 TTCAGGCACCAGCAGGAGGAGGG - Intergenic
947523541 2:230865527-230865549 TCGAGTCCCCAGGTGGGGGATGG + Intronic
947781340 2:232767126-232767148 TTTATTCACCAGTAGGAGGTTGG - Exonic
947859906 2:233351459-233351481 TTGATTCCCGGGTAGGAGGAGGG - Intergenic
948468980 2:238165439-238165461 CCGAGTCCCCAAGAGGAGGAAGG - Intronic
948554394 2:238797434-238797456 TGGGGTCCACAGGAGGAGGACGG + Intergenic
1171266518 20:23776087-23776109 TGGAGCCCCGAGGAGGAGGAAGG - Intergenic
1173495079 20:43513047-43513069 CTGAATCCCCAGAGGGAGGAGGG + Intronic
1174072882 20:47910975-47910997 TTGAGTCCTGAGGAGGGGGAAGG - Intergenic
1176296640 21:5076660-5076682 GTGAGTGACCAGGAGGAGGAGGG + Intergenic
1179860409 21:44185461-44185483 GTGAGTGACCAGGAGGAGGAGGG - Intergenic
1180469955 22:15644426-15644448 CTCAGTCACCAGCAGGAGGAGGG - Intergenic
1180922833 22:19530750-19530772 CTGACACCCCAGTAGGAGGCTGG - Intergenic
1181117109 22:20638975-20638997 TTGAGTCCCCACAAGTAGGTGGG + Intergenic
1182685441 22:32119546-32119568 CTCAGGCCCCAGAAGGAGGAGGG + Intergenic
1183036291 22:35143269-35143291 CTGAGTCACCACTTGGAGGAGGG + Intergenic
1184871690 22:47244803-47244825 TTGAGTCCCCAGCAAGGCGAAGG + Intergenic
949406229 3:3717600-3717622 TGGAGTCCTCAGAAAGAGGATGG + Intronic
949650867 3:6157529-6157551 TTCAGTTCCCAGTAGGATGCTGG + Intergenic
950457247 3:13100044-13100066 GAGAGTTCCGAGTAGGAGGATGG + Intergenic
951317392 3:21203951-21203973 TTGAGGCCCCTGTAGGTTGAGGG + Intergenic
955369179 3:58336283-58336305 CTGAGTCACCAGAAGGATGAAGG + Intronic
955935764 3:64100968-64100990 TGGAGGCCCCAGTAGGAGACAGG - Intronic
956255505 3:67279058-67279080 TTGAGACAACACTAGGAGGATGG - Intergenic
957723317 3:84032166-84032188 GTGAGTGCCCAGAAGGAGGCAGG + Intergenic
962381577 3:134902340-134902362 TTGAGTCACTGGCAGGAGGAAGG + Intronic
965787525 3:172351790-172351812 TTGAGTGCTCTGAAGGAGGAGGG + Intronic
967235788 3:187382495-187382517 TTAATTCCCCAGTATGGGGAGGG - Intergenic
969214378 4:5710735-5710757 CTCAGTCTCCACTAGGAGGATGG - Intergenic
970424855 4:15936582-15936604 CTGAGCAGCCAGTAGGAGGAAGG + Exonic
972059746 4:34854641-34854663 TTGACACCCCAGTAGCAGGCTGG + Intergenic
972171406 4:36350103-36350125 TTGAGTACACAGGAGGAGGGTGG - Intergenic
973137260 4:46724061-46724083 TTTAGTTCCCACTAGGATGATGG + Intergenic
975496463 4:75040972-75040994 AGGAGTTCCCAGTAGGAGGTGGG - Intronic
976872541 4:89812847-89812869 ATGAGTCCCCACTCAGAGGAAGG - Intronic
978295773 4:107203578-107203600 TTTAGTTCCCACTAGGATGATGG + Intronic
980967708 4:139539148-139539170 TTTAGGCCCCAGGAGGCGGAAGG - Intronic
981768936 4:148284232-148284254 TTGAATCCCCAGCAAGAGGGGGG - Intronic
981980188 4:150782441-150782463 TGGAGTCTCCAGAAGGAGAATGG - Intronic
982464096 4:155708815-155708837 TTGAGGCCCCCCTAGGAGCAAGG + Intronic
985025393 4:185734777-185734799 TTGAAGCCCCAGTAGGGAGAAGG - Intronic
986464366 5:8006640-8006662 TTGAGTCCCCAAAAGCAAGAAGG + Intergenic
990496248 5:56350787-56350809 TTCAGTCCCAAGTATGAGAAAGG + Intergenic
991504301 5:67308162-67308184 TTCTGTCAACAGTAGGAGGAAGG - Intergenic
992257002 5:74931007-74931029 TGGAGTCTGCAGTGGGAGGATGG + Intergenic
995693813 5:114857719-114857741 TTGATTTCCCAGTACGAGGGAGG + Intergenic
998782390 5:145672356-145672378 TTGATTCCCAAGATGGAGGAAGG - Intronic
1000562048 5:162801417-162801439 TTGAGTCACTATTTGGAGGAGGG + Intergenic
1004744832 6:18499434-18499456 TTGAGTGCTGAGAAGGAGGAGGG + Intergenic
1006207646 6:32362380-32362402 GAGAGTCCCCAGTAGCAAGAAGG + Intronic
1007959737 6:45947723-45947745 TTGAGTCCCGGGGAGGGGGATGG + Intronic
1008960468 6:57260977-57260999 TGGAGGCCCCAGTGAGAGGAGGG + Intergenic
1014459024 6:121673092-121673114 TGGTGTCCCCAGTGGCAGGACGG - Intergenic
1015107201 6:129550914-129550936 CTGAGTCCCCACTATGTGGAAGG - Intergenic
1015729766 6:136335588-136335610 TTGAGTCCCGAGTTGGGGCAGGG + Intergenic
1017598999 6:156060628-156060650 GAAAGTCCCCAGTAGGAGAAGGG + Intergenic
1017941202 6:159054872-159054894 TTGAGTCCCCACAAGGTGCATGG + Intergenic
1020241941 7:6401905-6401927 TTTAGTTCCCACTAGGATGATGG - Exonic
1020668144 7:11073199-11073221 TTGAGTCCCCAGTAAGACACTGG - Intronic
1022197742 7:28084995-28085017 TAGAGTCCCCACTTGGAGGAAGG + Intronic
1023981780 7:45074634-45074656 TTGAGTTCCCAGGAGAATGAAGG - Intronic
1024673350 7:51616531-51616553 CAGAGTCCCCACTAGCAGGAAGG - Intergenic
1024921657 7:54563509-54563531 CAGTGTCCCCAGCAGGAGGAAGG + Intronic
1026743050 7:72990660-72990682 TTGAGACCCCAGAAGGAAGGTGG - Intergenic
1027029165 7:74875364-74875386 TTGAGACCCCAGAAGGAAGGTGG - Intergenic
1027100685 7:75374418-75374440 TTGAGACCCCAGAAGGAAGGTGG + Intergenic
1029367304 7:100124898-100124920 TTGAGCCCCCAGGAGGGGAAGGG + Exonic
1030231443 7:107211937-107211959 TTGAATCCCAAGTAGTAAGATGG + Intronic
1033455714 7:141501679-141501701 TGAAGTCCCCAGAAGGAGAAGGG + Intergenic
1033865414 7:145685716-145685738 TTGTGTCCCCAGTGGGAAGAAGG + Intergenic
1034422732 7:150997872-150997894 TGGAGGCCCCAGGAGGAGGCTGG - Intronic
1035112184 7:156492341-156492363 TTGTGTCCCCAGCAGGACGCAGG + Intergenic
1042539973 8:69898253-69898275 TTGAGCCCCCAATAGAAGAAGGG + Intergenic
1045492402 8:102680218-102680240 TGGAGGCCGAAGTAGGAGGATGG - Intergenic
1046083641 8:109403938-109403960 TTGGGTACACAGTAGGATGAGGG + Intronic
1048599342 8:135902462-135902484 TAGAGTCCTCAGAAGGAGCACGG - Intergenic
1049695969 8:143984487-143984509 TTGAGTCCCCAGTAGGAGGAGGG + Intronic
1051457741 9:17280005-17280027 TAGAGTCCCCATGAGGAAGAAGG + Intronic
1058756568 9:108088210-108088232 CTGAGTCCCCAGGAGGAGAAGGG - Intergenic
1060192682 9:121603091-121603113 CAGAGGCCACAGTAGGAGGATGG - Intronic
1060235758 9:121861616-121861638 CTTAGTCTCCAGAAGGAGGAGGG + Intronic
1062020172 9:134315680-134315702 CTGAGTCCCCAGAAGAAGGGAGG - Intergenic
1062552225 9:137094374-137094396 TTGAGTCCACAGTGGAAGGTCGG - Intronic
1062581767 9:137232010-137232032 TTGTGCCCCCAGTTGGAGGGAGG + Intronic
1185894773 X:3848082-3848104 TTCAGTACCCAGAAGGAGAAAGG + Intergenic
1185899891 X:3886507-3886529 TTCAGTACCCAGAAGGAGAAAGG + Intergenic
1185905007 X:3924935-3924957 TTCAGTACCCAGAAGGAGAAAGG + Intergenic
1189082366 X:37988293-37988315 TAGAGTCCCCAGAGGGAGTATGG + Intronic
1190282806 X:48942061-48942083 TGAAGGCCCCAGTGGGAGGAAGG + Intronic
1193151914 X:78134343-78134365 TTGAGTACCTATTAGGAGCAAGG - Intronic
1195462693 X:105145432-105145454 TTGAGTACACAGAAGGAGGCAGG + Intronic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1197492750 X:127138955-127138977 TTGAGTTCCCAGGAGGGGGTTGG - Intergenic
1198029889 X:132744718-132744740 GAGAGCCCTCAGTAGGAGGAGGG - Intronic
1200115705 X:153768861-153768883 AGGAGCCCCCACTAGGAGGAGGG + Intronic
1201776143 Y:17668188-17668210 TGGAGTCCACAGTAGCAGGCAGG + Intergenic
1201825413 Y:18237804-18237826 TGGAGTCCACAGTAGCAGGCAGG - Intergenic
1202264790 Y:23006771-23006793 TGGAATCCCCAGTGGAAGGAGGG - Intergenic
1202417781 Y:24640513-24640535 TGGAATCCCCAGTGGAAGGAGGG - Intergenic
1202453005 Y:25029573-25029595 TGGAATCCCCAGTGGAAGGAGGG + Intergenic