ID: 1049699804

View in Genome Browser
Species Human (GRCh38)
Location 8:144005252-144005274
Sequence GATGAGCTGCTGAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049699798_1049699804 -3 Left 1049699798 8:144005232-144005254 CCAGCATCCACCAAGTCCGAGAT 0: 1
1: 0
2: 0
3: 7
4: 94
Right 1049699804 8:144005252-144005274 GATGAGCTGCTGAAGGTGGATGG No data
1049699799_1049699804 -10 Left 1049699799 8:144005239-144005261 CCACCAAGTCCGAGATGAGCTGC 0: 1
1: 0
2: 0
3: 10
4: 88
Right 1049699804 8:144005252-144005274 GATGAGCTGCTGAAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049699804 Original CRISPR GATGAGCTGCTGAAGGTGGA TGG Intronic
No off target data available for this crispr