ID: 1049702323

View in Genome Browser
Species Human (GRCh38)
Location 8:144020882-144020904
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 628
Summary {0: 5, 1: 10, 2: 31, 3: 83, 4: 499}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049702323_1049702332 1 Left 1049702323 8:144020882-144020904 CCCTCTTCCCTCAGGACCCTCTT 0: 5
1: 10
2: 31
3: 83
4: 499
Right 1049702332 8:144020906-144020928 CCTCAGGACCTTCTCCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049702323 Original CRISPR AAGAGGGTCCTGAGGGAAGA GGG (reversed) Intronic
900176839 1:1294833-1294855 AAGGGGGTCCTGAGGGTGGGAGG + Intronic
900313781 1:2047389-2047411 GAGAGGGCCCTGAGGGCAGAGGG - Intergenic
900742780 1:4340748-4340770 AGGTGGGACCTGGGGGAAGACGG + Intergenic
900917750 1:5650533-5650555 TAGCGGGGCCTGGGGGAAGATGG + Intergenic
901001387 1:6150614-6150636 AAGAAGGGACTGAGGGAAGGAGG + Intronic
901240005 1:7687396-7687418 AGGAAGGTCCTGAGGCAAGAGGG + Intronic
901318547 1:8324794-8324816 CTGAGGGTCCTGAGGGGAGAAGG + Intronic
902201371 1:14836124-14836146 AACTGGCTCCTGAGAGAAGAGGG + Intronic
902801975 1:18836125-18836147 AGGAGGTTCCTGAGGCAGGAGGG + Intergenic
903406336 1:23099927-23099949 GTGAGGGACCAGAGGGAAGAGGG - Intronic
903682218 1:25104628-25104650 AAGAGGCTCCTGAAGGAAGAGGG + Intergenic
903789400 1:25882240-25882262 AAGAGGTTCCGGAGTCAAGAAGG - Intergenic
904128374 1:28258714-28258736 GAGAGTGTCTGGAGGGAAGAGGG + Intergenic
904259290 1:29279277-29279299 AGGAGGGTCCTGAAGGCAGGAGG + Intronic
904803969 1:33118119-33118141 AAGAGGGCCCTGCTGGAAAATGG + Intronic
904927344 1:34059371-34059393 ATGAGGGGGCTGAGGGAAGAGGG - Intronic
905313562 1:37066838-37066860 AAGAGGGGAATGAGGGAGGAAGG - Intergenic
905610655 1:39347881-39347903 AAGAGAGTTGTGATGGAAGATGG - Intronic
906066505 1:42984836-42984858 GAGATGGGGCTGAGGGAAGAAGG + Intergenic
906196392 1:43933137-43933159 AAGTGGGTACTGAGGGCTGAAGG - Intergenic
906346847 1:45021023-45021045 AAAAGGATCCTGAGGGTAGAGGG - Intronic
906863631 1:49391042-49391064 AAAAGAGTGCTGAAGGAAGAAGG + Intronic
907823982 1:57997687-57997709 AAGTGGGGTCTGAGGGGAGAAGG + Intronic
907923647 1:58935758-58935780 AGGAGGCTTCTGAGGCAAGAAGG + Intergenic
909481364 1:76131390-76131412 AAGGGACCCCTGAGGGAAGACGG + Intronic
910405394 1:86883789-86883811 AAGTGGGGCCTGAGGTAAGCAGG - Intronic
910689949 1:89955455-89955477 ATGAAGGTCTTCAGGGAAGAGGG - Intergenic
911110470 1:94178742-94178764 TAGTGGGTACTGAAGGAAGATGG + Intronic
912957485 1:114165683-114165705 AAGAGGCCCATGAGGGAAGGAGG + Intergenic
913220225 1:116654243-116654265 CAGAGGCTCCTGAGGGCAGCAGG + Intronic
915298508 1:154938699-154938721 AAGCGGATGCTGAGGGATGAGGG - Intergenic
915734929 1:158078606-158078628 AGGAGGCAGCTGAGGGAAGAAGG - Intronic
916231061 1:162541801-162541823 AACAGAGAACTGAGGGAAGAGGG - Intergenic
916291015 1:163166178-163166200 AAGAGGGTCCACAGGGAAAAAGG + Intronic
916426435 1:164685579-164685601 AAGAGGGTCCAGAGACAAAAGGG + Intronic
916490000 1:165293775-165293797 AAAAGGGGCCTGAGGGAGGCTGG - Intronic
916687725 1:167162306-167162328 GAGTGGGGCCTGAGGCAAGAGGG - Intergenic
917337300 1:173938772-173938794 CAGAGGACCCTGAGGGAGGAGGG - Exonic
917478494 1:175389387-175389409 ATGAGGGTCCTCAAGGGAGAAGG - Intronic
917530592 1:175831490-175831512 GAGAGTGGGCTGAGGGAAGATGG + Intergenic
918424385 1:184393299-184393321 ACAGGGGCCCTGAGGGAAGAAGG - Intronic
921395944 1:214669742-214669764 AAGTGGGTCCTGATTTAAGAAGG + Intergenic
921751230 1:218796381-218796403 AAGAGGGCCCTGGAGGAAGAAGG + Intergenic
921764105 1:218950448-218950470 AAGGGGGTCTTAAGGGAAAAAGG - Intergenic
923686998 1:236160435-236160457 AGGAGGGGTCTGAGGGAACATGG - Intronic
924137122 1:240980363-240980385 AAGAGGGTTTTGTGGCAAGATGG - Intronic
924258823 1:242209279-242209301 CAGGGAGTCCTGTGGGAAGACGG - Intronic
924382268 1:243475445-243475467 AAGAGGCGCCGGAGGGAAGGGGG - Intronic
1062931740 10:1357398-1357420 AGGAGGGTCCCGTGGGAAGAGGG - Intronic
1064824153 10:19376338-19376360 AAGAGGCTCCTCAGAGAAGCAGG - Intronic
1065134987 10:22659084-22659106 CAGAGGGACCTGAGGCCAGAGGG - Intronic
1065411856 10:25438003-25438025 AATAGGGTCCTGAGTGCAGGTGG + Intronic
1065485955 10:26236839-26236861 ATGAGGGCCCTGAGGTGAGAAGG - Intronic
1066094884 10:32062627-32062649 AGGTGGGACCTGAGGAAAGACGG - Intergenic
1066438510 10:35415512-35415534 AGCTGGGTCCTGAGGGCAGAAGG + Intronic
1066466802 10:35658926-35658948 AAGAGGGGCCTAAAGGCAGAGGG - Intergenic
1067128520 10:43540837-43540859 AAGAGAGACCTGAGGAAGGAGGG - Intergenic
1068659756 10:59611900-59611922 AATCTGGTCCTGAGGCAAGAGGG - Intergenic
1069558895 10:69415907-69415929 AAGAGGGTCCTTGGGGAAGCTGG - Intronic
1069915570 10:71784684-71784706 AAGAGGATGATGAGGGAAGCAGG - Intronic
1069984167 10:72272767-72272789 AGGAGGACCCTGATGGAAGAGGG - Intergenic
1070701217 10:78602983-78603005 ATGATTGTCCTGAGGGAACAAGG - Intergenic
1070777496 10:79118401-79118423 GAGAGTGTCCTGTGGGAAGCGGG + Intronic
1071969240 10:90886281-90886303 AAGAGAGTCAAGAGGGAACAGGG + Intronic
1072186656 10:93046511-93046533 AAGAGCTACCTGAGTGAAGAAGG + Intronic
1072571905 10:96665752-96665774 CAGAGGTTACTGAGGAAAGAAGG + Intronic
1072728722 10:97830433-97830455 AGTAGGGTCCTGAGGCCAGATGG + Intergenic
1073051333 10:100669382-100669404 GAGAGGGTCCTGGGAGAGGAAGG - Intergenic
1073819739 10:107247882-107247904 AACATGCTCCAGAGGGAAGAAGG + Intergenic
1074051232 10:109882855-109882877 AAGAGGGTCATCAGTGAAGGAGG - Intronic
1074873280 10:117594724-117594746 AAAATGCTCCTGGGGGAAGAGGG - Intergenic
1076110386 10:127855466-127855488 AAGAGGGGCCTGTGGGGACAAGG - Intergenic
1077278970 11:1733400-1733422 GAGGGGGTGCTCAGGGAAGAGGG - Exonic
1077391851 11:2303944-2303966 CAGACGGCCCTGAGGGAAGGAGG - Intronic
1077410860 11:2403318-2403340 AAGAGGGTCCTGGGGAAGGTGGG + Exonic
1078731903 11:13982665-13982687 AAGAGGGAGCTGGGTGAAGAGGG + Intronic
1079138009 11:17787254-17787276 AAGAGGGCCCTCGGGTAAGATGG - Intergenic
1079666236 11:23109538-23109560 AATAGGGTACTGGAGGAAGACGG + Intergenic
1080972465 11:37294841-37294863 TAGAGGGTCAGGAGGGGAGAGGG + Intergenic
1081854467 11:46295105-46295127 GCCAGGGACCTGAGGGAAGAGGG + Intronic
1083756987 11:64797095-64797117 GGGAGGATCCTGAGGTAAGAGGG - Exonic
1083789908 11:64977771-64977793 ATGGGGGACCTGAGGCAAGAAGG - Intergenic
1083936750 11:65873368-65873390 AAGACGGTCCTGGGGGTGGAGGG - Intronic
1083945271 11:65919711-65919733 AAGGGGGTGCTGGGGGAGGAAGG - Intronic
1084937368 11:72594317-72594339 CAGAGGGTGCAGAAGGAAGATGG - Intronic
1085038789 11:73314863-73314885 ATCAGGGACCTGAGGGCAGAAGG - Intronic
1085326525 11:75610753-75610775 AAGAGGGTGCTGGGTCAAGAGGG + Intronic
1085344704 11:75761061-75761083 AAGAGGGTTCTGGGGGAATCAGG - Intronic
1085632635 11:78131842-78131864 ATGAAGGGCCTGAGTGAAGATGG - Intronic
1087369311 11:97261629-97261651 CAGAGGTGCCCGAGGGAAGATGG - Intergenic
1087970140 11:104470429-104470451 AAGAGGATCGAGATGGAAGAAGG + Intergenic
1088502491 11:110496749-110496771 AACAGGGCCCTGAAGGAACAAGG + Intergenic
1088511343 11:110578987-110579009 AATAGGGGCCTGAGGAGAGAGGG - Exonic
1088585591 11:111357702-111357724 AGGAAGGACCTGTGGGAAGAAGG + Exonic
1089764530 11:120753011-120753033 GAAGTGGTCCTGAGGGAAGATGG + Intronic
1091575387 12:1728871-1728893 AAGAGAGTCAAGATGGAAGATGG - Intronic
1091637234 12:2206230-2206252 AAGGAGATCCAGAGGGAAGAAGG + Intronic
1091683125 12:2540962-2540984 CTGAGGGTCATGAGGGAAAAGGG + Intronic
1091845570 12:3653764-3653786 AAGAGGGACCAGAGGGAAGCAGG - Intronic
1092170335 12:6370372-6370394 AAGAGGGGCTAGAGGGGAGAGGG - Intronic
1093120913 12:15270528-15270550 AAGAGGGCCAGGAGTGAAGAGGG + Intronic
1093216021 12:16361911-16361933 AAGAGGACCATGAGGGTAGAGGG - Intronic
1093853735 12:24072552-24072574 AAGTGTGTCCTGGGGGATGACGG + Intergenic
1094443549 12:30505665-30505687 AAGAGGGTTCAGGGTGAAGAGGG - Intergenic
1094601238 12:31910887-31910909 AAGAGGTAACTGAGGCAAGATGG + Intergenic
1095814536 12:46406985-46407007 AAGTGGGTGGGGAGGGAAGATGG - Intergenic
1096439983 12:51633134-51633156 AAGAGGGTGCTGAGGGGAGGAGG + Intronic
1096843001 12:54390649-54390671 AAGAGGGGCTTGGGAGAAGAGGG - Intronic
1097263097 12:57730717-57730739 AAGAGGGGTAAGAGGGAAGAGGG - Intronic
1100387725 12:94119175-94119197 GAGAAGGTCCTGAGAGAATAGGG - Intergenic
1100548390 12:95624346-95624368 GAATGGGTCCTGATGGAAGAAGG - Intergenic
1102039689 12:109792839-109792861 AAGAGAGGCCAGAGGGGAGAGGG + Intronic
1102582332 12:113897829-113897851 AAGAGGTTGCTCAGTGAAGAGGG - Intronic
1102688775 12:114744161-114744183 AAGGGGATCCTGTGGGAAAAGGG + Intergenic
1105256154 13:18745077-18745099 AAGCGGGACCTGGGAGAAGAGGG + Intergenic
1105806644 13:23955346-23955368 AAGAGGGTGCTGAGAAAGGACGG + Intergenic
1106248026 13:27965170-27965192 CAGAGGGTCCTGTGGGGGGAGGG + Intronic
1106402028 13:29440644-29440666 CAGATGGTCGAGAGGGAAGATGG - Intronic
1106763999 13:32895534-32895556 AAGAGGCTGATGCGGGAAGATGG - Intergenic
1111057224 13:82967194-82967216 AGGAGGAACATGAGGGAAGATGG + Intergenic
1111957667 13:94776119-94776141 TAGATGCTGCTGAGGGAAGAAGG + Intergenic
1113365155 13:109669034-109669056 GAGAGGAGCCTGAGGGAGGAAGG + Intergenic
1113645992 13:111996357-111996379 AGGAGGGTCCTGTGGGAGTATGG - Intergenic
1113931464 13:113971179-113971201 AAGGGGGTGTTGTGGGAAGAGGG - Intergenic
1115350143 14:32385125-32385147 CAGAGTGTCATGAGGCAAGATGG - Intronic
1115640512 14:35332810-35332832 AAGAGGGAACCCAGGGAAGAAGG + Intergenic
1115954149 14:38758872-38758894 AAGAGGGTCCAAAGGGATGGCGG + Intergenic
1116075936 14:40111045-40111067 AAGACTGTCCTGAGGGTAAAAGG + Intergenic
1116277894 14:42860215-42860237 CAGAGGATGCAGAGGGAAGAGGG + Intergenic
1116484233 14:45427660-45427682 AAGAGGGACCTGGGGCAAGAAGG + Intergenic
1116677841 14:47927849-47927871 GAAAGTGTCCAGAGGGAAGAAGG + Intergenic
1117236748 14:53786111-53786133 AGGAGTGTACTGAGGCAAGATGG - Intergenic
1117583826 14:57179752-57179774 AAGAGAGACCTGAGGGATCATGG + Intergenic
1118347089 14:64948303-64948325 ACGGGCCTCCTGAGGGAAGAGGG + Exonic
1118982601 14:70728859-70728881 CAGAGAGTCTTGAGGGAAGAGGG + Intronic
1119382057 14:74235496-74235518 AAGAGGGTGATTAGGGAAGAGGG - Intergenic
1119436690 14:74602008-74602030 AAGAGGGGCCTGTGGGAGGAAGG + Intronic
1119919431 14:78432672-78432694 AAGAGGAAGGTGAGGGAAGAAGG - Intronic
1120154397 14:81076623-81076645 AAGTGGGTGATGAGGAAAGAAGG - Intronic
1120266757 14:82260578-82260600 AAGTGGGCTCTGAGGAAAGAGGG - Intergenic
1120270378 14:82306366-82306388 CAGATGATCCTGAGGAAAGATGG - Intergenic
1120440773 14:84536128-84536150 CACAGGGTGCTGAGGGAAAAAGG - Intergenic
1120648558 14:87102703-87102725 AAGAAGGGCAAGAGGGAAGAGGG - Intergenic
1120724027 14:87917357-87917379 AGGGGGCTCCTGAGGCAAGATGG - Intronic
1120827506 14:88969041-88969063 ACAAGGGTCCTGAGGCAGGAGGG - Intergenic
1122131573 14:99606874-99606896 AACAGCGTCCTGAAGGAAAAGGG + Intergenic
1122706505 14:103625260-103625282 AAGAGGGTGGGGAGGAAAGAGGG - Intronic
1122821193 14:104346008-104346030 AAGAGGGCCTGGAGGGAAGGAGG - Intergenic
1202835858 14_GL000009v2_random:76951-76973 AAGTGGGACCTGGGAGAAGAGGG - Intergenic
1125673880 15:41492590-41492612 AAGAAGGTTCAGTGGGAAGACGG - Intergenic
1125687070 15:41569898-41569920 ATAAGGGTCCTGAGGGAAAGGGG - Intronic
1125929409 15:43589835-43589857 GAGGGGGTCCTGTGGGAGGATGG - Intronic
1125942576 15:43689667-43689689 GAGGGGGTCCTGTGGGAGGATGG - Intergenic
1126644144 15:50858438-50858460 AAGAAGGTGATGTGGGAAGATGG + Intergenic
1127330327 15:57932704-57932726 AAGATGGTCATGTGGGAAAAAGG - Intergenic
1127458180 15:59173927-59173949 AAGAGGGTCAAGATGGAAGAAGG + Intronic
1127525978 15:59792257-59792279 AAGGGGGTCCTGAGAGCAGCTGG - Intergenic
1127638520 15:60893641-60893663 AAGAGGCTCCTAAGGGAAGCGGG + Intronic
1128648325 15:69393079-69393101 AAGTGGGAGCTGAGGGGAGAGGG + Intronic
1128684326 15:69672356-69672378 AAAAGGATCCTGAGGAGAGAGGG + Intergenic
1128892239 15:71341774-71341796 AAGAGGGTTGTGAGGGAGGTAGG - Intronic
1129360114 15:75019329-75019351 CAGAGGGGCCAGAGGCAAGAGGG - Exonic
1129515229 15:76153285-76153307 AGGAGGGTCCTGAAGGGAGTAGG - Intronic
1130622052 15:85473711-85473733 AAGAGGGTCATGAGAGGGGAGGG + Intronic
1131059691 15:89397165-89397187 AAGCAGGTCCTCAGGGCAGAGGG - Intergenic
1132349699 15:101132238-101132260 ATGAGGAACCTGAGGGCAGAGGG - Intergenic
1134297940 16:12963119-12963141 CAGAGGTGCCTGAGGGAAGCAGG + Intronic
1134905798 16:17978495-17978517 ATGAGGGTCCTGAGGGGATGAGG - Intergenic
1135325965 16:21526101-21526123 AAAAGGGATTTGAGGGAAGAGGG + Intergenic
1135622242 16:23966028-23966050 AAGAGGGCCATGGGGTAAGAGGG + Intronic
1135804798 16:25533140-25533162 AAGACGGTCCCAAGGGAAAAGGG - Intergenic
1136886299 16:33932253-33932275 TAGAGGGTCCTGGGGAAAGGTGG - Intergenic
1137480032 16:48844676-48844698 AGCAGAGTCCTGAGGGAACAGGG - Intergenic
1138195919 16:55052007-55052029 AAGAGGGGGCTGAGACAAGATGG - Intergenic
1138297582 16:55900095-55900117 GAGAGGGTCCCTAGGGATGAAGG - Intronic
1139520285 16:67478805-67478827 TAGAGGGTCCCCTGGGAAGATGG + Intronic
1140125963 16:72119346-72119368 ATGAGGAACCTGAGGGAACAGGG + Exonic
1140799915 16:78476928-78476950 AAGAGGGAACTGAAGGAGGAAGG - Intronic
1141609042 16:85170914-85170936 AGGAGGCTCCCGAGGGAAGAGGG + Intergenic
1141625045 16:85256753-85256775 AAGTGTGTCCTGAGGCCAGAGGG - Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1142387350 16:89774322-89774344 AGGAGGATCCTGGGGGAAGGAGG + Intronic
1203086139 16_KI270728v1_random:1185580-1185602 TAGAGGGTCCTGGGGAAAGGTGG + Intergenic
1142666785 17:1467902-1467924 CAGAGATTCCTGAGGGGAGAGGG + Exonic
1142712258 17:1730067-1730089 AAGAGAGGCCAGAGGGAAGGTGG + Intronic
1143579998 17:7819885-7819907 ATGAGGACCCTGAAGGAAGAGGG - Intronic
1144671130 17:17133221-17133243 AGGAGGGGCCTGAGTGCAGAAGG - Intronic
1145404195 17:22571211-22571233 AAGAGGGTGACGAGGAAAGAGGG + Intergenic
1146018870 17:29257800-29257822 AAGAAGGTGCTGAGGGGAGAAGG + Exonic
1146501510 17:33368819-33368841 GAGAGGATCCTGAGCTAAGACGG - Intronic
1146956768 17:36940548-36940570 AAGCGGGTCCTGGGGGAGGAAGG + Intronic
1147228586 17:39000760-39000782 GAGGGGGTCCTGTGGGAGGATGG - Intergenic
1147387105 17:40089174-40089196 AAGAGGGGCGTGAGGGGCGAGGG - Intronic
1147559670 17:41501131-41501153 CAGGGGGTCCTGAGAGCAGAGGG + Exonic
1147766683 17:42841484-42841506 TAGAGTGACCTGAGAGAAGAGGG - Exonic
1148240503 17:45996832-45996854 AAGAGGGTCCAGAGGGGACTGGG - Intronic
1148254874 17:46121534-46121556 AATAGGGTCATCAGGGAAAAAGG - Intronic
1148691317 17:49528491-49528513 AGGGGTGGCCTGAGGGAAGAGGG + Intergenic
1148751480 17:49947988-49948010 GACAGGGTCCTGATGGAATAGGG - Intergenic
1151401366 17:73857996-73858018 GAGGGGGCCCTGAGGGAGGAGGG - Intergenic
1151816357 17:76473330-76473352 AAGGGGGTGGTGAGGCAAGAGGG + Intronic
1151966055 17:77432384-77432406 GAGAGCCTGCTGAGGGAAGAAGG - Intronic
1153196133 18:2598508-2598530 AACAGAGCCCTGAAGGAAGAAGG + Intronic
1153406691 18:4748792-4748814 AAGAGGATCCTCAGGGGAGAAGG + Intergenic
1156566859 18:38201279-38201301 AATAGGTACCTCAGGGAAGAAGG - Intergenic
1157015954 18:43713045-43713067 AAGAAGGTCTTCAAGGAAGAAGG + Intergenic
1157716792 18:49893574-49893596 CAGAGGGTCCTGTGGGCAGAGGG + Intronic
1157927994 18:51787529-51787551 ATGAGAGCCCTCAGGGAAGATGG + Intergenic
1158216399 18:55104640-55104662 AAGAGGGGCCTGGTGGAAGGTGG - Intergenic
1158547512 18:58408718-58408740 ACGAGGGCCCTGAGAGAAGCTGG - Intergenic
1159687304 18:71438402-71438424 GAGTAGGCCCTGAGGGAAGAAGG + Intergenic
1159794344 18:72823427-72823449 GTGAGGGACCTAAGGGAAGAGGG + Intronic
1160059234 18:75514597-75514619 GAGTGGGGCCTGAGGGAAGTTGG + Intergenic
1160116664 18:76085162-76085184 AAGAGGGGGCTGAGGGTAGTTGG - Intergenic
1160607142 18:80059672-80059694 AAGGGTGTCCTGCAGGAAGAGGG + Intronic
1160870832 19:1277109-1277131 ATGAGAGTCCTGAGGGAAGGAGG + Intronic
1160908090 19:1461088-1461110 AAGAAGGTGCTGAGGGAGGCGGG + Exonic
1161070455 19:2257306-2257328 CTGGGAGTCCTGAGGGAAGAGGG + Intronic
1161505838 19:4642933-4642955 TAGATGGTGCTGAGGGACGAGGG + Intronic
1161737837 19:6002521-6002543 CAGAGGGCCCTGAGAGATGATGG + Intronic
1161959724 19:7516678-7516700 CCTAGGGTCCTGGGGGAAGAGGG - Intronic
1162736884 19:12751866-12751888 TAGGGGGCCCTGAGGGAAGAGGG + Exonic
1162812455 19:13172476-13172498 AAGTGGGACATGAGGGCAGAAGG - Intergenic
1163056015 19:14718711-14718733 ACGTGGCTCCTGAGGGATGATGG - Exonic
1164441484 19:28283364-28283386 AAGAGGGTTGTGTGGGGAGAGGG - Intergenic
1166271446 19:41716841-41716863 AAAAGAGTCCTGTGGGTAGATGG - Intronic
1166915241 19:46190972-46190994 CTGAGGGGCCTGAGGGGAGATGG - Intergenic
1167600426 19:50451530-50451552 ACTGAGGTCCTGAGGGAAGAGGG + Intronic
1167959587 19:53095204-53095226 AAGAGGGTCGTGTGGGAGGGTGG - Intronic
1168135551 19:54349053-54349075 AAGAGGGCGCTGAGGGTGGATGG + Intergenic
1168576199 19:57513052-57513074 AACAGGGACGTGAGTGAAGAAGG + Intronic
1202636779 1_KI270706v1_random:50412-50434 AAGTGGGACCTGGGAGAAGAGGG + Intergenic
925135080 2:1521460-1521482 AGGAGGGTCCTGGGGGAAGAGGG - Intronic
925135096 2:1521492-1521514 AAGAGGGCCCTGGGGGAGGAGGG - Intronic
925425639 2:3746973-3746995 GAGAGGGCCCTGAGGGAAGCAGG + Intronic
926210070 2:10862894-10862916 ATGAGGGTCCTGAGGGATGCAGG + Intergenic
926341489 2:11908364-11908386 AAGAGGAAACTGAGGGTAGAGGG + Intergenic
926722486 2:15971494-15971516 ACGAGGGTCAGGAGGGAAGAAGG + Intergenic
927244470 2:20945916-20945938 CTGAGGGGCCTGGGGGAAGAGGG - Intergenic
927460821 2:23296771-23296793 AAAGGGGGCCTGGGGGAAGAGGG - Intergenic
927993192 2:27462668-27462690 AAGAGGGACAGGATGGAAGAGGG - Intronic
928065773 2:28163201-28163223 AAGAAGGTCATGGGGGAAGCAGG - Intronic
928904744 2:36356721-36356743 AAGAGGGCTCTGCGGGAAGAGGG + Intronic
929891142 2:45919423-45919445 AAGAGAGGCCAGAGGGCAGAAGG - Intronic
930417136 2:51103278-51103300 TTGAGTGTCCTCAGGGAAGAGGG - Intergenic
930725213 2:54675368-54675390 AATAGGGTGCTGAGCGATGAGGG - Intergenic
932184192 2:69677879-69677901 ATGAGGGTCTTCAGGGGAGAAGG - Intronic
932879805 2:75490645-75490667 AAGAGGCTCTTAAGGGAAGTTGG + Intronic
934603352 2:95675804-95675826 AAGAAGGGCCGGAAGGAAGATGG - Intergenic
934708266 2:96499671-96499693 AAGAGGGGCCTGAAGGAAGGTGG - Intronic
934802981 2:97185965-97185987 AAGAGGGTTGTGAGGCAGGAAGG + Intronic
934833219 2:97554582-97554604 AAGAGGGTTGTGAGGCAGGAAGG - Intronic
935333313 2:101993430-101993452 AAGAAGGTCATGAGTGAGGAAGG + Intronic
935469431 2:103439350-103439372 AATGGGGGCCTGGGGGAAGAAGG - Intergenic
936505132 2:113099696-113099718 AAGAGGATGCTGAGGAAAAATGG - Intergenic
936536734 2:113318030-113318052 AAGAAGGGCCGGAAGGAAGATGG - Intergenic
937507071 2:122549666-122549688 GAAAGAGTCCTGAGTGAAGAGGG + Intergenic
937992947 2:127674435-127674457 ACGAGGGGCCTGAGAGCAGAGGG + Intronic
939748128 2:146003698-146003720 CAGACGGTCCCCAGGGAAGAAGG + Intergenic
939865903 2:147472048-147472070 GAGAAGGTCCTGAGAGGAGAAGG - Intergenic
940139794 2:150481370-150481392 AAGAAGGTTGTCAGGGAAGAAGG + Intronic
941155852 2:161977163-161977185 AAAGGGGTCCTGGGGGAAGTGGG - Intronic
941463871 2:165802154-165802176 AAGAGGGTCCTGAGGCAGACAGG + Intergenic
941877292 2:170447053-170447075 ATGAGGGTCTTCAGGGGAGAAGG + Intronic
942167477 2:173255904-173255926 ATGTGGGTCCTGAGGTAAGTGGG - Intronic
942899524 2:181097256-181097278 AAGAAGTTCCTCAGTGAAGAGGG - Intergenic
943247350 2:185473078-185473100 CAGAGGGGCCTGAGGCAACAGGG - Intergenic
943568432 2:189543833-189543855 GAAAGGGTACTGAGTGAAGAGGG - Intergenic
944537434 2:200725086-200725108 CAGAGGGTCCAGCAGGAAGAGGG + Intergenic
945218473 2:207460457-207460479 ATGAGGGTCTTCAAGGAAGAAGG - Intergenic
945768443 2:214009600-214009622 ATGAGGGTCGTGAGGGAGGCAGG + Intronic
946048724 2:216843047-216843069 AAGAGGGGACTGAGGGCTGAGGG + Intergenic
947121103 2:226816159-226816181 AAGAAGTTCATGGGGGAAGAAGG - Intergenic
947625481 2:231615656-231615678 AAGAGGGTCGAGAGGGGAGGCGG - Intergenic
947648101 2:231759677-231759699 AAGAGGGAGTTGATGGAAGATGG - Intronic
947650258 2:231780864-231780886 AGGGGCGTCCTGAGGGAGGAAGG - Intronic
947736776 2:232459300-232459322 AAGGGGATGCGGAGGGAAGAAGG - Exonic
948530173 2:238599183-238599205 GAGAGGGACATGAGGGAAAAAGG + Intergenic
948774229 2:240273832-240273854 AAGAGGGTCATTTGGGAAAATGG + Intergenic
1168889703 20:1286993-1287015 AAGTGGGTCCCAAGGAAAGATGG - Intronic
1169349259 20:4854999-4855021 AAGAGTGTCCCAAGGCAAGAGGG + Exonic
1169418238 20:5436313-5436335 AAGAGGAGCCTAAGGGAACATGG - Intergenic
1169571471 20:6911315-6911337 ATGAAGGTCCTGGTGGAAGAAGG + Intergenic
1169596339 20:7203999-7204021 AAGAAGGTCTTAAGTGAAGAAGG + Intergenic
1169838599 20:9908636-9908658 ATGGGGGTCCTGGGGGAAGTGGG - Intergenic
1170598420 20:17822675-17822697 AAGAGGGACCTGAGGCCTGAGGG - Intergenic
1171221384 20:23401072-23401094 AAGAGGGAGCTGAAGGAAGCAGG + Intronic
1171880892 20:30616828-30616850 AAGTGGGACCTGGGAGAAGAGGG + Intergenic
1172980215 20:38935966-38935988 AAGAGGGTCCTGAGAGAGTTAGG + Intronic
1173228676 20:41177326-41177348 AAGACTGCCCTGCGGGAAGATGG + Intronic
1173868813 20:46329454-46329476 GAGAGAGTCCTGAGGCCAGAGGG + Intergenic
1173907085 20:46637213-46637235 AAGCTGGTCCTGGGGGAAGCCGG + Intronic
1174199050 20:48794356-48794378 CAGAGAGTCCTGAAGGAAGCTGG + Intronic
1175208359 20:57329343-57329365 AAGAGGGACCTGAGTGCAAAGGG + Intergenic
1175389096 20:58615143-58615165 AAGAGGATCCTGGGGCCAGAGGG - Intergenic
1175433959 20:58929325-58929347 AAGAGGGTTCTGAAGACAGATGG - Intergenic
1175542626 20:59757271-59757293 AAGAGGGCACTGAGGGGAGCAGG - Intronic
1175708628 20:61201847-61201869 TGGAGGGTCCTGAGTGAGGATGG - Intergenic
1175708659 20:61201981-61202003 TGGAGGGTCCTGAGTGAGGATGG - Intergenic
1175708667 20:61202015-61202037 TGGAGGGTCCTGAGTGAGGATGG - Intergenic
1175708698 20:61202149-61202171 TGGAGGGTCCTGAGTGAGGATGG - Intergenic
1175708706 20:61202183-61202205 TGGAGGGTCCTGAGTGAGGATGG - Intergenic
1175708714 20:61202217-61202239 TGGAGGGTCCTGAGTGAGGATGG - Intergenic
1175708723 20:61202252-61202274 TGGAGGGTCCTGAGTGAGGATGG - Intergenic
1175708731 20:61202286-61202308 TGGAGGGTCCTGAGTGAGGATGG - Intergenic
1175708739 20:61202320-61202342 TGGAGGGTCCTGAGTGAGGATGG - Intergenic
1175708747 20:61202354-61202376 CGGAGGGTCCTGAGTGAGGATGG - Intergenic
1175948905 20:62571951-62571973 AAGTGGGGCCTGTGGGAAGGCGG + Intergenic
1176107363 20:63395728-63395750 AAGAGAGTAGAGAGGGAAGAAGG + Intergenic
1176728594 21:10466056-10466078 AAGTGGGACCTGAGGGCTGAAGG + Intergenic
1176842157 21:13850101-13850123 AAGCGGGACCTGGGAGAAGAGGG + Intergenic
1177894854 21:26845849-26845871 AAGAGGGAACTGAGGGAGGAGGG - Intergenic
1178365231 21:31984759-31984781 AACAGGCTCCAGAGGGAAAAGGG - Intronic
1180364092 22:11923901-11923923 AAGTGGGACCTGGGAGAAGAGGG - Intergenic
1180814685 22:18782033-18782055 CACAGGGTCCTGAAGGCAGAGGG + Intergenic
1180821525 22:18832262-18832284 CAGAGGCTCCTGAGGGCAGCAGG + Intergenic
1181041244 22:20193695-20193717 GGGAGGGTGCTGAGGGATGACGG - Intergenic
1181191453 22:21143783-21143805 CAGAGGCTCCTGAGGGCAGCAGG - Intergenic
1181200874 22:21216369-21216391 CACAGGGTCCTGAAGGCAGAGGG + Intronic
1181207745 22:21266727-21266749 CAGAGGCTCCTGAGGGCAGCAGG + Intergenic
1181545325 22:23599199-23599221 AACAGGGCCCAGAGGGAACAAGG - Intergenic
1181700871 22:24620604-24620626 CACAGGGTCCTGAAGGCAGAGGG - Intronic
1181979122 22:26753484-26753506 ATGAGGCTGCTGAGGGAAGCAGG - Intergenic
1182039155 22:27222949-27222971 AAGAGGCACCTGTGGGAGGAAGG - Intergenic
1182948452 22:34347934-34347956 AACAGGGTGGAGAGGGAAGAGGG + Intergenic
1183464692 22:37973662-37973684 AATAGGGTCCTGAGGGCTGATGG + Exonic
1183985503 22:41567973-41567995 AATTGGGTGTTGAGGGAAGAGGG - Intronic
1183987006 22:41575516-41575538 AAGAGGGGCCTGAGGGCGGAAGG + Exonic
1184003313 22:41690869-41690891 ATCATGGTGCTGAGGGAAGAAGG - Intronic
1184259214 22:43305123-43305145 AAGAGAGTCCTGCCGGAATACGG + Intronic
1184829683 22:46976671-46976693 AAGAGGGTGCTTAAGGAAGATGG - Intronic
1184907333 22:47497756-47497778 AAGTAGGCCCTGAGGGAAGCCGG - Intergenic
1203219175 22_KI270731v1_random:28689-28711 CAGAGGCTCCTGAGGGCAGCAGG - Intergenic
1203226045 22_KI270731v1_random:79066-79088 CACAGGGTCCTGAAGGCAGAGGG - Intergenic
1203264782 22_KI270734v1_random:7720-7742 CACAGGGTCCTGAAGGCAGAGGG + Intergenic
1203271650 22_KI270734v1_random:58138-58160 CAGAGGCTCCTGAGGGCAGCAGG + Intergenic
950227917 3:11251040-11251062 AAGAAAGTCACGAGGGAAGATGG - Intronic
952197944 3:31095711-31095733 AAAAGAGTCATGAGGGAAGATGG + Intergenic
953625284 3:44565773-44565795 AACAGGGTCACTAGGGAAGAAGG - Intronic
954257583 3:49417349-49417371 AGCAGGGTCCTGAAGGAAGCTGG + Exonic
954498500 3:50988126-50988148 AGGAAGCTCCTGAGGGGAGAGGG + Intronic
954881235 3:53837378-53837400 AAGAGGATCCAGAGGGCAGGTGG - Intronic
956720395 3:72112477-72112499 AAAAGGGTCTTGTGGGAACAGGG + Intergenic
957018795 3:75100819-75100841 AAAAGGGGCCTGGTGGAAGAAGG + Intergenic
957219494 3:77363738-77363760 ATGAGGGTCTTCAAGGAAGAAGG + Intronic
958468733 3:94491741-94491763 AAGAGGTACGTGATGGAAGAAGG + Intergenic
959289534 3:104456289-104456311 AAGAGAGACTTGAGGGAATAAGG + Intergenic
960507671 3:118513165-118513187 AAGAGGGTCTTCAGGGGAGAAGG - Intergenic
960758006 3:121039579-121039601 AAGAGGGTCTTCAGGCAAAAGGG - Intronic
960934890 3:122892758-122892780 AAGAGGGAAGGGAGGGAAGAAGG - Intergenic
961040867 3:123677094-123677116 AAAAGTGTCCTGAGGGAAAGAGG - Intronic
962071145 3:132034880-132034902 AGGAGGGTACTGAGAAAAGAGGG + Exonic
962646382 3:137444933-137444955 AAGAGGGAGCTGTGAGAAGAGGG - Intergenic
963492528 3:146019049-146019071 AAGAGGGACATTGGGGAAGAGGG - Intergenic
964645628 3:158956153-158956175 AGGAGGGGCCTGAGGGCAGAGGG + Intergenic
965619357 3:170627021-170627043 AAGAGGGAACTGAGGGAGGTGGG - Intronic
966267261 3:178061468-178061490 AAGAGTTTACTTAGGGAAGATGG - Intergenic
966501036 3:180639639-180639661 GAGAGGGACCTGAGGGATAAAGG + Intronic
967393194 3:188977487-188977509 AAGAGAGTGCTGTGGGCAGAAGG - Intronic
967674561 3:192281194-192281216 TAGAGGATTCAGAGGGAAGATGG - Intronic
967824214 3:193865858-193865880 AGGAGGGGCTTGAGGGAAGAGGG - Intergenic
969498760 4:7540681-7540703 AAGAGAGTCATGAGGGAGGGCGG + Intronic
972345021 4:38185551-38185573 AACAGGGCCCTGTGGTAAGATGG + Intergenic
972573791 4:40333601-40333623 AAGAGGCCCCTGAGGGGAGAAGG + Intergenic
973394025 4:49578653-49578675 AAGCGGGACCTGGGAGAAGAGGG - Intergenic
974188683 4:58474803-58474825 AAGTGGGGGCTGAGGGATGAGGG + Intergenic
976443395 4:85103129-85103151 AGGAGGAATCTGAGGGAAGATGG - Intergenic
977531606 4:98207133-98207155 AGGAGGGTTTTGAGAGAAGATGG + Intergenic
978113932 4:104996407-104996429 ACTAGGGTATTGAGGGAAGAAGG + Intergenic
978515947 4:109568590-109568612 AAGAGGGGTCTGTGGGGAGATGG - Intronic
978685077 4:111431190-111431212 ATGTGGGGGCTGAGGGAAGAGGG + Intergenic
980005504 4:127537809-127537831 AACACAATCCTGAGGGAAGAAGG + Intergenic
981601706 4:146496505-146496527 ATGAGGGTCTTCAGGGGAGAAGG - Intronic
981864954 4:149406449-149406471 ATGAAGGTCCTGTGGCAAGAGGG + Intergenic
982628816 4:157805156-157805178 AAGAGGGAGCAGAGGAAAGAGGG - Intergenic
982761437 4:159289095-159289117 AGGAGGGGCTTGAGGGGAGAAGG - Intronic
983464218 4:168066699-168066721 AAGAGTGTCTTGAAAGAAGATGG + Intergenic
983552572 4:169032490-169032512 AAGAAGGAACAGAGGGAAGAAGG - Intergenic
984248311 4:177302158-177302180 AAGAGGGTGCTGAGAGAGGATGG + Intergenic
984455163 4:179957370-179957392 ATGAGGAACCTGAGGGAAGAGGG + Intergenic
984830188 4:183965851-183965873 AAGGGGGTGGTTAGGGAAGAAGG + Intronic
985137484 4:186801781-186801803 AGGAGGGTCCAGAGGGAAGTTGG + Intergenic
985999548 5:3619828-3619850 AAGAGGATCTTGAGTGAAGTGGG + Intergenic
987946951 5:24622366-24622388 AGAAAGGGCCTGAGGGAAGAAGG + Intronic
988492737 5:31718309-31718331 CAGATGGGCCTGGGGGAAGAAGG + Intronic
988553454 5:32217199-32217221 AAAAGGTTCCTGAGGGATAATGG + Intergenic
991920271 5:71649872-71649894 AGGAGGGTCCTGAGCACAGATGG - Intronic
992466229 5:77008178-77008200 AACAAGGTGCTGTGGGAAGAAGG - Intergenic
993929151 5:93916672-93916694 TAGGGGGTTCTGAGGGAAGGGGG - Intronic
994994233 5:107039191-107039213 ATGAGGGTCTTCAGGGGAGAAGG + Intergenic
995366156 5:111363687-111363709 AAAAGAGGCCTGATGGAAGAGGG + Intronic
995436074 5:112137030-112137052 AAGTGGGTCCTCTGGGGAGAAGG + Intergenic
995571763 5:113488608-113488630 AGGAGGCACCTCAGGGAAGAGGG + Exonic
995775181 5:115717393-115717415 AAGAGGGTCCTGAGAGACTGTGG - Intergenic
998091527 5:139373679-139373701 GAGAGGGCACTGAGGGAAGGTGG + Intronic
998546239 5:143030265-143030287 AAGAGGGGCCTGAGGCCTGAGGG - Intronic
998902841 5:146874397-146874419 AAAAGGCTTCTGAGGGAAGGTGG + Intronic
1001045092 5:168365385-168365407 AAGAGGTTACTGTGGGAAGCTGG + Intronic
1002284241 5:178151703-178151725 AAGAAGGTCCTGAGAGGAGAGGG - Intronic
1002716923 5:181233816-181233838 GACTGGGTCCTGAGGGAAGTTGG + Intronic
1004533903 6:16480852-16480874 AAGAAGGTGCTGAGGGGAAAGGG + Intronic
1006092675 6:31637220-31637242 GAGAAGGACCTAAGGGAAGAAGG - Exonic
1006370806 6:33642673-33642695 ATGAGGGGCCTGGGGGAGGAGGG - Intronic
1006442180 6:34059597-34059619 AAGAGGGAGCTGTGGGCAGAAGG - Intronic
1006501032 6:34458861-34458883 AGGAGGGTCTTCAGGAAAGAAGG + Intergenic
1006924609 6:37647633-37647655 AAAAGGGATATGAGGGAAGATGG + Intronic
1007109410 6:39304333-39304355 AATAGGGTCCTTAGTGAAAAAGG - Intronic
1007585640 6:42987466-42987488 AACACTGTGCTGAGGGAAGAGGG + Intronic
1007978869 6:46130090-46130112 AAGGGGGACCTGGAGGAAGAGGG - Exonic
1010021128 6:71161181-71161203 AAGTGGGACCTGAGGGACCATGG - Intergenic
1010677945 6:78766636-78766658 AAGAGGGACCTGGTGGAAGGTGG + Intergenic
1012555386 6:100505339-100505361 CAGAGGGTAGTGAGGGGAGAAGG + Intergenic
1013655527 6:112242923-112242945 CAGAGGGTCCAGAGAGGAGAAGG - Intronic
1013761597 6:113524824-113524846 CAGAGGGTAATGAGAGAAGAAGG + Intergenic
1015018487 6:128443310-128443332 AAGAAGGAGATGAGGGAAGAGGG + Intronic
1015479143 6:133689000-133689022 AAGAAGCTCCTGAGGAAAGCTGG + Intergenic
1015539527 6:134300097-134300119 AAGGTTTTCCTGAGGGAAGAAGG - Intronic
1016027611 6:139303413-139303435 ATTAGGTTCCTGAGGGAATAAGG + Intergenic
1017533564 6:155322236-155322258 AAGAGGTTCAAGAGGCAAGAAGG + Intergenic
1017570817 6:155742365-155742387 AAAGGGGTGTTGAGGGAAGAGGG - Intergenic
1017875398 6:158520084-158520106 GAGAGTGGCCTGGGGGAAGAGGG - Intergenic
1018247798 6:161839223-161839245 AAGGTGCCCCTGAGGGAAGAAGG + Intronic
1019152413 6:170017551-170017573 GAGAGGCCCCTGAGGGAAGTTGG + Intergenic
1019210662 6:170401992-170402014 CAGGGAGTCCTGAGGGAGGATGG - Intronic
1019268859 7:134684-134706 AAGAGGTTCCTGTGGCCAGAGGG - Intergenic
1019558247 7:1643067-1643089 AGGAGGGTCCTGGGGCCAGAGGG - Intergenic
1023527818 7:41123306-41123328 AAGTGGGTCATGTGGGATGAAGG - Intergenic
1023562548 7:41491072-41491094 TAGAGAGTGCTGGGGGAAGAAGG - Intergenic
1023603770 7:41908614-41908636 AATAGGGTCCGGATGAAAGAAGG + Intergenic
1024793361 7:52992732-52992754 GAGAGTGTCCTGAGGGAGGTAGG + Intergenic
1028562415 7:92189867-92189889 AGGGGGGTCCTGAGCCAAGATGG - Intergenic
1028630399 7:92927452-92927474 AAAAGGGTCTAGAGGGATGATGG + Intergenic
1029514624 7:101017721-101017743 AAGGGAGTCCCGGGGGAAGAGGG - Intronic
1029636779 7:101789872-101789894 AAGAGGCTGCTGAGGGCATAGGG - Intergenic
1032450276 7:132024674-132024696 AAGAGGGTAGTGAAGGAAGCAGG + Intergenic
1033321429 7:140343258-140343280 CAGCTGGTCCTGAGGGGAGACGG + Intronic
1034392866 7:150800246-150800268 CAGAGGGTCCTGCGGCAAGAGGG + Intronic
1034440096 7:151081892-151081914 AACTGGGTCCTGAGGAGAGAGGG + Exonic
1034818526 7:154195850-154195872 CACAGGGTCCTGCTGGAAGATGG - Intronic
1034937551 7:155209812-155209834 AAGAGGTTCCTGAGAAAGGAAGG - Intergenic
1035080315 7:156210258-156210280 AAGTGGGGGCTGAGGGAAAATGG + Intergenic
1035556295 8:569532-569554 AGGAGGGTCCTGACGGACGTGGG - Intergenic
1035587191 8:785632-785654 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587204 8:785666-785688 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587216 8:785700-785722 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587229 8:785734-785756 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587242 8:785768-785790 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587266 8:785836-785858 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035610065 8:955998-956020 AAGAGGGCTATGAAGGAAGAGGG - Intergenic
1039038603 8:33385514-33385536 CACAGGCTCCTAAGGGAAGAGGG + Intronic
1039089046 8:33808953-33808975 TAGAAGGCCCTGAAGGAAGAGGG + Intergenic
1040860587 8:51994656-51994678 AAGAAGGAACTGAGGAAAGAAGG - Intergenic
1041389880 8:57338796-57338818 AAGAGTGTTCTGAGGGACTAAGG - Intergenic
1042739461 8:72027278-72027300 AAGATGGTCCTGGGGGAGGTTGG + Intronic
1043523796 8:81074313-81074335 GTGAGGATCATGAGGGAAGAGGG + Intronic
1043858820 8:85292069-85292091 AAAAGGGTCCTGAGACCAGAAGG + Intergenic
1045183366 8:99810982-99811004 AAGAGTGTTCTGAGGGCAGATGG - Intronic
1046857726 8:119052990-119053012 AGGAAAGTCCTGAGCGAAGACGG + Intronic
1047411630 8:124628987-124629009 AAGAGGGTCCTTGGGGCAGGAGG + Intronic
1047498723 8:125426824-125426846 AAGAGGATTCTGTGGGAAGAGGG + Intergenic
1048450312 8:134527705-134527727 TTGAGGATCCTGTGGGAAGAGGG - Intronic
1048554619 8:135462507-135462529 AAGATGTTCCTTAGGAAAGAGGG - Intronic
1048638376 8:136325132-136325154 AAGATGTTCCTGAGGGAATGAGG + Intergenic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1049698804 8:143997264-143997286 AAGTGGGTCCAGAGGGTGGAGGG - Intronic
1049702142 8:144020177-144020199 AAGAGGGTCCTGAGCGGGGAGGG - Intronic
1049702148 8:144020193-144020215 GAGATGGTCCTGAGGGAAGAGGG - Intronic
1049702154 8:144020209-144020231 AACAGCCTCCTGAGGGGAGATGG - Intronic
1049702194 8:144020384-144020406 GAGAGGGTTATCAGGGAAGAGGG - Intronic
1049702198 8:144020400-144020422 GAGAGGGCACTGAGGGGAGAGGG - Intronic
1049702203 8:144020416-144020438 AAGAGCGTTCTGAGGGGAGAGGG - Intronic
1049702210 8:144020448-144020470 AAGAGTGTCCTGCGGGAAGGTGG - Intronic
1049702222 8:144020512-144020534 AAGAGGGTTCTGAGGGGAGAGGG - Intronic
1049702228 8:144020528-144020550 AAGAGGGTCCTGAGGGAAGAGGG - Intronic
1049702232 8:144020544-144020566 GAGAGGATACTGAAGGAAGAGGG - Intronic
1049702240 8:144020576-144020598 GAGAGGGTTCTGAGGGGAGAAGG - Intronic
1049702244 8:144020592-144020614 AAGAGGGTTCTGAGGGGAGAGGG - Intronic
1049702250 8:144020608-144020630 AGGAGGGTCCTGAAGGAAGAGGG - Intronic
1049702275 8:144020687-144020709 AAGAGGATCCTGAGGGAAGAGGG - Intronic
1049702304 8:144020802-144020824 AAGAGAGTTCTGAGGGGAGAGGG - Intronic
1049702310 8:144020834-144020856 GAGAGGGTCTTTAGGGAAGAGGG - Intronic
1049702314 8:144020850-144020872 AAGAGAGTTTTGAGGGGAGAGGG - Intronic
1049702323 8:144020882-144020904 AAGAGGGTCCTGAGGGAAGAGGG - Intronic
1049702328 8:144020898-144020920 GAGAAGGTCCTGAGGGAAGAGGG - Intronic
1049702333 8:144020914-144020936 GAGGGGGTCCTGAGGGGAGAAGG - Intronic
1049702350 8:144020977-144020999 AAGAGGTTCCTGAGGGGAGAGGG - Intronic
1049702394 8:144021141-144021163 GAGAGGATACTGAAGGAAGAGGG - Intronic
1049702418 8:144021220-144021242 GAGAGGGTCCTGAGGGAAGGCGG - Intronic
1049702423 8:144021236-144021258 AAGAGAGTCCTGAGGGGAGAGGG - Intronic
1049702431 8:144021268-144021290 GAGAGGGACCTGAGGGAAGGGGG - Intronic
1049702438 8:144021284-144021306 AAGAGGGTCCTGAGGGGAGAGGG - Intronic
1049702443 8:144021300-144021322 CAGAGGGTCATGAGGGAAGAGGG - Intronic
1049702447 8:144021316-144021338 AACTGGGTCATGAGGGCAGAGGG - Intronic
1049702481 8:144021462-144021484 AAGGCAGTCCTGAGGGGAGAGGG - Intronic
1049702490 8:144021494-144021516 GAGAGGGATCTGAGGGAAGGAGG - Intronic
1049702496 8:144021510-144021532 CAGAGGGCCCTGAGGGGAGAGGG - Intronic
1049702501 8:144021526-144021548 AAGAGAGTTTTGAGGGCAGAGGG - Intronic
1049702508 8:144021573-144021595 GAGAGGGTTCTGAGGTAAGAGGG - Intronic
1049702512 8:144021589-144021611 CAGAGGGTCCTGAGGTGAGAGGG - Intronic
1049702540 8:144021700-144021722 AAGAGGCTCCTGAGGGGGAAGGG - Intronic
1049702551 8:144021732-144021754 AAGAGGTTCCTCAAGAAAGAGGG - Intronic
1049702593 8:144021926-144021948 AAGAGGGTCCTGAGGGGGAAGGG - Intronic
1049702600 8:144021942-144021964 AAGAGGGTCCTGAGGGAAGAGGG - Intronic
1049702605 8:144021958-144021980 AAGAGGTTCCTCAAGAAAGAGGG - Intronic
1049702624 8:144022038-144022060 GAGAGGGTCGTGAGAGGAGAAGG - Intronic
1049702638 8:144022102-144022124 GAGAGGGTCCTGAGGGGGAAGGG - Intronic
1049702645 8:144022118-144022140 AAGAGGGTCCTGAGGGGAGAGGG - Intronic
1049702651 8:144022134-144022156 AAGAGGTTCCTCAAGAAAGAGGG - Intronic
1049702670 8:144022214-144022236 GAGAGGGTCGTGAGAGGAGAAGG - Intronic
1049702688 8:144022309-144022331 AAGGCAGTCCTGAGGGGAGAGGG - Intronic
1049702697 8:144022341-144022363 GAGAGGGATCTGAGGGAAGGAGG - Intronic
1049702703 8:144022357-144022379 CAGAGGGCCCTGAGGGGAGAGGG - Intronic
1049702708 8:144022373-144022395 AAGAGAGTTTTGAGGGCAGAGGG - Intronic
1049702715 8:144022420-144022442 GAGAGGGTTCTGAGGTAAGAGGG - Intronic
1049702719 8:144022436-144022458 CAGAGGGTCCTGAGGTGAGAGGG - Intronic
1049702745 8:144022547-144022569 AAGAGGGTCCTGAGGGGGAAGGG - Intronic
1049702752 8:144022563-144022585 AAGAGGGTCCTGAGGGAAGAGGG - Intronic
1049702757 8:144022579-144022601 AAGAGGTTCCTCAAGAAAGAGGG - Intronic
1049702776 8:144022659-144022681 GAGAGGGTCGTGAGAGGAGAAGG - Intronic
1049702793 8:144022739-144022761 GAAAGGGTTCTAAGGGAAGAGGG - Intronic
1049702804 8:144022770-144022792 AAGTGGGTCCTCAGGGAAGAGGG - Intronic
1049702811 8:144022802-144022824 AAGAGGGTCCTGACGGGGGAGGG - Intronic
1049702820 8:144022834-144022856 GAGAGGGTCCTCAGGGAAGAAGG - Intronic
1049702840 8:144022914-144022936 GAGAGTGTCCTTAGAGAAGAGGG - Intronic
1049702850 8:144022966-144022988 AAGAGGGTCCTGAGGGAATAGGG - Intronic
1049702854 8:144022982-144023004 AAGAGGGTTTTCAGGGAAGAGGG - Intronic
1049702858 8:144022998-144023020 AAGAGGGTCTTGAGGGAAGAGGG - Intronic
1049702863 8:144023014-144023036 ACGAGGTTCCTCAGGGAAGAGGG - Intronic
1049702878 8:144023062-144023084 GAGAGGGTCCTTAGGGGAGAGGG - Intronic
1049702884 8:144023078-144023100 AAGAGGGTCCTGAGGAGAGAGGG - Intronic
1049702888 8:144023094-144023116 AAAGGAGTCCTGAGAGAAGAGGG - Intronic
1049702895 8:144023126-144023148 AAGAGGGTCCTGGGGGGAGAGGG - Intronic
1049702903 8:144023142-144023164 AAAGGGGTCCTGAGGGAAGAGGG - Intronic
1049702908 8:144023158-144023180 AAGAGGGTCCTGAGAGAAAGGGG - Intronic
1049702917 8:144023194-144023216 GAGAGGGTCCTCAGGGGAGAGGG - Intronic
1049702930 8:144023230-144023252 GAAGAGGTCCTGAGGGAAGAGGG - Intronic
1049702964 8:144023352-144023374 GAAAGGGTTCTGAGGGAAGAGGG - Intronic
1049702974 8:144023383-144023405 AAGAGGGTCCTCAGGGAAGAGGG - Intronic
1049702981 8:144023415-144023437 AAGAGGGTCCTGAGGGGGGAGGG - Intronic
1049702989 8:144023431-144023453 AAGAAGGTCCTTAGAAAAGAGGG - Intronic
1049702992 8:144023447-144023469 GAGAGGGTCCTCAGGGAAGAAGG - Intronic
1049703009 8:144023527-144023549 GAGAGTGTCCTTAGAGAAGAGGG - Intronic
1049703028 8:144023627-144023649 AAGAAGTTCCTCAGGGAAGAGGG - Intronic
1049703056 8:144023715-144023737 GAGAGGGTCCTGAGGGAAGGGGG - Intronic
1049703062 8:144023731-144023753 AAGAGAGTTTTGAGGGGAGAGGG - Intronic
1049703073 8:144023778-144023800 TAGAGGGTTCTGAGGGAAGAGGG - Intronic
1049703096 8:144023870-144023892 AAGAGCTTTCTGAGGGGAGAGGG - Intronic
1049703102 8:144023902-144023924 AACAGGGTCCTCAGGGAAGAGGG - Intronic
1049703111 8:144023934-144023956 AAGAGGGTCCTGAGGGGGGAAGG - Intronic
1049703118 8:144023950-144023972 TAGAAGGTCCTGAGGGAAGAGGG - Intronic
1049703123 8:144023966-144023988 GAGAGGGTCCTTAAGGTAGAAGG - Intronic
1049703126 8:144023982-144024004 TAGAGGGTCCTGAGGGGAGAGGG - Intronic
1049703132 8:144023998-144024020 GAGAGGGTCCTTAGGGTAGAGGG - Intronic
1049703136 8:144024014-144024036 GAGAGGGTTCTGAGGGGAGAGGG - Intronic
1049703150 8:144024051-144024073 AAGAGGGTCCTGAGGGAAGGTGG - Intronic
1049703155 8:144024067-144024089 TACAGGGTCCTCAGAGAAGAGGG - Intronic
1049703174 8:144024147-144024169 GAGAGGGTCCTGGGGAAAGATGG - Intronic
1049703179 8:144024163-144024185 GAGAGGGTCCTAACGGGAGAGGG - Intronic
1049703184 8:144024179-144024201 AAGAGAGTCCTGAAGGGAGAGGG - Intronic
1049703192 8:144024211-144024233 GAGAGCATCCTGAGGGTAGAGGG - Intronic
1049703228 8:144024341-144024363 GAGAGGGTCCTGAAAGAAGAGGG - Intronic
1049703231 8:144024357-144024379 AAGGGGGTCCTTTGGGGAGAGGG - Intronic
1049703237 8:144024373-144024395 AAGGGGGTCCTGAGGGAAGGGGG - Intronic
1049703244 8:144024389-144024411 AAGGGGGTCCTGAGGGAAGGGGG - Intronic
1049703251 8:144024405-144024427 AATAGGGTCCTGAAGGAAGGGGG - Intronic
1049703257 8:144024421-144024443 AAGAGGATCCTAAGGGAATAGGG - Intronic
1049703290 8:144024525-144024547 GAGAGGGTCCTGAGGGAAGGGGG - Intronic
1049703296 8:144024541-144024563 AAGAGAGTTTTGAGGGGAGAGGG - Intronic
1049703307 8:144024588-144024610 GAGAGGGTTCTGAGGGAAGAGGG - Intronic
1049703323 8:144024651-144024673 GAGAGGGTCTTGAGAGAAGAGGG - Intronic
1049703331 8:144024699-144024721 AAGAGGGCCTTCAGGGAAAAGGG - Intronic
1049703335 8:144024715-144024737 AAGAGGGTCGTCAGGGAAGAGGG - Intronic
1049703339 8:144024731-144024753 AGGAGGGTTTTCAGGGAAGAGGG - Intronic
1049703345 8:144024748-144024770 GAGAGGGTCCTGAGGGAAGGAGG - Intronic
1049703355 8:144024784-144024806 AAGAGGGTGCTGAGGGGAGAGGG - Intronic
1049703361 8:144024800-144024822 AAGAGGGTCCTCAGGGAAGAGGG - Intronic
1049703366 8:144024816-144024838 AAGAGGGTCCTGAGGGAAGAGGG - Intronic
1049703371 8:144024832-144024854 AAGAGATTCCTCAGGAAAGAGGG - Intronic
1049703392 8:144024911-144024933 AAGAGGGTCCTGAGGGGAGAGGG - Intronic
1049703397 8:144024927-144024949 AAGAGGATCTTGAAGGAAGAGGG - Intronic
1049703419 8:144025007-144025029 GAGATGGTCCTGAGAGGAGAGGG - Intronic
1049703423 8:144025023-144025045 GAGAGGGTCCTGAGGTGAGATGG - Intronic
1049703433 8:144025055-144025077 AGGTAGGTCCTGAGGGGAGATGG - Intronic
1049703439 8:144025075-144025097 AAGAGTTTCCTTAGGGGAGAAGG - Intronic
1049703463 8:144025187-144025209 GAGAGGGTGCTAAGGGGAGAGGG - Intronic
1049703469 8:144025203-144025225 AAGAGAGTCCTGAAGGGAGAGGG - Intronic
1049866971 8:144945684-144945706 AGTAGAGTCCTGAGGGGAGAGGG + Intronic
1050414152 9:5397624-5397646 AAGAGGGGAGAGAGGGAAGAAGG + Intronic
1050545377 9:6704693-6704715 AAAAGGGCCCTGAGGGCTGAGGG - Intergenic
1052291993 9:26852473-26852495 AAAAGGGTATTGAGAGAAGAGGG + Intronic
1052369889 9:27652054-27652076 AATAGTCTCCTGATGGAAGATGG + Intergenic
1053021381 9:34696854-34696876 GGGTGGGTCCTGAGGGAAAAAGG - Intergenic
1054808336 9:69413448-69413470 CACAGGCTCCTCAGGGAAGAGGG + Intergenic
1055566469 9:77573864-77573886 AAGAGGGTCAGGAGAGAAGGTGG + Intronic
1055985862 9:82056251-82056273 AAGTGGGACCTGGGAGAAGAGGG - Intergenic
1056429518 9:86513522-86513544 AAAAGCGTCCTGAGGACAGATGG - Intergenic
1056563638 9:87755097-87755119 AAGAGGGAGCTAAGGCAAGAGGG - Intergenic
1059745037 9:117191937-117191959 AAAAGGATCATGAGGGAGGAGGG + Intronic
1059792377 9:117654075-117654097 CAGAAGTTCCTGAGGGAACACGG - Intergenic
1060831770 9:126722136-126722158 AAGAGGGGCCTGAGGGAAGAGGG - Intergenic
1061399037 9:130358396-130358418 AAGGTGGACCTGAGGGACGAGGG + Intronic
1061466039 9:130780589-130780611 GAGAGGGAGATGAGGGAAGAGGG - Intronic
1061714987 9:132513448-132513470 GGGAGGGTCCTCAGGGAAGACGG - Intronic
1062540240 9:137038845-137038867 AAGAAGGCCCCGAGGGAGGAAGG - Intergenic
1062569103 9:137176315-137176337 AAGAGGGTTCAGAGGGAACGGGG + Intronic
1203544841 Un_KI270743v1:121156-121178 AAGCGGGACCAGAGAGAAGAGGG + Intergenic
1186020615 X:5251217-5251239 AAGAAGGGAGTGAGGGAAGAAGG + Intergenic
1186127833 X:6433306-6433328 AACAGGGTGCTGATGGAGGATGG - Intergenic
1186434244 X:9529376-9529398 AAGGCAGTCCTGAGGGATGATGG + Intronic
1187035025 X:15529317-15529339 AAGAGGGGGGTGAGGGTAGAAGG - Intronic
1189227326 X:39423826-39423848 AAGAGAGTGCTGAGGAGAGAGGG + Intergenic
1190030267 X:46965677-46965699 AAGAGGGTCCTCCTGGGAGAAGG + Intronic
1190621048 X:52287563-52287585 CAGAGGGGCCTGAGGGAGCAAGG - Intergenic
1190843567 X:54169569-54169591 TAGAGGGGCTTGAGGGAATATGG - Intronic
1190998796 X:55637550-55637572 AAGGGGGTGCTGAGGGCAGCTGG + Intergenic
1191699496 X:64024539-64024561 AACTGGGGGCTGAGGGAAGATGG - Intergenic
1191893696 X:65971224-65971246 AGGCTGGTCCTGAGGGAAGGAGG - Intergenic
1192419849 X:71020008-71020030 AAGAGGTTATTGAGGTAAGATGG - Intergenic
1192914286 X:75636737-75636759 AAGAGGGAATTGAGGGTAGAAGG + Intergenic
1194134904 X:90129632-90129654 AAGTTGGTACTGAGGGAAGTGGG + Intergenic
1194845578 X:98803567-98803589 GAGAAGGCCCTGAAGGAAGAGGG + Intergenic
1195010371 X:100727854-100727876 CAGGGAGTGCTGAGGGAAGAGGG + Intronic
1195146451 X:102022126-102022148 AGGAGGGTCCTGGTGGGAGATGG + Intergenic
1196683983 X:118495576-118495598 GCGAGGGTCACGAGGGAAGAGGG - Intergenic
1198229604 X:134676447-134676469 AACTGTCTCCTGAGGGAAGAGGG + Intronic
1198361961 X:135904280-135904302 CATAGTGTCGTGAGGGAAGAAGG + Intronic
1200175688 X:154114498-154114520 AAGAGGTTGCTGAGAGCAGATGG - Intergenic
1200480690 Y:3699723-3699745 AAGTTGGTACTGAGGGAAGTGGG + Intergenic