ID: 1049703043

View in Genome Browser
Species Human (GRCh38)
Location 8:144023677-144023699
Sequence ATCCCAAGGGGGGTCCTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 2, 1: 0, 2: 0, 3: 6, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049703043_1049703055 7 Left 1049703043 8:144023677-144023699 CCCCTCAGGACCCCCCTTGGGAT 0: 2
1: 0
2: 0
3: 6
4: 150
Right 1049703055 8:144023707-144023729 CCTCAAGACCCCCTTCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049703043 Original CRISPR ATCCCAAGGGGGGTCCTGAG GGG (reversed) Intronic
903570281 1:24299309-24299331 ATGCCAAATGAGGTCCTGAGTGG - Intergenic
912431600 1:109630971-109630993 ATACCAAGGAAGGCCCTGAGGGG + Exonic
914260558 1:145995789-145995811 GTCCTAAAGGGGATCCTGAGGGG - Intronic
915314798 1:155022360-155022382 ATTCCAAGGGGAGGCCTGTGTGG - Intronic
917693673 1:177495687-177495709 ATCCCACGGCAGATCCTGAGGGG + Intergenic
918042457 1:180921590-180921612 AGCCCAAGGGGTGGCCTGTGGGG - Intronic
919820179 1:201467750-201467772 CTCCCAAGGTGGGGCCTCAGTGG - Intronic
919939506 1:202276543-202276565 ATCCCCAGTGGGGTCCTGCTGGG + Intronic
922686082 1:227639689-227639711 ATCCCAGTGGGGGTCCTGGTTGG + Intronic
923133140 1:231094886-231094908 ATCCCAAGGGTGGGACTGTGAGG - Intergenic
1067223714 10:44362111-44362133 TTCCCAAGAGGGGACTTGAGGGG - Intergenic
1067523624 10:47025899-47025921 ATCCCCAGGAGGGGCCAGAGTGG - Intergenic
1067770611 10:49120957-49120979 TTCCCAGGTGGGGTCCTTAGGGG - Intergenic
1067802780 10:49370583-49370605 ATCTGAAGGGAGGTCCTCAGAGG + Intronic
1070810401 10:79294864-79294886 ATCCTAAGGTGGATACTGAGGGG - Intronic
1077182680 11:1223610-1223632 ATCCCCAGGGAGGTCGTGAAGGG - Intronic
1079665199 11:23096014-23096036 AACCCATGGGAGGCCCTGAGAGG - Intergenic
1086359461 11:86042778-86042800 AACCCAAGCAGGGTCCAGAGTGG + Intronic
1086987046 11:93261853-93261875 ATCCCACCGGGGGTCTTGGGTGG - Intergenic
1090358998 11:126159928-126159950 ACGCCGAGGGGGGTGCTGAGGGG - Intergenic
1091782499 12:3222816-3222838 ATCCCAGGGTGGGACCTGGGGGG - Intronic
1093072820 12:14724324-14724346 ATCCCAAAGCAGATCCTGAGGGG - Intergenic
1101552147 12:105773061-105773083 ATCCCCAGAGGGATCCTGATTGG + Intergenic
1102229350 12:111251805-111251827 ATCCCAGCGGTGGTCCAGAGGGG + Intronic
1102437789 12:112938736-112938758 GTCCAAAGGGGAGTCCTGGGAGG + Intronic
1104996657 12:132662150-132662172 ATCCCAAGAGGGGTGCAGACTGG + Intronic
1106683741 13:32034744-32034766 AGCTCAAAGAGGGTCCTGAGTGG - Intronic
1113531801 13:111032624-111032646 AGCCCAGGGGGGTTCCTGACGGG + Intergenic
1117339841 14:54783725-54783747 AGCCCAAGTGGGGTTCAGAGAGG - Intronic
1117735029 14:58760260-58760282 TTCCCAAGGGGAGTTCTGGGAGG + Intergenic
1122025670 14:98873988-98874010 ATTCCAAGGGAAGTCCTGTGAGG - Intergenic
1122439496 14:101720233-101720255 ATGTCACGTGGGGTCCTGAGTGG + Intergenic
1124396948 15:29310428-29310450 ATCTCTAGGGAGGTCCTCAGAGG + Intronic
1124876427 15:33599240-33599262 ACCACAGGGGGGATCCTGAGTGG - Intronic
1129667036 15:77585020-77585042 AGCCCAAGGGCGCTGCTGAGAGG + Intergenic
1129679798 15:77652208-77652230 ATCCCTAGGGTGGCCCTGTGAGG - Intronic
1130324808 15:82871430-82871452 CTCCCAAGGCGTGTGCTGAGGGG - Intronic
1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG + Intronic
1133922228 16:10163611-10163633 TTCCCAAGGGAGGGGCTGAGTGG - Intronic
1136222081 16:28835404-28835426 CTGCCATGGGGGGTGCTGAGTGG + Intronic
1136242814 16:28954870-28954892 CTCCCAAGGGTGATCCTGAAGGG - Intronic
1136689736 16:32020564-32020586 ATGCCCAGGGGGGCCCAGAGAGG + Intergenic
1136790323 16:32964122-32964144 ATGCCCAGGGGGGCCCAGAGAGG + Intergenic
1136879490 16:33889810-33889832 ATGCCCAGGGGGGCCCAGAGAGG - Intergenic
1141657036 16:85421950-85421972 ACCTCAAGGGGGGTGCTGTGGGG - Intergenic
1142050770 16:87956780-87956802 TTCCAAAGGGGGGGCCAGAGTGG - Intronic
1143512703 17:7405102-7405124 ATCCCGAGGGCGGGCGTGAGGGG - Intronic
1143530773 17:7502066-7502088 ACGCCATGGGGGGTCGTGAGGGG + Exonic
1146111063 17:30089861-30089883 ATCCCAAGGGGAGCTCTGAAAGG - Intronic
1147175612 17:38654505-38654527 ATCCTACGGGGGCTTCTGAGAGG - Intergenic
1147319401 17:39636893-39636915 TTCCCGAGGGGAGTCCTGTGGGG - Intergenic
1147360097 17:39924956-39924978 ATCACAAGGGTTGGCCTGAGTGG - Intronic
1147650684 17:42060132-42060154 ATCAGAAAGGGGGTGCTGAGAGG - Intronic
1147845137 17:43399477-43399499 CTCCCTGGGGGGGTCGTGAGGGG - Intronic
1151357744 17:73570498-73570520 ATCACAAGAGGGGTGCTGGGTGG - Intronic
1151483960 17:74387177-74387199 ATCCCCAGGCGGCTCCTGGGAGG - Intergenic
1151666341 17:75547166-75547188 ATCGCCCCGGGGGTCCTGAGAGG + Intronic
1151780049 17:76239947-76239969 AGCCCAAGGGGCGTCCTGCCGGG - Intronic
1152227763 17:79100586-79100608 ATCACATGGGGGGCCATGAGAGG + Intronic
1152290452 17:79437183-79437205 ACCCCAGGGGGGCTCCTGGGGGG - Intronic
1153171966 18:2327011-2327033 TTCTCAAGGGGTGACCTGAGAGG - Intergenic
1153371303 18:4319492-4319514 ATCAGAAGGGGGATCCTGGGAGG + Intronic
1153549165 18:6242579-6242601 ATCCCAAGGGACACCCTGAGTGG + Intronic
1154141171 18:11826153-11826175 ATCCCATGGGGGATGGTGAGTGG - Intronic
1156291836 18:35754577-35754599 TCCCCAAGGTGGTTCCTGAGGGG + Intergenic
1158457385 18:57620218-57620240 ATGACCAGGGGGCTCCTGAGAGG - Intronic
1159022888 18:63157363-63157385 GTCCCAAAGGGGATCCTCAGAGG + Intronic
1161047340 19:2142724-2142746 ACCCCAATGGGGGCTCTGAGGGG + Intronic
1161231341 19:3176556-3176578 CCACCAAGGAGGGTCCTGAGGGG - Intronic
1161284182 19:3460260-3460282 ATGCCAAGGGGATTCCTGAGAGG + Intronic
1165375490 19:35438899-35438921 ATCCCAAGAGGGGGCCAGATGGG - Intergenic
1166304619 19:41930598-41930620 CTCCCAAAGGGTGTCCTGTGTGG - Intergenic
1166497582 19:43315495-43315517 ATCCCACTGTGGGTCTTGAGTGG + Intergenic
1166542734 19:43616185-43616207 ACCACAAGGGGGGTCCAAAGTGG + Intronic
1166552626 19:43676512-43676534 CTCCCCAGGGAGGCCCTGAGTGG - Intergenic
1167007321 19:46784490-46784512 GTCCTCAGGGGTGTCCTGAGGGG - Intronic
1167712296 19:51119893-51119915 AGACCCAGAGGGGTCCTGAGCGG + Intergenic
1168290041 19:55353181-55353203 ATCCCATCTCGGGTCCTGAGGGG - Intronic
1168464481 19:56590404-56590426 ATCCCAAGGGAGGTTCAGAAGGG - Intergenic
926730838 2:16034368-16034390 ATCCCAGGTGTGGTCCTGGGGGG + Intergenic
927497982 2:23563431-23563453 GCCCCAAGGGGGCTCCTGGGAGG - Intronic
929144277 2:38693028-38693050 ATCCCTAGGGTGGCCCTGGGTGG + Intronic
929543560 2:42841176-42841198 ATCCCTAGGGGGGTCCTTGAGGG - Intergenic
931263061 2:60637181-60637203 ATCACAAGGGGGGACGAGAGTGG + Intergenic
932720690 2:74137232-74137254 ATCCCAAGGGAGATTCTAAGTGG - Intronic
933168260 2:79097713-79097735 ATCCCAGTGGGGGTCCTGGCTGG + Intergenic
935080596 2:99789583-99789605 ATCCCAGGGGGGATGCAGAGAGG - Intronic
937237359 2:120438778-120438800 GTCACAAGGGGCCTCCTGAGAGG - Intergenic
938422115 2:131154233-131154255 ATCTCAGGAGAGGTCCTGAGAGG + Intronic
939496837 2:142935399-142935421 ATACCAGTGGGGGTCCTGATTGG + Intronic
946227929 2:218274467-218274489 AACCCAGGGAGGGTCCTAAGAGG - Exonic
948507097 2:238435678-238435700 AACACAAGGGGGCTCATGAGAGG - Intronic
948886846 2:240888918-240888940 CCCCCAAGGGAGGTCCTGGGGGG - Intronic
1168823620 20:793841-793863 TTCCCATGGGGGGTCCTGGGCGG - Intergenic
1171273462 20:23834708-23834730 ACCCCATGTGGGGTCCAGAGAGG - Intergenic
1171279630 20:23884771-23884793 ATCCCATGTGAGGTCCAGAGAGG - Intergenic
1173304139 20:41831755-41831777 AGCCAAAGGAGAGTCCTGAGGGG + Intergenic
1173495575 20:43515039-43515061 ATCCTCTGGGGGGTCCTGATTGG - Exonic
1175408144 20:58748314-58748336 ATCCCTAGGGGCCTCCAGAGAGG - Intergenic
1176426784 21:6553143-6553165 AACCCAAGGCGGGTCCTTTGGGG + Intergenic
1176962501 21:15175223-15175245 AGTCCATGGGGAGTCCTGAGTGG + Intergenic
1178810012 21:35872902-35872924 ATTCCAAGGGGTGACATGAGGGG - Intronic
1179667655 21:42923688-42923710 ATCCCAGTGGGGGTCCTGGCTGG + Intergenic
1179702275 21:43161465-43161487 AACCCAAGGCGGGTCCTTTGGGG + Intronic
1180201498 21:46227496-46227518 ATCCCAAGGGTGATCCAGGGTGG + Intronic
1180995167 22:19961933-19961955 TTCCCAAGGGGAGTGGTGAGTGG + Intronic
1183893891 22:40951907-40951929 TCACCAAGGGGGGTCCTCAGAGG - Intronic
1185011970 22:48319464-48319486 GTCCCATGTGGGGTCCTGACAGG + Intergenic
950628301 3:14264674-14264696 ATGACAAGGGTGGTCCTTAGCGG + Intergenic
953929951 3:47000901-47000923 ACCCCAGGAGGGGTGCTGAGTGG + Intronic
958424633 3:93966141-93966163 CTCTCAGGGGTGGTCCTGAGAGG + Intronic
960143303 3:114172013-114172035 ATGCCAAGGGGCTTCCTGTGAGG + Exonic
960950726 3:122996942-122996964 AACCCAAGGGTGGACCAGAGAGG - Intronic
965872116 3:173276286-173276308 ATCCCAGTGGGGGTCCTGGTTGG - Intergenic
969546681 4:7834670-7834692 ACCCCAAGGGGGCAGCTGAGGGG + Intronic
969602369 4:8183841-8183863 ATACAAAGTGGGGTCCTGGGTGG - Intronic
971599711 4:28576637-28576659 ATCCCAAGGGCAGTTCTGAAGGG - Intergenic
971630148 4:28981029-28981051 AACCCCAGGGTGGTCTTGAGGGG + Intergenic
974958683 4:68673652-68673674 ATCCCAGTGGGGGTCCTGGTTGG - Intergenic
976208473 4:82644087-82644109 ATCCTAAGTGGGGACCTGGGTGG - Intronic
976300133 4:83508931-83508953 ATCCCAGTGGGGGTCCTGGTTGG + Intronic
978310653 4:107381958-107381980 GTCCCAATGGGGGTCTTGAGTGG - Intergenic
984734677 4:183098664-183098686 ACCCCAAGGGCGGTCCGGGGTGG - Intergenic
985248429 4:187999224-187999246 TTCCCAAGGGAGGCCGTGAGTGG - Exonic
986265090 5:6184147-6184169 CTGCCAGGTGGGGTCCTGAGGGG - Intergenic
989585897 5:43073729-43073751 ATCCCAGTGGGGGTCCTGGTTGG + Intronic
990184942 5:53202240-53202262 ATCCCAGTGGGGGTCCTGGTTGG - Intergenic
998135645 5:139673010-139673032 ATCAGTAGGGAGGTCCTGAGGGG + Intronic
1001264309 5:170261605-170261627 ACACCAAGGTGGGCCCTGAGAGG - Intronic
1001670266 5:173468021-173468043 ATCACAAGTGGGGACTTGAGGGG + Intergenic
1002445936 5:179289969-179289991 ATGCCACGTGGGATCCTGAGGGG + Intronic
1005207939 6:23426436-23426458 ATTTCAAGTGTGGTCCTGAGGGG - Intergenic
1006155756 6:32011985-32012007 AGCCACAGGGGGGTCCTGTGGGG + Intergenic
1006162087 6:32044839-32044861 AGCCACAGGGGGGTCCTGTGGGG + Intronic
1007098937 6:39231399-39231421 TTGGCCAGGGGGGTCCTGAGGGG - Intergenic
1015819500 6:137245511-137245533 GTCCCAAGGGGTGGCCTGAGTGG + Intergenic
1019734698 7:2644933-2644955 ATCCCAAGGGGGGGCCAGGCAGG + Intronic
1023046493 7:36214835-36214857 ATTCCAAAGGAGGTTCTGAGTGG - Intronic
1023871705 7:44266753-44266775 GTCCCAAGAGGCCTCCTGAGTGG + Intronic
1024543486 7:50498412-50498434 ATGCCATAGAGGGTCCTGAGAGG - Intronic
1025023063 7:55495133-55495155 GTCCCATGCGGAGTCCTGAGTGG - Intronic
1027202213 7:76071512-76071534 AGCCGAAGGCGGGGCCTGAGAGG + Intergenic
1027202511 7:76072660-76072682 AGCCGAAGGTGGGGCCTGAGAGG + Intergenic
1029803675 7:102975464-102975486 ATCCCAGTGGGGGTCCTGGTTGG - Intronic
1040482871 8:47842156-47842178 ACCCCAAGGGGGGCCCTGGTGGG - Intronic
1040905908 8:52469793-52469815 AACCCCTGGAGGGTCCTGAGTGG - Intergenic
1047210262 8:122834931-122834953 ATCCCAGTGGGGGTCCTGGTTGG + Intronic
1049156871 8:141072746-141072768 GTCCACAGGGGGGTCCAGAGGGG + Intergenic
1049353710 8:142177533-142177555 ACCCCAAGGGGGGTCTGGAGGGG + Intergenic
1049703043 8:144023677-144023699 ATCCCAAGGGGGGTCCTGAGGGG - Intronic
1049703277 8:144024487-144024509 ATCCCAAGGGGGGTCCTGAGGGG - Intronic
1055676393 9:78666615-78666637 ATGCCAAGGAGTGTACTGAGAGG - Intergenic
1059560893 9:115333638-115333660 ACACCAAGGGTGGTCCTGGGGGG - Intronic
1189261061 X:39679102-39679124 ATCCCAAGGAGGGCTCTGATTGG - Intergenic
1190259037 X:48786566-48786588 ATCCCAGGGGGTGTCCTGGCTGG - Exonic
1192282667 X:69701865-69701887 ATCCCAGTGGGGGTCCTGGTTGG + Intronic
1195320857 X:103720992-103721014 ACCCCAAGGGGGCTCCTGGGTGG - Intronic
1200569663 Y:4812828-4812850 ATTCCAAGTGTGGTCCTGAAGGG + Intergenic