ID: 1049703349

View in Genome Browser
Species Human (GRCh38)
Location 8:144024764-144024786
Sequence GGGTAGGTCTTGAGGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 1, 2: 3, 3: 34, 4: 339}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049703349_1049703365 21 Left 1049703349 8:144024764-144024786 CCCTCTCCCCTCAAGACCTACCC 0: 1
1: 1
2: 3
3: 34
4: 339
Right 1049703365 8:144024808-144024830 CCTGAGGACCCTCTTCCCTCAGG No data
1049703349_1049703360 5 Left 1049703349 8:144024764-144024786 CCCTCTCCCCTCAAGACCTACCC 0: 1
1: 1
2: 3
3: 34
4: 339
Right 1049703360 8:144024792-144024814 CCTCAGCACCCTCTTCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049703349 Original CRISPR GGGTAGGTCTTGAGGGGAGA GGG (reversed) Intronic
900104430 1:976318-976340 GGCTGGGTCTTGCGGGCAGACGG - Intronic
900129482 1:1081371-1081393 GGACAGGCCTTGAGGGCAGAGGG - Intergenic
900518767 1:3095718-3095740 GGGTAGGATTTGAGGGGGGCAGG + Intronic
900544609 1:3221635-3221657 GGGCAGGCATTGAGGGGAGAAGG - Intronic
900738044 1:4311646-4311668 GAGGAGGTCGGGAGGGGAGACGG - Intergenic
901456749 1:9367540-9367562 AGGTAGGCCTTGAGGGAAGCCGG - Exonic
902113398 1:14101511-14101533 GAGTAGGGATTGAAGGGAGAGGG + Intergenic
902241283 1:15090977-15090999 GGGAAGGCCTTGTGGGGAGGGGG + Intronic
902469871 1:16641647-16641669 GTGTAGGGCTTGTGGGGAGATGG + Intergenic
902790780 1:18766389-18766411 GGGTAGGTGAAGAGGGCAGAGGG + Intergenic
903575136 1:24335178-24335200 CTGTGGGTCTTCAGGGGAGAGGG - Intronic
903763006 1:25712372-25712394 GGGAGGGTCTGGAGAGGAGATGG + Intronic
905008590 1:34731133-34731155 GGGCAGGGCATGAGGGGAGCAGG - Intronic
905035244 1:34913970-34913992 GGGAAGGTCGTGGAGGGAGAAGG + Intronic
905627738 1:39499371-39499393 GGGGAGGGTCTGAGGGGAGATGG + Intronic
906754185 1:48293017-48293039 TGGGAGGTCTTCAGTGGAGAAGG + Intergenic
906967421 1:50472103-50472125 CCGTAGGTCTGGAGGGGAGCTGG + Intronic
907904771 1:58774443-58774465 GGGTTGGTGTTAAGGGGAAATGG - Intergenic
908513744 1:64871570-64871592 GGGAAGGTCTTGGGGGAAGAGGG - Intronic
908649291 1:66314289-66314311 GGGTGAGGCATGAGGGGAGAGGG - Intronic
910676951 1:89824223-89824245 GAATAGGTCTTGAAGGGAGGTGG + Intronic
910934382 1:92475637-92475659 GGGTAGGTCAAGAGGGGGGAGGG + Exonic
914718078 1:150267924-150267946 GGAGTGGTCTGGAGGGGAGAGGG - Intronic
915439253 1:155934315-155934337 GGGTACGGCTTCAGGGGCGAGGG - Exonic
916070137 1:161165285-161165307 GGTTCGGTCTTGTAGGGAGAAGG + Intronic
917213180 1:172651059-172651081 GAGAAACTCTTGAGGGGAGAAGG + Intergenic
917288912 1:173451978-173452000 GGGTAGATTTTGAGGAGAGTGGG - Intergenic
917310078 1:173669703-173669725 GGGCAGGGCTGGAGGGGAGTGGG - Intronic
918134747 1:181661542-181661564 GGGTAGGTCTTAAGGGAAAGAGG + Intronic
918841773 1:189549839-189549861 GGGTAGGAGGGGAGGGGAGAAGG + Intergenic
919373218 1:196758347-196758369 GTATAGGGCTAGAGGGGAGATGG - Intergenic
919379662 1:196843031-196843053 GTATAGGGCTAGAGGGGAGATGG - Intronic
919645066 1:200087207-200087229 GTGTATGTGTTGAAGGGAGAGGG - Intronic
919917132 1:202145551-202145573 GGGTGGGTCTTGCAAGGAGAGGG - Intergenic
920179825 1:204125780-204125802 GAGGAGGCCTGGAGGGGAGATGG + Intronic
920693137 1:208161963-208161985 GGGTAGGTGCTGGGAGGAGAGGG + Intronic
922727183 1:227927938-227927960 GGGTAGGGGATGAGGGGACAAGG + Intronic
923024928 1:230196598-230196620 GTGTGGGTCTTGACAGGAGATGG + Intronic
923545751 1:234922132-234922154 GGGTAACTCCTGAGGGGAGGTGG + Intergenic
923649858 1:235864342-235864364 GAGTAGGTTTGGTGGGGAGAAGG - Intronic
924018990 1:239760565-239760587 GAGGAGCTCATGAGGGGAGAGGG - Intronic
924417007 1:243866135-243866157 TGGTTACTCTTGAGGGGAGAGGG - Intergenic
924454264 1:244205914-244205936 GGCTAAGTCTTGAAGGGTGACGG + Intergenic
1063527127 10:6796676-6796698 GGGTGGGGCTTGGGGAGAGAAGG - Intergenic
1064273793 10:13888480-13888502 GGGGAGGTCATGAGGGCACATGG + Intronic
1064973394 10:21088974-21088996 GTGAAGCTCTAGAGGGGAGATGG + Intronic
1069752095 10:70751464-70751486 GGGGAGAGCCTGAGGGGAGATGG - Exonic
1070421749 10:76244295-76244317 GGGTAGGAGGTGATGGGAGAAGG - Intronic
1070773437 10:79096149-79096171 GGGTGGGTCTGGAGGAGAGGGGG + Intronic
1073077662 10:100834828-100834850 AGGAAGGTCTTGAAGGGACAGGG + Intergenic
1073115883 10:101091403-101091425 GGGTGGGGCCTGAGGGGACAGGG - Intronic
1074192590 10:111150648-111150670 GGGTATGTCTTCAGGGCACAGGG - Intergenic
1075950498 10:126473469-126473491 GAACAGGTCTTGAGAGGAGATGG + Intronic
1076599144 10:131645869-131645891 GTGTGTGCCTTGAGGGGAGAGGG + Intergenic
1077020188 11:413879-413901 GGGAAGGTGGGGAGGGGAGAGGG - Intronic
1077020229 11:414017-414039 GGGAAGGTGTGCAGGGGAGAGGG - Intronic
1077020277 11:414170-414192 GGGAAGGTGTGCAGGGGAGAGGG - Intronic
1077101835 11:825908-825930 AGGGAGGCCATGAGGGGAGAAGG + Intergenic
1079139303 11:17797102-17797124 GGGCAGCCCTTGAGGGGTGATGG - Intronic
1079282859 11:19103576-19103598 GGGTAGGTAGAGAGTGGAGAGGG - Intergenic
1081657648 11:44868077-44868099 GGGTTGGGCCTGTGGGGAGATGG + Intronic
1082274017 11:50201944-50201966 GGGTAGGTTTGCAGGGAAGATGG - Intergenic
1083310412 11:61780903-61780925 TGGGAGAGCTTGAGGGGAGAGGG - Intronic
1083628725 11:64085150-64085172 GGATGGGGCTTGAGGGCAGAGGG + Intronic
1084408472 11:68992392-68992414 GGGGAGGTGTCGAGAGGAGAGGG + Intergenic
1084861506 11:72021502-72021524 CGGTACATCTTGAGGGGAGGTGG - Intronic
1084889080 11:72227956-72227978 GTGTAGGTCTGGTGGGGAGACGG + Intronic
1088600665 11:111471827-111471849 GGGAAGGTTTTGAGTGGAGCAGG - Intronic
1088811564 11:113396009-113396031 AGGTAGGGCTGGAGGGGAGCTGG - Intronic
1089176475 11:116552340-116552362 GGGAAGGTCTGGGGGAGAGAAGG - Intergenic
1090228434 11:125085276-125085298 GGTTTGGGCTTGAGAGGAGAGGG - Intronic
1091667524 12:2430171-2430193 GATTAGGTCATGAGGGCAGAAGG - Intronic
1092239712 12:6829161-6829183 GGGGAGGTCGTGAGGTGGGACGG + Intronic
1092288595 12:7144751-7144773 GGGTGGGTTTAGAGGGGAGAGGG + Intronic
1093024882 12:14236535-14236557 GGGGTGGTCTGGAGGGGTGATGG - Intergenic
1094842902 12:34349388-34349410 GGGTGGGTGTGGAGGGGACAAGG + Intergenic
1095279075 12:40328135-40328157 GGGTATGTGTAGAGGGAAGACGG + Intronic
1096334678 12:50744475-50744497 TGGTTGGGATTGAGGGGAGAAGG + Intronic
1097240066 12:57569086-57569108 GGGTGTGGCTTGAGGGGTGAGGG - Intronic
1098740531 12:74168479-74168501 GGGTAGGGCAGGAGGGGAGCAGG + Intergenic
1102011819 12:109623824-109623846 GGGTAGGTCTGGTGGGGAGCTGG - Intergenic
1104030082 12:125058757-125058779 TGGAAGGTTTTGAGCGGAGAGGG - Intergenic
1104035150 12:125092683-125092705 GGGGAGGTCCTGGGGTGAGATGG - Intronic
1104558344 12:129822203-129822225 GAGCAGGGCTGGAGGGGAGAAGG + Intronic
1108803978 13:54131827-54131849 GGGTTGGTACTGAGGGGACAGGG + Intergenic
1111239149 13:85451899-85451921 GGGGACTTCTAGAGGGGAGAGGG - Intergenic
1112035707 13:95494903-95494925 GAGTAGGGGTGGAGGGGAGAAGG - Intronic
1112077468 13:95929452-95929474 GGGGATTTCTAGAGGGGAGAGGG - Intronic
1113055948 13:106268274-106268296 GAGTAGGTGTTGATGGGAGATGG - Intergenic
1113677107 13:112214888-112214910 GGGGAGGCCTGGAGGGGAGGAGG + Intergenic
1113677252 13:112215304-112215326 GGGGAGGGCTGGAGGGGAGAAGG + Intergenic
1117049118 14:51843156-51843178 GGAAAGGTCTTCAGGGGAGAGGG + Intronic
1118683600 14:68268965-68268987 GGGTGGCGCCTGAGGGGAGAAGG - Intronic
1118837305 14:69485936-69485958 TGGGAGGTATTGAGGGAAGAGGG + Intronic
1119777140 14:77256441-77256463 GGGTGGGGCATGAGGGGAGAGGG + Intronic
1121467998 14:94128328-94128350 GGGTAGGAGTGGAGGGGTGATGG - Intronic
1121698849 14:95936424-95936446 GGGTTGGTGGTGGGGGGAGAAGG - Intergenic
1121794586 14:96724488-96724510 GGGTAGGCACTGAGGGGAGGTGG - Intergenic
1122417788 14:101558508-101558530 GGGTTGCTCTGGAGGAGAGAGGG + Intergenic
1122450098 14:101798908-101798930 GGGTCTGTGTTCAGGGGAGAGGG + Intronic
1122606074 14:102948287-102948309 GGGTGGGTGTGGAGGTGAGACGG + Intronic
1122606105 14:102948352-102948374 GGGTAGGTGTGGAGGTGAGGGGG + Intronic
1122606250 14:102948707-102948729 GGGTGGGTGTGGAGGTGAGAGGG + Intronic
1123434852 15:20247661-20247683 GGGGAGGGGATGAGGGGAGAGGG + Intergenic
1123434861 15:20247681-20247703 GGGGAGGGGATGAGGGGAGAGGG + Intergenic
1124036274 15:26056454-26056476 AGGTATGTCTTGAGGAGAGGAGG - Intergenic
1124463637 15:29916882-29916904 GGGTAGGGCTTGAAAGGAAATGG - Intronic
1124970074 15:34479972-34479994 GGGTTGGTGGGGAGGGGAGAGGG - Intergenic
1126049505 15:44673464-44673486 GTGAAGTTCTTGAGGGGAAAAGG - Intronic
1127341545 15:58049996-58050018 GTGTGGGTCTTGAGGGGGAAGGG + Intronic
1127469212 15:59275620-59275642 GGGTGGGTTTTTAGGGGAGTGGG - Intronic
1128448437 15:67785563-67785585 GGGTCCATCTTGAAGGGAGAGGG + Intronic
1130833645 15:87628586-87628608 GGAAAGGTCTGGAGGGAAGAGGG - Intergenic
1132634142 16:934868-934890 GGGTAGGTCTTGCTGTGAGGTGG - Intronic
1132686306 16:1163528-1163550 GGGAAGGTGTGGAGGGGCGAGGG + Intronic
1132763189 16:1520932-1520954 GGGTGGGTATGGAGGGGACAAGG + Intronic
1133450095 16:5896717-5896739 GCATAGCTCTTCAGGGGAGAGGG + Intergenic
1135063897 16:19293003-19293025 GAGAAGGTCTTCATGGGAGAAGG + Intronic
1135173621 16:20208851-20208873 GGGTGGGTATTGAGGGGACAGGG + Intergenic
1135957430 16:26967461-26967483 GGGTAGTTCCGGAAGGGAGATGG + Intergenic
1139419966 16:66844223-66844245 GGGTGGGAGTTGGGGGGAGAGGG + Intronic
1143155751 17:4834883-4834905 GGATATGGCTGGAGGGGAGAGGG + Intronic
1143359307 17:6354970-6354992 GGGTAGGGGTTAAGGGGAGGGGG + Intergenic
1143562482 17:7704192-7704214 GGGAAGGTGTTGGGGGGAGGAGG - Intergenic
1143887198 17:10073573-10073595 TAGGAGGTCTTGAGGGGAGCGGG - Intronic
1144813293 17:18015845-18015867 GGGCAGGTGTTGTGGGGAAAGGG - Intronic
1146171947 17:30641251-30641273 GGGTAGGTTTTGAAGGCAAATGG - Intergenic
1146345406 17:32057287-32057309 GGGTAGGTTTTGAAGGCAAATGG - Intergenic
1146910464 17:36645433-36645455 GGGTAGGACCAGAGGGGAGGGGG - Intergenic
1147121092 17:38335464-38335486 GGGTTGGCCTTGGGGGTAGAGGG + Intronic
1147241148 17:39091300-39091322 GGGTGTGTGTTGCGGGGAGATGG - Intronic
1148109709 17:45137495-45137517 GGGGAGGGCTGGAGGGGAGAAGG + Intronic
1148807979 17:50273729-50273751 GGGTAGATTTTGAGGGGTTATGG - Intronic
1151654871 17:75491158-75491180 GGGTGGGCCTTGCGGGGAGGAGG + Intronic
1152199922 17:78939388-78939410 GGGCTGGTCTAGATGGGAGAGGG + Intergenic
1152863404 17:82709076-82709098 GGGTGGGTGGTAAGGGGAGAGGG - Intergenic
1152863494 17:82709316-82709338 GGGTGGGTCATGGGGGCAGAGGG - Intergenic
1153371097 18:4316978-4317000 GTGTAGGTCATGAGGGAAGGAGG - Intronic
1153640899 18:7156179-7156201 GAGTGGGTGTTGAGAGGAGATGG - Intergenic
1153958335 18:10118118-10118140 AGGTAGGGCCTGAGGGGAGCCGG - Intergenic
1154274532 18:12947886-12947908 GGGCAGGGCTTGAGGGGCCAGGG + Intronic
1154308049 18:13244689-13244711 GGGTGTGTCTTGGGGGAAGAGGG - Intronic
1154980230 18:21497796-21497818 GGGGGGGTGGTGAGGGGAGAAGG - Intronic
1155498675 18:26466048-26466070 GGGTAGGTCTTTCTCGGAGAAGG - Intronic
1156446310 18:37239562-37239584 GGGGAGAACTTGAGGAGAGAAGG + Intergenic
1157688800 18:49664312-49664334 GGGCAGGTGTTGTGGGGAGCTGG - Intergenic
1158015685 18:52780752-52780774 GTGAAGGTCTTCAGGGGAGAAGG + Intronic
1159426512 18:68295485-68295507 GGGTAGGGCTTATGGTGAGAAGG + Intergenic
1159687304 18:71438402-71438424 GAGTAGGCCCTGAGGGAAGAAGG + Intergenic
1159763480 18:72457163-72457185 GGGAAGTTGTTGAGGAGAGAAGG + Intergenic
1159874864 18:73799565-73799587 GGGTAGGGATTGAGGGTAAAGGG - Intergenic
1160179039 18:76618686-76618708 GGCTGTGTCTTGAGGGAAGAAGG + Intergenic
1160465040 18:79069328-79069350 GGGTTGGCGCTGAGGGGAGAGGG + Intronic
1160695669 19:483247-483269 GGGTGGGTGTTGGGGGGGGATGG - Intergenic
1160966259 19:1748212-1748234 TGGTCGGTCTTGCGGGGAGGAGG + Intergenic
1161841867 19:6686719-6686741 GGGTTGGCCTGGAGGGGTGAAGG - Intronic
1162716304 19:12636633-12636655 GGGTAGGTCTTGGGGAGGGGAGG - Intronic
1162717139 19:12641327-12641349 GGGATGGTTTTGATGGGAGAAGG - Intergenic
1162990483 19:14298784-14298806 GGGTAGGTTTTGAAGGCAAATGG + Intergenic
1163183985 19:15623582-15623604 GGGTAGATCTGGAGGTGACAAGG + Intronic
1163845395 19:19635607-19635629 GGGTAGGTCAGGATGGGACAGGG - Intronic
1164742417 19:30585732-30585754 GGGAAGGTCATCAGGGGAGATGG - Intronic
1166352559 19:42206962-42206984 GGCTAGGTCTTGATGGGAGATGG - Intronic
1166627538 19:44372725-44372747 GGGTAGGTTGAGATGGGAGACGG + Intronic
1167041984 19:47027905-47027927 GGGGACATTTTGAGGGGAGAGGG + Intronic
1167267981 19:48493018-48493040 GGGAAGGGCCTGAGGGGTGAAGG - Intronic
1167306942 19:48714879-48714901 GGGCAGGGAGTGAGGGGAGAGGG + Exonic
1167694012 19:51003431-51003453 GGTTAGGTCCTGCGGGGAGGTGG - Intronic
1167726867 19:51220761-51220783 GGCAAGGTCTGGAGGGCAGATGG - Intergenic
1168516168 19:57011875-57011897 GGGGACTTCTAGAGGGGAGAGGG - Intergenic
1168628991 19:57942536-57942558 GGGTTGGTCTTCTGGGGAGAAGG + Exonic
926062782 2:9814481-9814503 GGGCAGGACTGGAGAGGAGAAGG + Intergenic
926229008 2:10988940-10988962 GGGGAGGTCAGAAGGGGAGAAGG - Intergenic
926676403 2:15626182-15626204 GGGTATGTGTGGAGGGGAGAGGG - Intronic
926904446 2:17792821-17792843 GGGAAGGGCTTGAGGGGTGGGGG - Intronic
927428614 2:23007993-23008015 GGGTGGGGCTGAAGGGGAGAGGG + Intergenic
928112756 2:28523905-28523927 GGTTAGGTAATGAGGGGAGCAGG - Intronic
928394948 2:30936293-30936315 GGGCAGGAATTCAGGGGAGAAGG + Intronic
928435795 2:31253730-31253752 GGGTGTGTCTTGTGGGAAGAAGG + Intronic
929103257 2:38338294-38338316 GGGGAGTACTAGAGGGGAGAGGG + Intronic
929952102 2:46419962-46419984 GGGTGGGAGTTGAGGGGGGAAGG + Intergenic
931076451 2:58719113-58719135 GAGTTGGTCTTGAAGAGAGAAGG + Intergenic
931573326 2:63693534-63693556 GGGGAGGATTTGAGGGGACAAGG + Intronic
932005450 2:67922604-67922626 CTGTTGGCCTTGAGGGGAGAAGG + Intergenic
932035667 2:68244383-68244405 GGGGTGGTTTTGAGGGGTGAGGG - Intronic
932431326 2:71675433-71675455 GGGTAGCCCTTGACTGGAGAAGG + Intronic
936133813 2:109871563-109871585 TGGGTGCTCTTGAGGGGAGAAGG - Intergenic
936210884 2:110499922-110499944 TGGGTGCTCTTGAGGGGAGAAGG + Intergenic
936435412 2:112501025-112501047 TGGGTGCTCTTGAGGGGAGAAGG + Intronic
936562358 2:113552096-113552118 GGGTGGGCATGGAGGGGAGAGGG - Intergenic
937882993 2:126882446-126882468 GGGTTGTTCTTGGGGTGAGAGGG - Intergenic
938545968 2:132331839-132331861 GGGTAGGTTGAGATGGGAGACGG - Intergenic
938768797 2:134482383-134482405 GTGTTGGTCTTTAGGGGAAAGGG - Intronic
938787119 2:134640291-134640313 GGGTTGGGCGTGAGGGGAGAAGG - Intronic
939669612 2:144993987-144994009 GGGTACTTCTAAAGGGGAGATGG + Intergenic
939865903 2:147472048-147472070 GAGAAGGTCCTGAGAGGAGAAGG - Intergenic
940855185 2:158723886-158723908 GGTTTGGTACTGAGGGGAGAAGG - Intergenic
942112080 2:172692623-172692645 GGGCAGGTCTTATAGGGAGAGGG + Intergenic
942649197 2:178149284-178149306 GGGCAGGTGTTCAAGGGAGAGGG + Intergenic
944082490 2:195804033-195804055 GGGCTGGTTTTGAGGGGAGAGGG + Intronic
944658331 2:201899012-201899034 GGGGAGGTGTTGTGCGGAGAGGG + Intergenic
946219897 2:218217342-218217364 GGGTAGGAGGTTAGGGGAGAAGG - Exonic
946539747 2:220671119-220671141 GGGGGGGTGTTGTGGGGAGATGG + Intergenic
947847818 2:233259738-233259760 GGGAAGATCTAGAGGGAAGAAGG - Intronic
948258331 2:236584481-236584503 GGGTGGGCCTTGAAGGGAGGAGG + Intergenic
948880748 2:240856051-240856073 GGGAAGGTCTTCAGGGGCCAAGG + Intergenic
1168833034 20:857758-857780 GTGAAGGACGTGAGGGGAGAGGG + Intergenic
1170478101 20:16736719-16736741 GGGTAGGTTTGGAGAGGAAAGGG + Intronic
1170507565 20:17043601-17043623 GGGTAGATATTGCGGGGAGGTGG + Intergenic
1170985823 20:21257306-21257328 GGGAAGGACTTCAGGGAAGAGGG + Intergenic
1171874828 20:30564572-30564594 GGGTAGGTTGAGATGGGAGACGG - Intergenic
1173044605 20:39497579-39497601 GCGTAGCTCTGGAGGGGAAATGG + Intergenic
1173246483 20:41341034-41341056 GGGCAGGGCGGGAGGGGAGAGGG - Intronic
1173380482 20:42535311-42535333 GGGGAGTACTTGAGGGTAGAGGG + Intronic
1174108375 20:48179655-48179677 GGGGAGGTCTTGGGAGGAGGTGG - Intergenic
1174744551 20:53048549-53048571 TGGTAGGTGTTGAAGGGAGAGGG - Intronic
1174750546 20:53107170-53107192 GGCTATGGCTTGAAGGGAGAGGG - Intronic
1174767432 20:53267196-53267218 GGATAGGCCTCGAGGGAAGATGG + Intronic
1175408466 20:58750725-58750747 GGGTAGGTCTTGGAGGATGAGGG + Intergenic
1177853451 21:26376197-26376219 GGGTTGGTAATGATGGGAGATGG + Intergenic
1178350570 21:31870570-31870592 GGGGAGGTCTTCATGGGAAAGGG + Intergenic
1178503588 21:33145435-33145457 TGGAAGGGCTGGAGGGGAGAGGG + Intergenic
1179500875 21:41807881-41807903 GGGTTGGGCTTGAGGGGAGTGGG + Intronic
1180192499 21:46172783-46172805 GGGAAGGTGCTGAGGGCAGATGG + Intronic
1181848580 22:25733233-25733255 GGGTAGGTTTTGAGGGCATGAGG - Intergenic
1181960201 22:26617177-26617199 GGGTAGGCTTTGGGTGGAGAGGG + Intronic
1182113843 22:27743574-27743596 GGGTTGGTACTGAGGGGACAGGG - Intergenic
1182510399 22:30815614-30815636 GTGTATGTCCTGAGGGGAGATGG - Intronic
1182698380 22:32211670-32211692 GGGTAGGTCAGGTGGGGTGATGG - Intergenic
1183312881 22:37120894-37120916 GGGTAGGTCTTGGGGGATGATGG - Intergenic
1183416695 22:37686649-37686671 GGGGAGGTCAAGAAGGGAGAAGG - Intronic
1183714824 22:39527514-39527536 GGGTAGCACTGGAGGAGAGAGGG - Intergenic
1184799897 22:46752964-46752986 GGGCAGGGCTAGAGGGGTGAGGG - Intergenic
950096116 3:10331678-10331700 GGGTAGGCAGGGAGGGGAGATGG - Intronic
950643226 3:14361580-14361602 GGGAAGGCCTTGGGGGCAGAGGG + Intergenic
950937191 3:16851133-16851155 GGATAGGTCTTTTGGGGAGAGGG + Intronic
952207431 3:31193964-31193986 GGAAAGGCCTGGAGGGGAGAGGG - Intergenic
952683243 3:36120213-36120235 GGGTAGGTATTGGGGGAAGCTGG + Intergenic
953384945 3:42501239-42501261 GGGGTGGGCTTGAGGGGAGTGGG - Intronic
954299562 3:49692606-49692628 GTATAGGGCTTGTGGGGAGATGG - Intronic
954498500 3:50988126-50988148 AGGAAGCTCCTGAGGGGAGAGGG + Intronic
954554239 3:51505718-51505740 GGGCATGACTTTAGGGGAGAAGG + Intergenic
955066174 3:55535418-55535440 GGGTGGGTTTTGGGGAGAGAAGG + Intronic
955751147 3:62186435-62186457 GGGTAGGTGGTGAGGACAGAGGG + Intronic
957840804 3:85666735-85666757 GTGAAGATCTTCAGGGGAGAAGG + Intronic
960591364 3:119368944-119368966 GGGTGGGTAGAGAGGGGAGAGGG + Intronic
961063045 3:123848978-123849000 TGGTAGGAATTGAGGGCAGATGG + Intronic
961821412 3:129577457-129577479 GGGTGGGGCTTGAGGGCTGAGGG + Intronic
962015774 3:131438873-131438895 GTTTAGGACTTGAGGAGAGAAGG + Intergenic
963345225 3:144088615-144088637 GGTGAGGTCTTGAGAGGAGGAGG - Intergenic
963922649 3:150920778-150920800 GGGTAAGGCAAGAGGGGAGAAGG + Intronic
965901313 3:173644872-173644894 GGGCAGGTGTTGAGGGGGCATGG + Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967544620 3:190710202-190710224 GTGAAGGTCTAGAGGGGAGTTGG + Intergenic
967748699 3:193088724-193088746 GGGTAGGGGGTGAGGGGAGTGGG - Intergenic
968468323 4:764368-764390 AGGTAGGGCCTGTGGGGAGAGGG + Intronic
968656461 4:1780371-1780393 GGGTAGGATTTGAGAGTAGATGG + Intergenic
969112898 4:4854709-4854731 GGGCAGAGCTGGAGGGGAGAAGG + Intergenic
969121558 4:4915042-4915064 GGGTAGGGTTTGAGAGGACAGGG - Intergenic
969244479 4:5923583-5923605 GGGTAGGGATGGAGGGGAGAAGG + Intronic
972583112 4:40412612-40412634 GGTTGGGTGTTGTGGGGAGAGGG + Intergenic
973533987 4:51862275-51862297 GAGTAGGTCTGCAGGGCAGAGGG - Intronic
973851469 4:54965465-54965487 GGTTAGGTCATGAGGGTGGAGGG + Intergenic
975393856 4:73852911-73852933 GGGCAGTTCTTGAGTTGAGAAGG + Intergenic
977180545 4:93868062-93868084 TGGCAGGAATTGAGGGGAGATGG - Intergenic
978596611 4:110384268-110384290 GGGTCCTACTTGAGGGGAGAGGG + Intronic
980515159 4:133847676-133847698 ATGAAGGTCTTCAGGGGAGAAGG + Intergenic
982761437 4:159289095-159289117 AGGAGGGGCTTGAGGGGAGAAGG - Intronic
983936102 4:173503542-173503564 TGGTGAGTGTTGAGGGGAGATGG + Intergenic
986944312 5:12996782-12996804 GTGTATTTCTTGAGGAGAGAAGG - Intergenic
988695975 5:33623249-33623271 CAGTAGGGCCTGAGGGGAGAGGG - Intronic
988987492 5:36635138-36635160 GGGTAGGTGTTGAGGGGGGCAGG - Intronic
989187617 5:38640408-38640430 GGGTGGGGCTTGAGAGAAGAAGG - Intergenic
992752027 5:79870637-79870659 GTCTAGGTCTTCAGGGGAAATGG + Intergenic
998039587 5:138943950-138943972 TGGTAGGACAGGAGGGGAGAGGG - Intergenic
998252293 5:140561372-140561394 TGGCAGGTCTTCAGGAGAGATGG + Exonic
999356928 5:150943972-150943994 GAGAAGGTCGTGATGGGAGAAGG + Intergenic
999800141 5:155026093-155026115 GGGTAAGGGTTGAGGTGAGAGGG - Intergenic
1000154718 5:158539249-158539271 GGGAAGGCCTTGAGTAGAGATGG - Intergenic
1000331644 5:160210484-160210506 GGGTAGATCATGTGGGGACAAGG + Intronic
1001659821 5:173383067-173383089 GGCTAGGACTTGAGCGGTGAAGG + Intergenic
1001761244 5:174210108-174210130 AGGTGGATCTTGAAGGGAGAAGG - Intronic
1001796053 5:174503406-174503428 GCCTAGGGCTTGAGGGGACAGGG + Intergenic
1004111317 6:12721623-12721645 GGGAAGGTGTTGGAGGGAGAGGG - Intronic
1004292169 6:14377548-14377570 GGTTAGGGCTTCAGGGGAAAGGG - Intergenic
1004690951 6:17991664-17991686 GAATAGGTCTTAAGGTGAGAGGG + Intergenic
1006709113 6:36049962-36049984 GGGCAACTCTTGAGGGAAGAGGG + Intronic
1007547966 6:42708573-42708595 GGGAAGGTCTTGGGGGAAGAAGG - Intronic
1011135618 6:84096837-84096859 GGGTAATTCTTGAGAGAAGAAGG + Intergenic
1017796564 6:157850093-157850115 GGGCAGGTGTGGAGGGGCGAGGG + Intronic
1019408037 7:894168-894190 GGGGAGCTCTGGAGTGGAGACGG - Intronic
1019532513 7:1510855-1510877 GGGTCGGGCCCGAGGGGAGACGG + Intergenic
1019568587 7:1697212-1697234 GGCCAGGTCTAGAGGGGAAAGGG + Intronic
1019600823 7:1882820-1882842 GGGTCGGTGCTGAGGTGAGAAGG + Intronic
1019892037 7:3954603-3954625 GGGAAGGTGTAGAGGGGAGGTGG - Intronic
1021052837 7:16010663-16010685 GAGTAGGTCGTAAGGGCAGAAGG + Intergenic
1021655280 7:22868366-22868388 GGGGATGGGTTGAGGGGAGATGG - Intergenic
1022387692 7:29916793-29916815 TGATAGGTCTCAAGGGGAGATGG - Exonic
1022449333 7:30499995-30500017 GAGTAGGCCTTGAGAAGAGAGGG - Intronic
1022813649 7:33893469-33893491 GGGTAGGTATGGAGGCTAGAAGG - Intergenic
1023066306 7:36381140-36381162 GGTTAGGACTGGAAGGGAGAAGG + Intronic
1023319399 7:38976451-38976473 GGGTAGGACTTCAGCGCAGACGG + Intergenic
1026929905 7:74218037-74218059 GGGCAGGGCCTGAGGGGAGAGGG - Intronic
1027714983 7:81658928-81658950 GGGTAGCTCTTCTGTGGAGAGGG - Intergenic
1029424679 7:100488382-100488404 GGGGACGTCTTTAGGGGAGGAGG + Exonic
1029927306 7:104330413-104330435 GGGAAGGTTTTCTGGGGAGAGGG + Intronic
1033315126 7:140290927-140290949 GGGTTCGTGTTGAGGGGAAACGG - Intergenic
1033711600 7:143951675-143951697 GTGGAGTTTTTGAGGGGAGAGGG + Intergenic
1034788337 7:153945464-153945486 GGGTATGTTTTGAGAGGAAATGG + Intronic
1036099444 8:5761847-5761869 AGCAAGGTCTTGAGGGGAAAAGG + Intergenic
1037802807 8:22044393-22044415 GGCTAGGTCCCGCGGGGAGAGGG + Intronic
1037888047 8:22605212-22605234 GGGTCGGGCTTCCGGGGAGAGGG + Intronic
1037900957 8:22689497-22689519 GAGAAGGTTTAGAGGGGAGAAGG + Exonic
1038334433 8:26634935-26634957 GGGGAGGTTTGGAGGGGAGGGGG + Intronic
1039064686 8:33598469-33598491 GTGTGTGTCTTGAGGGGAGGGGG + Intronic
1042175319 8:66032643-66032665 GGGCAGATTTTGAGGAGAGATGG - Intronic
1043021061 8:75000314-75000336 GGGCAGCTCTTGAAGGAAGATGG + Intronic
1043415890 8:80048582-80048604 GGGTAGTTCTTGAGGGAACGTGG + Intronic
1045426018 8:102066596-102066618 GGGCAGGTCTTGAAAGGAAATGG - Intronic
1047613748 8:126545760-126545782 GGGTAGTAGTTGTGGGGAGAGGG + Intergenic
1048992151 8:139766765-139766787 GGGGAGCTCTTGTGGGCAGAGGG - Intronic
1049271926 8:141700575-141700597 GGGGTGGTCTTGGGGGAAGATGG + Intergenic
1049343488 8:142126366-142126388 GGGGATCTCCTGAGGGGAGAGGG + Intergenic
1049499862 8:142956017-142956039 GGGCAGGACTACAGGGGAGAGGG + Intergenic
1049513784 8:143043086-143043108 GGGTAGGCCTGCGGGGGAGAGGG + Exonic
1049702328 8:144020898-144020920 GAGAAGGTCCTGAGGGAAGAGGG - Intronic
1049702333 8:144020914-144020936 GAGGGGGTCCTGAGGGGAGAAGG - Intronic
1049702843 8:144022946-144022968 GGGTAGGTCATGAGGGGAAAGGG - Intronic
1049702912 8:144023174-144023196 GGGTAGGTCCTGAGGAAAGAGGG - Intronic
1049702923 8:144023210-144023232 GGGTAGGTCCTGAGGGGAGAGGG - Intronic
1049703012 8:144023559-144023581 GGAAAGGTCGTGAGGGGAAAGGG - Intronic
1049703082 8:144023810-144023832 GGGGAGGTCCTGAGGGGACAGGG - Intronic
1049703349 8:144024764-144024786 GGGTAGGTCTTGAGGGGAGAGGG - Intronic
1049703433 8:144025055-144025077 AGGTAGGTCCTGAGGGGAGATGG - Intronic
1049832588 8:144711569-144711591 GCATAGGTCTTGAGGGAAGCTGG + Intergenic
1049890326 9:63236-63258 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1049970973 9:821639-821661 GGTTAGGGGTTGAGGGGAAATGG - Intergenic
1050009820 9:1173809-1173831 GGGTAGCTCAGGTGGGGAGAAGG - Intergenic
1051653700 9:19356439-19356461 GGGTGGGACTTGAGGAGGGAAGG - Intronic
1052416458 9:28184170-28184192 GGGGAGGTCTTAATGGGAAAAGG + Intronic
1053021381 9:34696854-34696876 GGGTGGGTCCTGAGGGAAAAAGG - Intergenic
1053105323 9:35403637-35403659 GGGTAAGACTTGAGGGGTGGGGG + Intronic
1053429971 9:38035619-38035641 GGGTAGGTCTTGGGGACAGAAGG + Intronic
1053731791 9:41064421-41064443 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1056297339 9:85206076-85206098 GGGTAGGTCTAGGGGAGAGATGG - Intergenic
1057779842 9:98040579-98040601 GCAGAGGTCTTGAGTGGAGAGGG - Intergenic
1057911462 9:99023186-99023208 GGGTAGCTGTAGAGGGGAGTGGG + Intronic
1059423014 9:114204638-114204660 GGGCAGGTCTTGAAAGGGGAGGG + Intronic
1059445079 9:114332992-114333014 TGGGAGGTCTTCCGGGGAGAGGG - Intronic
1060387418 9:123244535-123244557 GGGAAAGTCATGAGGGAAGAAGG + Intronic
1060404804 9:123367933-123367955 GGGATGGTCTTCAGGGAAGACGG + Intronic
1060730692 9:126034973-126034995 GAGTGGCTCTTGAGGGGTGATGG + Intergenic
1061682552 9:132250150-132250172 GGGTAGGGGATGAGGGCAGAGGG + Intergenic
1061725875 9:132581775-132581797 GGGTACGGCTGGAGGGGAGGGGG - Intergenic
1062417495 9:136459736-136459758 GGGTAGGTCAGGGGTGGAGATGG - Exonic
1062630843 9:137462433-137462455 AGGTAGGTTCTGGGGGGAGAGGG + Intronic
1185505088 X:627411-627433 GGAAAGGTCTTTAGGTGAGAGGG + Intronic
1185664908 X:1757915-1757937 GGGGTGGTCTGCAGGGGAGAGGG - Intergenic
1185795509 X:2961127-2961149 GGGTAGGTGCTGCCGGGAGAGGG + Intronic
1185872680 X:3677108-3677130 GGGTAGGGCTTGAGGGGGAAGGG + Intronic
1186819156 X:13269025-13269047 GTGTTGGCCTTGAGGGGAGGTGG + Intergenic
1187502934 X:19854719-19854741 GGGAAGATCGTGTGGGGAGATGG - Intronic
1188747376 X:33862751-33862773 GGGTGGGTGTGGAGGGGAGGTGG - Intergenic
1189048611 X:37620064-37620086 GGCTAAGTCTTGAAGGAAGATGG - Intronic
1189701987 X:43721256-43721278 GTGAAGGCCTTGAGGTGAGAAGG + Intronic
1190010459 X:46780302-46780324 GGGTATGACTTCAAGGGAGATGG - Intergenic
1190292305 X:49001073-49001095 GGGGAGATCTTGAGGGGAGTGGG - Intronic
1190375155 X:49782132-49782154 CAGTAAGGCTTGAGGGGAGATGG - Intergenic
1191850076 X:65579804-65579826 GGGTAGGACTGGAGGTGGGAAGG - Intergenic
1192644271 X:72888168-72888190 GGGGAGGGCTGGAGGGGAGGGGG - Intronic
1192902882 X:75519032-75519054 GGCTAGGACTTGGGGGAAGAGGG + Intronic
1193729741 X:85088672-85088694 AGGTAAGTCTTGAAGGTAGATGG - Intronic
1194419788 X:93659667-93659689 CAGTAGGTTTTGATGGGAGAGGG + Intergenic
1195004477 X:100672344-100672366 GTGGATGACTTGAGGGGAGAAGG + Intergenic
1195879413 X:109576748-109576770 GGGCAGGTTTGAAGGGGAGATGG - Intergenic
1198939790 X:141941020-141941042 TGGTAGCTCTTCAGGGAAGAGGG + Intergenic
1199525130 X:148783701-148783723 GCCTTGGTCTTGAGGGGAGGTGG + Intronic
1199953919 X:152727432-152727454 GGGTAGGGCTTAAGGGGAAGAGG - Intergenic