ID: 1049704707

View in Genome Browser
Species Human (GRCh38)
Location 8:144035895-144035917
Sequence CCAATTCCTTAGGAGAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049704707 Original CRISPR CCAATTCCTTAGGAGAGCCC AGG (reversed) Intronic
901873171 1:12150496-12150518 CCTCTTCCTCAGGAGAGGCCTGG - Intergenic
902757047 1:18555859-18555881 CAAATTCCTTAGCATGGCCCTGG + Intergenic
908648702 1:66308466-66308488 CCAATTCCATAGAAGGCCCCTGG + Intronic
915493290 1:156263668-156263690 CAAATTCCTTGGAAGGGCCCAGG - Intronic
915519566 1:156433887-156433909 CCAATTTCTTGGCAGAGCCTGGG - Intergenic
920248742 1:204608034-204608056 CCAACTCCTGAGGACAGCACTGG + Intergenic
921159995 1:212465813-212465835 CAAATGCCCCAGGAGAGCCCTGG - Intergenic
923177229 1:231478557-231478579 CAAATTCCTGAGGGCAGCCCGGG + Intergenic
923329517 1:232909620-232909642 CCAATGCCTATGGAAAGCCCAGG - Intergenic
924590221 1:245396797-245396819 CTAATTCCTTAGGAGAGACAAGG - Intronic
1062882114 10:987780-987802 GCAGTGCCTTAGGAGAGCCCAGG - Intergenic
1063522347 10:6752382-6752404 CCCATTCCTTAGGAGAACTCTGG + Intergenic
1069553271 10:69379700-69379722 CAAATGCCTGAGAAGAGCCCAGG - Intronic
1073299074 10:102459793-102459815 CCAGTTCCTGAGGAGCCCCCAGG - Intergenic
1074055860 10:109922806-109922828 CCTATGCCCAAGGAGAGCCCAGG + Intronic
1074266430 10:111908743-111908765 CCAATTACTTAGGTGACCACAGG + Intergenic
1076295273 10:129378902-129378924 CCAACTCCCTAGAACAGCCCAGG + Intergenic
1076637310 10:131891010-131891032 CCCCTTCCTGAGGAGGGCCCGGG + Intergenic
1078490423 11:11762959-11762981 CCAATTACCCAGTAGAGCCCAGG - Intergenic
1080099020 11:28438147-28438169 GTAATTCCTTAGAACAGCCCAGG + Intergenic
1080397721 11:31905237-31905259 CCTGTTCCTGAGTAGAGCCCAGG - Intronic
1081342406 11:41944082-41944104 ACAAATCCTTAGGAAAGCCATGG - Intergenic
1081698122 11:45132854-45132876 CCAATTCCTAAAGCCAGCCCAGG + Intronic
1083203688 11:61134731-61134753 CCACTGACTTAGGAGAGACCTGG + Intronic
1083713447 11:64562453-64562475 CCTTTTCCTTAGGAGACCCAGGG + Intronic
1085105447 11:73838465-73838487 GCAATACCTTTGGAGAGTCCTGG + Intronic
1086614253 11:88795860-88795882 CCTATTGTGTAGGAGAGCCCTGG + Intronic
1088902409 11:114128204-114128226 TCTCTTCCTTAGGAGAGCCTGGG + Intronic
1089295984 11:117468597-117468619 CCACTTTCTGAGGAGAGCCCTGG + Intronic
1092523281 12:9294365-9294387 CAGACTCCTTAGGAGAGGCCTGG + Intergenic
1092544013 12:9437534-9437556 CAGACTCCTTAGGAGAGGCCTGG - Intergenic
1094458795 12:30670587-30670609 ACACTACCTTAGTAGAGCCCTGG + Intronic
1094508936 12:31084515-31084537 CAGACTCCTTAGGAGAGGCCTGG + Intronic
1098859499 12:75691608-75691630 CCATTTCCTTAGGATAGGCCTGG - Intergenic
1099295151 12:80821141-80821163 CCAAAGCCTTAGCAGAGCCAGGG + Intronic
1102563865 12:113781762-113781784 CCATTTCCTTAAGCCAGCCCTGG - Intergenic
1102606968 12:114075311-114075333 TCAATTCCACAGCAGAGCCCTGG + Intergenic
1103538903 12:121652631-121652653 CCAAGCCCTTTGGAGACCCCAGG + Intronic
1104188599 12:126456341-126456363 CCAGTACCTTCTGAGAGCCCAGG + Intergenic
1106242444 13:27922070-27922092 CCATTTCCTGAGGAAGGCCCAGG - Intronic
1107823286 13:44305385-44305407 CCACTTGCTGAGGAAAGCCCAGG - Intergenic
1108638485 13:52359938-52359960 TCAATTCTTTTGGAGAGCTCTGG - Intergenic
1110140867 13:72127482-72127504 CCAATTAATTCTGAGAGCCCAGG - Intergenic
1117292276 14:54345189-54345211 CCCACTACTTAGAAGAGCCCTGG + Intergenic
1117988985 14:61415448-61415470 CCATTTCCTTAGGAGAGCTGAGG + Intronic
1119149308 14:72343657-72343679 CTAAAGCCTTAGGTGAGCCCGGG + Intronic
1119196919 14:72723908-72723930 CCAAGGGCTTAGGAGAGCCTCGG - Intronic
1120283779 14:82471657-82471679 CCAATTCCTTAAGATGGCTCTGG + Intergenic
1121643137 14:95499745-95499767 GCAGTCCCTTAGCAGAGCCCAGG + Intergenic
1124995269 15:34717435-34717457 CCAGTTCCATAAGAGAGCTCTGG + Intergenic
1126672542 15:51129454-51129476 CCACTTCCTCAGGTGTGCCCTGG - Intergenic
1130429461 15:83831976-83831998 TCAACTCCTTTGAAGAGCCCAGG - Intronic
1131159166 15:90093153-90093175 CCAGTTCCTAAGGAGGGCCTGGG + Intronic
1141565667 16:84900005-84900027 CCAAGGCCTGAGGAGGGCCCTGG + Intronic
1142749254 17:1977691-1977713 CCAACTTCTGAGGAGAGACCCGG + Intronic
1144148642 17:12422000-12422022 CCAATTTCTACGGAGAGCCGTGG + Intergenic
1145032558 17:19516051-19516073 CCAATGCCTTAGGAAGGCCAAGG + Intronic
1145888044 17:28396382-28396404 CCATTTCCTAAGAAGAGCCCAGG - Exonic
1146065566 17:29632195-29632217 CCAGATCCTCAGGAGGGCCCAGG - Exonic
1148724505 17:49779077-49779099 GCAATTCCTTAGGAGTGTGCAGG - Intronic
1149131012 17:53302638-53302660 CCCCTTCCGTAGGAGTGCCCTGG - Intergenic
1153169592 18:2300843-2300865 CCCATACCTCAGGAGTGCCCTGG - Intergenic
1154055777 18:11012792-11012814 CCAATACTTTGGGAGAGCCAAGG + Intronic
1154165805 18:12013491-12013513 CAAATGCCTTAGGAAAGCCTTGG - Intronic
1156322670 18:36041944-36041966 CCTATTCCTTGGGAGAGTTCAGG + Intronic
1157860601 18:51137348-51137370 CAGCTTACTTAGGAGAGCCCGGG - Intergenic
1160347433 18:78145291-78145313 CCCCTTCCTTTGGACAGCCCTGG - Intergenic
1162420693 19:10564676-10564698 ACAAGTCCTTAGCAGAGCCTAGG - Intronic
1163848308 19:19649866-19649888 CCAGTGCCTTTGGGGAGCCCCGG + Exonic
1164037457 19:21467115-21467137 CCATTTCCTTGGGAGAGTTCAGG + Intronic
1166253363 19:41586072-41586094 CCATCACCTGAGGAGAGCCCTGG + Intronic
925748039 2:7061056-7061078 CCACTACCATAGTAGAGCCCAGG - Intronic
927276310 2:21265266-21265288 ACAATCCCTTACGAGAGGCCTGG + Intergenic
927889903 2:26741753-26741775 CCCCTTCCTAAGGAGATCCCCGG - Intergenic
929288494 2:40163352-40163374 ACAATTCCCCAGGAGAACCCAGG + Intronic
933794520 2:85908800-85908822 CCTGTTGCTTAGGAGAGGCCTGG + Intergenic
937313593 2:120916991-120917013 CCTATTCCTGTGGAGATCCCAGG - Intronic
943493526 2:188586576-188586598 CCATTTGATTAGGATAGCCCTGG + Intronic
943709059 2:191069581-191069603 CTACTTCCTTAGGTGAGCCTAGG - Intronic
948852029 2:240713200-240713222 CCCAGTCCTTAGGAGCCCCCAGG - Intergenic
1169355014 20:4898570-4898592 CCACTTCCTGAGCAGTGCCCTGG + Intronic
1173755154 20:45509156-45509178 AAAATTCCTTGGGAGAGCCTGGG - Intergenic
1173802417 20:45902641-45902663 CCATTTCCTTTGGAGCCCCCAGG + Intronic
1174817069 20:53696325-53696347 CCAATTACTCAGGGGAGCCCTGG + Intergenic
1175539589 20:59740052-59740074 ACAATGCCTTAGGATAGTCCTGG + Intronic
1176230884 20:64032340-64032362 CCCATTCCTAAAGTGAGCCCAGG - Intronic
1177656160 21:24020130-24020152 CCAAGTCCTTAGGGGGGCCCTGG - Intergenic
1184613059 22:45618342-45618364 GCCACTCCCTAGGAGAGCCCTGG + Intergenic
1184918729 22:47590790-47590812 GCCACTCCCTAGGAGAGCCCTGG - Intergenic
950107400 3:10396928-10396950 CCCATTCCTTGGGTGAGGCCTGG - Intronic
950217353 3:11168956-11168978 CCAGTTCCTTTGCAGAGCCTGGG + Intronic
952851932 3:37736663-37736685 TCACTTCCTAAGGAGAGCCTCGG + Intronic
956498825 3:69859506-69859528 CCATCTCATTAGGAGATCCCAGG - Intronic
961845255 3:129757459-129757481 GCCACTCTTTAGGAGAGCCCTGG - Intronic
962986154 3:140537911-140537933 CCAGTGCCTTAAGGGAGCCCTGG + Intronic
968470710 4:781217-781239 CCCATACCTTGGGGGAGCCCCGG - Intergenic
969298683 4:6284630-6284652 CCACTTCCCCAGGAGACCCCAGG - Intronic
982786772 4:159545413-159545435 TCAATTCCCTAGGGGAGCTCTGG + Intergenic
985958160 5:3279929-3279951 CCAATTACCTAGGTGAGCCTAGG - Intergenic
988551426 5:32204218-32204240 ACCACTCCCTAGGAGAGCCCTGG - Intergenic
988714291 5:33809863-33809885 CCAATTCTTTAGTAGAGACTGGG + Intronic
995023181 5:107389373-107389395 CCAATTCATTAGGAAAACCACGG + Intronic
995935422 5:117505652-117505674 TGAATTCCTTAAGAGAGCCAAGG + Intergenic
997402786 5:133615367-133615389 CCCTGTGCTTAGGAGAGCCCTGG + Intergenic
997422441 5:133780001-133780023 CCAATACCTCTGGGGAGCCCTGG + Intergenic
998168251 5:139856623-139856645 TCAATGCCTTGGCAGAGCCCTGG + Intronic
1001269729 5:170302270-170302292 ACAATTCCTTAGAAGAGACTTGG + Intergenic
1002787471 6:414517-414539 CCAATGCCAGAGGAGAGGCCTGG + Intergenic
1004285921 6:14320700-14320722 AAAATACCTCAGGAGAGCCCAGG + Intergenic
1005528886 6:26681956-26681978 CCACTACCTTAGGAAACCCCTGG - Intergenic
1005541910 6:26819690-26819712 CCACTACCTTAGGAAACCCCTGG + Intergenic
1008033271 6:46720326-46720348 CCAATAAGTTAGGAGTGCCCTGG + Intronic
1009012716 6:57861747-57861769 CCACTACCTTAGGAAACCCCTGG + Intergenic
1013744027 6:113323193-113323215 CCAATTTCTTAGGAGACCATGGG + Intergenic
1015428925 6:133107047-133107069 CAATTTCCTTAGTAGAGCCTGGG + Intergenic
1015938347 6:138424695-138424717 CCACTTGCTTTGGAGAGGCCAGG + Exonic
1016816714 6:148309552-148309574 ATCATTCCTTAGGACAGCCCTGG + Intronic
1017876886 6:158532162-158532184 CTAATTCCTTAGGGAACCCCTGG - Intergenic
1018988135 6:168653413-168653435 CCACTTGCCCAGGAGAGCCCAGG + Intronic
1025854450 7:65265219-65265241 CCATTTCCTTGGGAGAGCTGAGG + Intergenic
1035966460 8:4197555-4197577 TCTATTTCTTTGGAGAGCCCTGG + Intronic
1037561269 8:20076667-20076689 CCAATTCCTTTTGAGACTCCAGG + Intergenic
1038361293 8:26881518-26881540 CCATTTTCTCAGGACAGCCCAGG + Intergenic
1043989195 8:86731921-86731943 CCATTTACTTAACAGAGCCCAGG + Intronic
1045323038 8:101096342-101096364 CCAATGTCTTAGCAGAGGCCTGG + Intergenic
1049521391 8:143093106-143093128 CCAATTCCATGGGAGGACCCTGG + Intergenic
1049704707 8:144035895-144035917 CCAATTCCTTAGGAGAGCCCAGG - Intronic
1050360248 9:4823401-4823423 CCAGTCCTTTAGGAAAGCCCAGG + Intronic
1058651075 9:107176267-107176289 CTAAGTCCATAGGAGCGCCCTGG - Intergenic
1060031775 9:120220566-120220588 CAAATCTCTCAGGAGAGCCCTGG - Intergenic
1061300869 9:129704278-129704300 GCATGTCCTTGGGAGAGCCCTGG + Intronic
1061372872 9:130207684-130207706 CCAAGTCCCCAGGAGAGCACAGG + Intronic
1185491863 X:524099-524121 CCAATTCCTTAGAAGGGCGGGGG + Intergenic
1186907337 X:14125843-14125865 CCGATTGCTTTGGAGAGCACAGG + Intergenic
1188559913 X:31455918-31455940 CCAATTTGGTAGTAGAGCCCAGG - Intronic
1197283146 X:124561787-124561809 CCATTTCCAAAGCAGAGCCCTGG + Exonic
1200953548 Y:8923458-8923480 CAACTTTCTTAGGAGAGACCAGG + Intergenic
1202107638 Y:21386852-21386874 CAAACCCCTTAGGAGAGCCCTGG + Intergenic
1202231651 Y:22664810-22664832 CAACTTTCTTAGGAGAGACCAGG + Intergenic
1202311507 Y:23531355-23531377 CAACTTTCTTAGGAGAGACCAGG - Intergenic
1202559295 Y:26139239-26139261 CAACTTTCTTAGGAGAGACCAGG + Intergenic