ID: 1049706761

View in Genome Browser
Species Human (GRCh38)
Location 8:144046635-144046657
Sequence GAACCCCAGTGACCACAAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 147}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049706758_1049706761 -9 Left 1049706758 8:144046621-144046643 CCACAGGCTTCCCTGAACCCCAG 0: 1
1: 0
2: 3
3: 55
4: 501
Right 1049706761 8:144046635-144046657 GAACCCCAGTGACCACAAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 147
1049706755_1049706761 0 Left 1049706755 8:144046612-144046634 CCGCTGTCCCCACAGGCTTCCCT 0: 1
1: 0
2: 2
3: 64
4: 573
Right 1049706761 8:144046635-144046657 GAACCCCAGTGACCACAAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 147
1049706753_1049706761 8 Left 1049706753 8:144046604-144046626 CCTGATGGCCGCTGTCCCCACAG 0: 1
1: 0
2: 2
3: 13
4: 192
Right 1049706761 8:144046635-144046657 GAACCCCAGTGACCACAAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 147
1049706757_1049706761 -8 Left 1049706757 8:144046620-144046642 CCCACAGGCTTCCCTGAACCCCA 0: 1
1: 0
2: 5
3: 29
4: 294
Right 1049706761 8:144046635-144046657 GAACCCCAGTGACCACAAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 147
1049706756_1049706761 -7 Left 1049706756 8:144046619-144046641 CCCCACAGGCTTCCCTGAACCCC 0: 1
1: 0
2: 4
3: 41
4: 445
Right 1049706761 8:144046635-144046657 GAACCCCAGTGACCACAAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 147
1049706752_1049706761 9 Left 1049706752 8:144046603-144046625 CCCTGATGGCCGCTGTCCCCACA 0: 1
1: 0
2: 2
3: 11
4: 178
Right 1049706761 8:144046635-144046657 GAACCCCAGTGACCACAAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049706761 Original CRISPR GAACCCCAGTGACCACAAGC TGG Exonic
903853186 1:26320531-26320553 GATGTCCAGTAACCACAAGCAGG - Intergenic
907207335 1:52784873-52784895 TCATCCCAGTAACCACAAGCTGG - Exonic
908670133 1:66537109-66537131 ATTCCCCAGGGACCACAAGCAGG + Intronic
910125787 1:83840785-83840807 CAACTCCAGAGACCAGAAGCTGG + Intergenic
911546563 1:99224692-99224714 GAACCAGAGTGAACAAAAGCTGG + Intergenic
918619021 1:186581280-186581302 GAACCCCAGTGGCCAGTGGCAGG - Intergenic
920376703 1:205512616-205512638 CAATCCAAGTGACCAGAAGCTGG + Intronic
922270646 1:224029822-224029844 GAAGCCCAGCCACCACATGCAGG - Intergenic
1063610022 10:7554073-7554095 GAAGCCCAGAGACCACAGGTCGG - Intergenic
1064265158 10:13820104-13820126 GAACCCCAGTCACTAGAAGCTGG + Intronic
1067792581 10:49299262-49299284 GAAGATCAGTGACCAGAAGCCGG - Intronic
1069609950 10:69766323-69766345 GACCACCAGTGGCCACAACCAGG - Intergenic
1070225603 10:74501605-74501627 CAACCCAAATGTCCACAAGCAGG + Intronic
1072120162 10:92399082-92399104 GAAGCTCAGAGAACACAAGCAGG + Intergenic
1073653894 10:105391661-105391683 GAACCCCAGTGCATAAAAGCAGG - Intergenic
1074506812 10:114078113-114078135 CAGCCCCAGTCACCACAAGGTGG + Intergenic
1075780673 10:125015396-125015418 CAACCCCACAGGCCACAAGCAGG + Intronic
1076439654 10:130472391-130472413 TAACACCAGGAACCACAAGCTGG - Intergenic
1077233959 11:1470982-1471004 CAGCCCAAGTGCCCACAAGCTGG + Intronic
1077252337 11:1566182-1566204 GAACCCCAGGGCCCACAGGAAGG - Intronic
1081413380 11:42785705-42785727 GAATCCGAGTGACCTCCAGCAGG - Intergenic
1081814895 11:45933437-45933459 CAACCCCAGTGCCCAGAAGAGGG - Intronic
1085567982 11:77531963-77531985 AAACCTCAGTGACCAAAAACAGG - Intronic
1090226379 11:125074553-125074575 GAACACCTGGGGCCACAAGCAGG + Intronic
1090744663 11:129696238-129696260 CAACCCCTCTGACCACAAGGGGG - Intergenic
1091876178 12:3935022-3935044 GAAGCTCAGAGAACACAAGCAGG + Intergenic
1093109892 12:15138166-15138188 GAAGCACAGAGAACACAAGCAGG - Intronic
1093301035 12:17455383-17455405 GAACTCCATTGAACTCAAGCAGG - Intergenic
1094828889 12:34290871-34290893 GAACCCCACGGACCCCAGGCAGG + Intergenic
1110426767 13:75375849-75375871 ACACCCCAGTGGCCAGAAGCAGG + Intronic
1113464275 13:110503202-110503224 GAACCCCAGGGACCAAAGGATGG + Exonic
1113786692 13:113005662-113005684 TAACCACAGTCACCACAAACAGG - Intronic
1117478030 14:56117707-56117729 GAGCTCTATTGACCACAAGCCGG + Intergenic
1119091455 14:71785350-71785372 GAACACCAGTGTCCAAGAGCAGG - Intergenic
1126705301 15:51400254-51400276 GAACACCATTCCCCACAAGCAGG + Exonic
1127416301 15:58760596-58760618 GAACACCAGAAACCACAAGGAGG - Intergenic
1130792300 15:87168407-87168429 GAGCACCAGTGTCCCCAAGCTGG + Intergenic
1131375621 15:91920681-91920703 GAACCGCAGTAACCACTAGGAGG + Intronic
1132326601 15:100975186-100975208 GCACCCCAGTGGCCTCAAGCAGG + Intronic
1135629420 16:24024048-24024070 GAACCCCAGGGACCAGAACCAGG + Intronic
1137601274 16:49757931-49757953 GAACCAGGGTGACCACAGGCAGG - Intronic
1139605616 16:68016065-68016087 AAGCCCCAGTGACCACAGGAGGG + Intronic
1141086231 16:81097212-81097234 GAGCCCCAGGGACCCCAAACAGG + Intergenic
1141440367 16:84025990-84026012 GAGCCCCAGTGCCCACAATGGGG + Intronic
1141496542 16:84414348-84414370 CAACCCCAGTGGGCACAAGGTGG - Intronic
1141935066 16:87232917-87232939 GAATCCCAGTGAGCACAAGAAGG + Intronic
1144728270 17:17512525-17512547 GAACCCCAGTGCAAAGAAGCTGG + Exonic
1144931355 17:18861656-18861678 GAACGTCAGAGACCACATGCAGG + Intronic
1152572621 17:81127300-81127322 GAACCACAGGGCACACAAGCAGG + Intronic
1152926926 17:83091591-83091613 GACCCCCAGTCACCAGCAGCTGG + Intronic
1154018623 18:10643276-10643298 CACCCCATGTGACCACAAGCAGG - Intergenic
1154140120 18:11816208-11816230 TAACCCAAGTGCCCACCAGCTGG + Intronic
1154185605 18:12180146-12180168 CACCCCATGTGACCACAAGCAGG + Intergenic
1157019489 18:43762279-43762301 GAAGCCCAGTGTACTCAAGCTGG + Intergenic
1157187417 18:45552438-45552460 CAACCCCCGTGTCCTCAAGCTGG + Intronic
1158561052 18:58513949-58513971 GAACCACAGTGCCCTCCAGCAGG - Intronic
1160269092 18:77367597-77367619 CAGCCCCAGTGTCCACCAGCCGG - Intergenic
1160985087 19:1834909-1834931 GGAGCCCAGTGACCACAGGGAGG - Intronic
1161029789 19:2052235-2052257 GAGCCCCACTGACCTGAAGCTGG + Intergenic
1161878581 19:6931095-6931117 GAACAGCAGTTACCAGAAGCTGG - Intronic
1162326573 19:10003136-10003158 TGTCCCCAGTGACCCCAAGCAGG + Intronic
1162917565 19:13882554-13882576 CAGCCCCAGTGACTTCAAGCGGG - Exonic
1163371443 19:16903466-16903488 GAACCCCAGGGACCCCCAGAGGG - Intronic
1164722972 19:30445506-30445528 GCACTCCCGTGTCCACAAGCGGG + Exonic
1168230049 19:55025249-55025271 GAACCTCTGTGACCCCCAGCCGG - Exonic
927083899 2:19655602-19655624 GAACCTCAGTGACCAGAACTAGG - Intergenic
934650545 2:96089158-96089180 GGACCCCAGTGAGCTCCAGCGGG + Intergenic
934961004 2:98673031-98673053 CAAACCCAGCGACTACAAGCAGG - Intronic
935528068 2:104197212-104197234 GATCCCCTGTGACCAGCAGCAGG - Intergenic
936517629 2:113192453-113192475 GAAGGCCAGAGACCACCAGCTGG + Exonic
946133662 2:217628046-217628068 GAATCCCAGTGCTCAGAAGCTGG + Intronic
1168859226 20:1033975-1033997 GGAACCCTGTGACCACAACCAGG + Intergenic
1171357935 20:24565021-24565043 GAACACCAGTGAACAATAGCAGG - Intronic
1173400816 20:42724371-42724393 GAGCCCCACTGACCACCAGAGGG - Intronic
1175909003 20:62395735-62395757 GACCCACAGTCACCACAAGGAGG + Intronic
1176974031 21:15298283-15298305 GACCTTCAATGACCACAAGCTGG + Intergenic
1181361990 22:22344590-22344612 GAGCCCCACTGGCCACAGGCTGG + Intergenic
1182344784 22:29654668-29654690 CGACCCCAGTGTTCACAAGCGGG + Exonic
1182943293 22:34298720-34298742 AAACCCCAGTTACCACCAGATGG - Intergenic
1183490530 22:38113288-38113310 GACCCTCAGTGACCACCAGCAGG - Intronic
950549564 3:13658000-13658022 CAACCCCAGCGACCACACGGAGG + Intergenic
951655578 3:25004206-25004228 GAAGCCAAGTGACTACAACCTGG - Intergenic
953627965 3:44586281-44586303 CAACCCTGGTGCCCACAAGCAGG - Intronic
957243381 3:77687732-77687754 GGAGCCTAGTGGCCACAAGCTGG + Intergenic
961093818 3:124138033-124138055 GATCCCCAGTGGCCCCCAGCAGG + Intronic
961443341 3:126965903-126965925 GAAGTCCAGTGACCCCAGGCGGG + Intergenic
962248695 3:133821145-133821167 GAGCCCAAGTGACCACCAGAAGG - Exonic
963665250 3:148176640-148176662 GAACCCCAGAGGCTAGAAGCTGG - Intergenic
966854075 3:184182161-184182183 CAACCCCACTGAACACAAGCGGG + Exonic
967251081 3:187539409-187539431 GACCCCCATTGACCACAAATTGG + Intergenic
968643281 4:1725765-1725787 GCACCACAGTGACCACCACCTGG - Intronic
968711990 4:2126074-2126096 GGACTCCAGTGCCCAAAAGCTGG + Intronic
969595589 4:8147809-8147831 GGTCACCAGTGACCACAAGCTGG - Intronic
977417650 4:96754681-96754703 GAACACAAGTGAGGACAAGCAGG + Intergenic
977681034 4:99798641-99798663 GAACCCCAGTGAGATCAACCCGG + Intergenic
983084008 4:163421728-163421750 CAAGCCCAGTGACAAGAAGCAGG + Intergenic
983781403 4:171674501-171674523 GAACCCCAGGCTCCAGAAGCAGG + Intergenic
984733599 4:183090318-183090340 GAACTCCTTTGGCCACAAGCTGG - Intergenic
985164932 4:187082965-187082987 GAACCCCTGTGATCACAGGCTGG + Intergenic
985548394 5:521185-521207 GAACCCCAGTGCACACAAATAGG + Intronic
988377347 5:30454306-30454328 AGAACCCAGTGAACACAAGCTGG - Intergenic
991341510 5:65615915-65615937 GTTCCCCACTGACCACAAACAGG + Intronic
997834853 5:137184070-137184092 TTAGTCCAGTGACCACAAGCAGG + Intronic
999811481 5:155131509-155131531 GAACCCCAGGCTCCAGAAGCAGG - Intergenic
1001088809 5:168721802-168721824 CTACCCCAGAGATCACAAGCTGG - Intronic
1001837284 5:174843088-174843110 GAAGCCCAGAGGCCACAAGGAGG + Intergenic
1006163409 6:32050634-32050656 GAAGCCCAGTGAACAAAAGATGG - Intronic
1006164028 6:32054024-32054046 GAAGCCCAGTGAACAAAAGATGG - Intronic
1006164659 6:32057222-32057244 GAAGCCCAGTGAACAAAAGATGG - Intronic
1006361974 6:33591656-33591678 GACCCCCAGTGACCCCAGACAGG - Intergenic
1006946946 6:37791053-37791075 CAACCCCATTGTCCCCAAGCTGG - Intergenic
1007727692 6:43926506-43926528 GAGCCCCAAGGACCACAGGCTGG - Intergenic
1008613999 6:53208729-53208751 GAACACCAGTGCTCACCAGCAGG + Intergenic
1012220981 6:96649024-96649046 GAAGCCCAATGACGAGAAGCCGG - Intergenic
1013431024 6:110054901-110054923 GAACCCCAGGGGCCATCAGCTGG + Intergenic
1015117669 6:129667225-129667247 GAACAACAGTGCCCACAAGATGG - Intronic
1016405214 6:143722769-143722791 GAACGACAGTTACCAGAAGCTGG - Intronic
1017786946 6:157764208-157764230 GAACGCCAATGACCATGAGCCGG - Intronic
1018743444 6:166747196-166747218 TCACCCCAGAGACCACAGGCAGG - Intronic
1019567780 7:1693148-1693170 GACCCCTAGTGACCAGATGCTGG + Exonic
1019833905 7:3361389-3361411 GAACCACAGTTACCAGAAGGTGG - Intronic
1020147101 7:5653044-5653066 AAATCCCTGTGCCCACAAGCTGG + Intronic
1025798532 7:64762237-64762259 CAAACCCAGTGACTCCAAGCTGG + Intergenic
1026258202 7:68731331-68731353 GAACTGCAGTGACAACAAACAGG - Intergenic
1026759269 7:73114245-73114267 GGACCCAAGTGTCCACCAGCAGG - Intergenic
1027088139 7:75279228-75279250 GGACCCAAGTGTCCACCAGCAGG + Intergenic
1027801281 7:82753288-82753310 GAGCATCAGTGGCCACAAGCGGG + Intergenic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1029394247 7:100296386-100296408 GGACCCAAGTGTCCACCAGCAGG + Intergenic
1029422361 7:100478030-100478052 GAGCCCCAGGGACCATGAGCGGG - Exonic
1031547900 7:123072141-123072163 GAAACCCTGTGACCTCAAGCAGG + Intergenic
1035540843 8:436567-436589 GAAGCCCAGCCACCACATGCAGG + Intronic
1035812489 8:2504376-2504398 GAAGCCCAGTGAGCACTGGCGGG - Intergenic
1038204044 8:25447756-25447778 CAACCCAAGTGTCCATAAGCAGG + Intronic
1041889995 8:62858425-62858447 GCACCCCAAAGCCCACAAGCTGG + Intronic
1042477598 8:69266614-69266636 GAACAACAGTGACCAGAATCAGG + Intergenic
1043737795 8:83768999-83769021 GAGCCCCAGTGAGCACAGGAAGG - Intergenic
1044643985 8:94418540-94418562 GAACCACCATGACCACAATCAGG + Intronic
1045002939 8:97893892-97893914 CACCACCAGAGACCACAAGCTGG - Intronic
1048058293 8:130890711-130890733 GAGCACCAGAGACCACAGGCTGG + Intronic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1049706761 8:144046635-144046657 GAACCCCAGTGACCACAAGCTGG + Exonic
1057877191 9:98767198-98767220 GAAGCACAGTGCCCAGAAGCAGG + Intronic
1060408063 9:123382397-123382419 GAACCCCAGTGACAAGGAGGAGG - Exonic
1187611822 X:20951638-20951660 GGCCCCCAGTGAGCTCAAGCTGG - Intergenic
1189260711 X:39676960-39676982 GAAGCCCTGGGACCACAAGGTGG - Intergenic
1189344375 X:40229486-40229508 AAAGCTCAGTGACCACAACCTGG - Intergenic
1189804019 X:44717670-44717692 GAGCCCCAGTGTCCAAGAGCAGG + Intergenic
1190380858 X:49838602-49838624 GTGCCCCACTGACCACAAGATGG - Intergenic
1195721864 X:107875837-107875859 CAACCCCAGTGTCCAAAAGGAGG + Intronic
1195941888 X:110173995-110174017 GGACACCAGTGACCAGAATCTGG - Exonic
1200910848 Y:8530131-8530153 CAACCCCAGGGAACACAGGCAGG - Intergenic
1201146870 Y:11069618-11069640 GACACCCAGTGAACACATGCTGG + Intergenic
1202125503 Y:21565821-21565843 CAACCCCAGGGAACACAGGCGGG - Intergenic
1202128200 Y:21587018-21587040 CAACCCCAGGGAACACAGGCAGG - Intergenic
1202151085 Y:21844435-21844457 CAACCCCAGGGAACACAGGCAGG + Intergenic
1202153505 Y:21863571-21863593 CAACCCCAGGGAACACAGGCGGG + Intergenic
1202180698 Y:22137409-22137431 CAACCCCAGTGAACACAGGCGGG + Intergenic
1202210662 Y:22448991-22449013 CAACCCCAGTGAACACAGGCGGG - Intergenic