ID: 1049707542

View in Genome Browser
Species Human (GRCh38)
Location 8:144049884-144049906
Sequence ACTACCGTCCGCACAGGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049707534_1049707542 14 Left 1049707534 8:144049847-144049869 CCCACGCACGTGGCGAGGACGCG No data
Right 1049707542 8:144049884-144049906 ACTACCGTCCGCACAGGTACTGG No data
1049707535_1049707542 13 Left 1049707535 8:144049848-144049870 CCACGCACGTGGCGAGGACGCGC No data
Right 1049707542 8:144049884-144049906 ACTACCGTCCGCACAGGTACTGG No data
1049707529_1049707542 25 Left 1049707529 8:144049836-144049858 CCGTTGCTTCCCCCACGCACGTG No data
Right 1049707542 8:144049884-144049906 ACTACCGTCCGCACAGGTACTGG No data
1049707528_1049707542 29 Left 1049707528 8:144049832-144049854 CCTTCCGTTGCTTCCCCCACGCA No data
Right 1049707542 8:144049884-144049906 ACTACCGTCCGCACAGGTACTGG No data
1049707533_1049707542 15 Left 1049707533 8:144049846-144049868 CCCCACGCACGTGGCGAGGACGC No data
Right 1049707542 8:144049884-144049906 ACTACCGTCCGCACAGGTACTGG No data
1049707532_1049707542 16 Left 1049707532 8:144049845-144049867 CCCCCACGCACGTGGCGAGGACG No data
Right 1049707542 8:144049884-144049906 ACTACCGTCCGCACAGGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049707542 Original CRISPR ACTACCGTCCGCACAGGTAC TGG Intergenic
No off target data available for this crispr