ID: 1049707746

View in Genome Browser
Species Human (GRCh38)
Location 8:144050690-144050712
Sequence CCCTGGGTATCGTGCTTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049707733_1049707746 12 Left 1049707733 8:144050655-144050677 CCGCCGGCTGGGCACGCGCCAAG No data
Right 1049707746 8:144050690-144050712 CCCTGGGTATCGTGCTTAGGGGG No data
1049707734_1049707746 9 Left 1049707734 8:144050658-144050680 CCGGCTGGGCACGCGCCAAGAGC No data
Right 1049707746 8:144050690-144050712 CCCTGGGTATCGTGCTTAGGGGG No data
1049707731_1049707746 14 Left 1049707731 8:144050653-144050675 CCCCGCCGGCTGGGCACGCGCCA No data
Right 1049707746 8:144050690-144050712 CCCTGGGTATCGTGCTTAGGGGG No data
1049707732_1049707746 13 Left 1049707732 8:144050654-144050676 CCCGCCGGCTGGGCACGCGCCAA No data
Right 1049707746 8:144050690-144050712 CCCTGGGTATCGTGCTTAGGGGG No data
1049707737_1049707746 -6 Left 1049707737 8:144050673-144050695 CCAAGAGCAGCCCTGGGCCCTGG No data
Right 1049707746 8:144050690-144050712 CCCTGGGTATCGTGCTTAGGGGG No data
1049707730_1049707746 15 Left 1049707730 8:144050652-144050674 CCCCCGCCGGCTGGGCACGCGCC No data
Right 1049707746 8:144050690-144050712 CCCTGGGTATCGTGCTTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049707746 Original CRISPR CCCTGGGTATCGTGCTTAGG GGG Intergenic
No off target data available for this crispr