ID: 1049708831

View in Genome Browser
Species Human (GRCh38)
Location 8:144054723-144054745
Sequence CACCCGCTAGGTGTTTTGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 36}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049708831_1049708838 22 Left 1049708831 8:144054723-144054745 CCGGCCAAAACACCTAGCGGGTG 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1049708838 8:144054768-144054790 GGCCACCACTGCCCCAGCAGAGG 0: 1
1: 0
2: 7
3: 50
4: 358
1049708831_1049708843 30 Left 1049708831 8:144054723-144054745 CCGGCCAAAACACCTAGCGGGTG 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1049708843 8:144054776-144054798 CTGCCCCAGCAGAGGCAGGCGGG 0: 1
1: 0
2: 8
3: 67
4: 556
1049708831_1049708842 29 Left 1049708831 8:144054723-144054745 CCGGCCAAAACACCTAGCGGGTG 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1049708842 8:144054775-144054797 ACTGCCCCAGCAGAGGCAGGCGG 0: 1
1: 0
2: 3
3: 42
4: 449
1049708831_1049708836 1 Left 1049708831 8:144054723-144054745 CCGGCCAAAACACCTAGCGGGTG 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1049708836 8:144054747-144054769 AGAGCCACGGTCAGCTGCATCGG 0: 1
1: 0
2: 2
3: 14
4: 121
1049708831_1049708840 26 Left 1049708831 8:144054723-144054745 CCGGCCAAAACACCTAGCGGGTG 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1049708840 8:144054772-144054794 ACCACTGCCCCAGCAGAGGCAGG 0: 1
1: 0
2: 0
3: 32
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049708831 Original CRISPR CACCCGCTAGGTGTTTTGGC CGG (reversed) Exonic
905252305 1:36657461-36657483 TACCTGCTAGGAGTTTTGGTAGG + Intergenic
905642616 1:39601684-39601706 CACCAGCAAGGTGCTGTGGCCGG + Intergenic
905885680 1:41490647-41490669 TACCAGCTACGTGTCTTGGCTGG - Intergenic
1068222635 10:54063779-54063801 CGCACGCTAGCTGCTTTGGCGGG + Intronic
1071201805 10:83227935-83227957 CATCCACTGGGGGTTTTGGCAGG + Intergenic
1102292657 12:111713786-111713808 AATTAGCTAGGTGTTTTGGCGGG + Intronic
1103809415 12:123601871-123601893 CACCGGGCAGGAGTTTTGGCGGG - Intergenic
1131028507 15:89166250-89166272 CCCCAGCTTGGTGTTTTGGTGGG - Intronic
1132318313 15:100906486-100906508 AACCCGGAAGGTATTTTGGCAGG + Intronic
1134463388 16:14449790-14449812 CACCCACTAGGTTTTTAGACTGG + Intronic
1148853847 17:50567892-50567914 CTCCTGCTTGCTGTTTTGGCTGG + Intronic
1166699914 19:44876328-44876350 CACCTGCTGGGTGTGTGGGCAGG - Intronic
1166716367 19:44970716-44970738 CATCTGCTAGGTGTTTTGGTGGG - Intronic
929939508 2:46322233-46322255 CACCCGCTAGGTTCTTATGCTGG + Intronic
931142972 2:59484221-59484243 CACCAGCTCGCTGTTTTAGCTGG + Intergenic
1178275118 21:31230041-31230063 CACCTGCCAGGTGTTTGTGCAGG - Intronic
1178816136 21:35931301-35931323 CACGTGCTATGTGTTTTGGATGG - Intronic
1180701821 22:17785351-17785373 CACCAGCTCGGTGTCCTGGCGGG - Intergenic
957661529 3:83161329-83161351 CAACCACTAGGAATTTTGGCAGG - Intergenic
959739264 3:109697132-109697154 CACCCTCTAGTGGTTTTTGCTGG + Intergenic
984544360 4:181082823-181082845 CCCTCGCTAGGTATTTTGACTGG - Intergenic
996129727 5:119767924-119767946 AACCCACTAGTTGATTTGGCAGG + Intergenic
1001848381 5:174941346-174941368 CACCCCCTGGGAGTTGTGGCAGG - Intergenic
1004484113 6:16049507-16049529 CTCCAGCTAGGTGTCTTGCCAGG + Intergenic
1004512291 6:16292693-16292715 CAGCAGCTAGGTGCTTTGCCTGG + Intronic
1013547141 6:111169434-111169456 CAGCAGACAGGTGTTTTGGCAGG + Intronic
1021478120 7:21085859-21085881 CACCAGTTTGGTGTCTTGGCTGG + Intergenic
1024292869 7:47818107-47818129 CACCCTCTGGGTGCTCTGGCAGG - Exonic
1031017277 7:116588439-116588461 CATCCACTAGGCGTTTTGTCAGG - Intergenic
1032052082 7:128655983-128656005 GACCCCCCAGGTGTTTAGGCAGG + Intergenic
1034547711 7:151799877-151799899 CACCCGTGAGGGATTTTGGCCGG - Intronic
1039910240 8:41820689-41820711 CACCTTCTAGGTCCTTTGGCTGG + Intronic
1049708831 8:144054723-144054745 CACCCGCTAGGTGTTTTGGCCGG - Exonic
1050576698 9:7004039-7004061 CTCCAGTGAGGTGTTTTGGCTGG - Intronic
1056215605 9:84403355-84403377 TCCCTGCTTGGTGTTTTGGCCGG + Intergenic
1187739237 X:22337576-22337598 CACCTGCTAGGTGTTGCTGCTGG - Intergenic
1190119911 X:47650975-47650997 CGCCCCCTTGGTGTTTTGGCAGG - Intergenic
1197316665 X:124974487-124974509 TATCCTCAAGGTGTTTTGGCAGG + Intergenic
1200106963 X:153719613-153719635 CACCCGCTCAGTGTTTCTGCTGG + Intronic