ID: 1049709338

View in Genome Browser
Species Human (GRCh38)
Location 8:144056632-144056654
Sequence TGCCCCGAAGTCCCCCGCAC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 73}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049709328_1049709338 27 Left 1049709328 8:144056582-144056604 CCCTTGCCAGGGATCCGGAGTCA 0: 1
1: 0
2: 1
3: 5
4: 87
Right 1049709338 8:144056632-144056654 TGCCCCGAAGTCCCCCGCACGGG 0: 1
1: 0
2: 0
3: 3
4: 73
1049709335_1049709338 -8 Left 1049709335 8:144056617-144056639 CCGCTCCACAAAGGCTGCCCCGA 0: 1
1: 1
2: 1
3: 12
4: 144
Right 1049709338 8:144056632-144056654 TGCCCCGAAGTCCCCCGCACGGG 0: 1
1: 0
2: 0
3: 3
4: 73
1049709332_1049709338 13 Left 1049709332 8:144056596-144056618 CCGGAGTCAGGAAGCCACGTACC 0: 1
1: 0
2: 1
3: 6
4: 89
Right 1049709338 8:144056632-144056654 TGCCCCGAAGTCCCCCGCACGGG 0: 1
1: 0
2: 0
3: 3
4: 73
1049709329_1049709338 26 Left 1049709329 8:144056583-144056605 CCTTGCCAGGGATCCGGAGTCAG 0: 1
1: 0
2: 1
3: 9
4: 151
Right 1049709338 8:144056632-144056654 TGCCCCGAAGTCCCCCGCACGGG 0: 1
1: 0
2: 0
3: 3
4: 73
1049709334_1049709338 -1 Left 1049709334 8:144056610-144056632 CCACGTACCGCTCCACAAAGGCT 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1049709338 8:144056632-144056654 TGCCCCGAAGTCCCCCGCACGGG 0: 1
1: 0
2: 0
3: 3
4: 73
1049709327_1049709338 28 Left 1049709327 8:144056581-144056603 CCCCTTGCCAGGGATCCGGAGTC 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1049709338 8:144056632-144056654 TGCCCCGAAGTCCCCCGCACGGG 0: 1
1: 0
2: 0
3: 3
4: 73
1049709331_1049709338 21 Left 1049709331 8:144056588-144056610 CCAGGGATCCGGAGTCAGGAAGC 0: 1
1: 0
2: 0
3: 23
4: 157
Right 1049709338 8:144056632-144056654 TGCCCCGAAGTCCCCCGCACGGG 0: 1
1: 0
2: 0
3: 3
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049709338 Original CRISPR TGCCCCGAAGTCCCCCGCAC GGG Exonic
903658139 1:24961238-24961260 TGCCTTGAAGGCCCCTGCACAGG + Intronic
903678800 1:25083391-25083413 TGCCCCCAACTCCCCATCACTGG + Intergenic
905339228 1:37266868-37266890 TGCCCCCACCTCCCCCACACAGG + Intergenic
907387960 1:54138075-54138097 TGCCCCGAAGCCCCTGGAACAGG + Intronic
907507158 1:54927913-54927935 TGCCCCCTAGTTCCCAGCACAGG - Intergenic
908338235 1:63149228-63149250 TGCCCCCTAGTGCCCAGCACAGG + Intergenic
920682440 1:208083359-208083381 TGCCCCGAGGTCTCCATCACAGG - Intronic
1064998712 10:21318182-21318204 TGAGCCGAAATCCCCCGCAATGG - Intergenic
1076244308 10:128934143-128934165 TGCCGGGAAGGCCCCTGCACAGG + Intergenic
1077060929 11:617596-617618 TGCCCCTGAGCCCCCCGCAGCGG - Exonic
1077168302 11:1153494-1153516 TGCCCGGGAGTCCCACCCACCGG - Intergenic
1083798411 11:65032070-65032092 TGCCTCCTAGTCCCCCTCACGGG - Intronic
1083964003 11:66031673-66031695 TGCCCCAAAGTTCCACCCACTGG + Intergenic
1086042431 11:82495390-82495412 TGGCCCCAAGTCCTCTGCACAGG + Intergenic
1089540247 11:119185530-119185552 TGTCCCAAAGTCCCCTGCAGAGG - Intronic
1096259420 12:50081547-50081569 GGCCCCGAAGGCTCTCGCACGGG - Exonic
1122255448 14:100472677-100472699 TGCCCCCAAGACCCACGCAGGGG - Intronic
1136666864 16:31819762-31819784 TGCCCCAAAGTCCCCCAGCCAGG - Intergenic
1141900626 16:86988168-86988190 TGCACCTTTGTCCCCCGCACTGG + Intergenic
1142088633 16:88198301-88198323 TGCTCCAAAGTCCCCCGCTGGGG - Intergenic
1146591870 17:34134335-34134357 TGCCCCAAAGTCCCCAGAAAGGG + Intronic
1151726740 17:75889564-75889586 TGCCCCAAAGTCCCACACCCAGG + Exonic
1152073868 17:78147110-78147132 TGCCCCGGAGGTCCCCACACTGG - Intronic
1152781969 17:82230705-82230727 TGCCCGGAAGGCCCCCGCTGGGG - Intronic
1159304072 18:66616574-66616596 TGGCCCCAAGTCCACTGCACCGG - Intergenic
1160168385 18:76532402-76532424 TGCCCAGAACTCCCCTGCCCAGG - Intergenic
1160794705 19:939905-939927 TGCCCCGGAGACCCCCAGACTGG + Intronic
1163373350 19:16914779-16914801 TGTCCTGAAGTCCTTCGCACAGG - Exonic
1163775164 19:19213117-19213139 TGCCCCCACGTCCCCCGCTGGGG - Intronic
1165832544 19:38736695-38736717 TGCCCCGCAGTCCCCGACCCAGG + Intronic
1167765781 19:51481310-51481332 TGCCCAGAAGTCCCCTGGAGAGG + Intronic
926111469 2:10186969-10186991 TGCCCAGGAGTCCCCCGAAGGGG + Intronic
927711603 2:25329562-25329584 TGCCCCTAAGTCTCCAGCCCAGG + Intronic
935650244 2:105375745-105375767 TGCCCCCGAGTCCCCCTGACAGG - Intronic
936865364 2:117071647-117071669 TGCCACCAAGTCTCCCGGACGGG - Intergenic
948542376 2:238699730-238699752 TGCCCTGAGGTCCCCAGCAGAGG - Intergenic
1170413961 20:16120623-16120645 TGGCCCGAAGTCCACGGGACTGG - Intergenic
1175572769 20:60036706-60036728 TGCCCCGATGGTCCTCGCACAGG + Intergenic
1179570948 21:42278683-42278705 TGTAACGAAGTCCCCCACACTGG - Intronic
1179984812 21:44914349-44914371 TGTCACCAAGTCCCCTGCACAGG + Intronic
1180220362 21:46354684-46354706 TGCCCCGAGTTCCCCTCCACTGG - Intronic
1181793173 22:25283239-25283261 TCTCCCGGAGTCCCCCCCACCGG - Intergenic
951922884 3:27875275-27875297 TCCACCGAAGTGCCCCTCACTGG + Intergenic
953551664 3:43908173-43908195 TGCACCCAAGTCCCCCTCTCAGG - Intergenic
958526722 3:95269995-95270017 TGCCCAGATGTCCCTCTCACAGG - Intergenic
968761021 4:2442852-2442874 TGCCCCCAAGGCCACCGCGCAGG - Intronic
980239337 4:130153131-130153153 TGCTCCCAATTTCCCCGCACAGG + Intergenic
996027804 5:118668253-118668275 TGCCCCAAACACCCCCCCACCGG - Intergenic
997584133 5:135034618-135034640 CGCCTCGAAGTCCCCAGCCCTGG + Intronic
1002195142 5:177497278-177497300 TTCCCCTTAGTCCCCCGCCCGGG + Intronic
1002466025 5:179409199-179409221 TGCCCCGAAATCCCACACAAAGG + Intergenic
1002603716 5:180370032-180370054 TGCCCTGACGTCCCTCCCACTGG - Intergenic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1005491933 6:26355077-26355099 TACCCCGAAGTACCCAGCCCAGG - Intergenic
1005964991 6:30720936-30720958 TGGCCCTAAGTACCCCGCAGGGG - Intronic
1015626009 6:135181515-135181537 TGGCCCGAAGACCCCGGCACAGG + Exonic
1019056968 6:169231038-169231060 TGCCACTCAGTCCACCGCACAGG - Intronic
1020186449 7:5962788-5962810 TGCCCAGAAGCCCCCCTGACTGG + Intronic
1020296465 7:6761986-6762008 TGCCCAGAAGCCCCCCTGACTGG - Intronic
1029437912 7:100573092-100573114 TGCCCCCAACTCACCCACACCGG + Exonic
1029689232 7:102169797-102169819 TGTCCCGCAGCCCCCAGCACTGG + Intronic
1032084538 7:128877101-128877123 TGCCCCCAAGTCCTGCTCACTGG - Exonic
1034680813 7:152925939-152925961 TGCCCCAACGTCCCCCTCCCGGG + Intergenic
1036707402 8:11055779-11055801 GGCCCCGAAGTCCACTGCACAGG + Intronic
1039921299 8:41896233-41896255 TGCCGCCAACTCCGCCGCACCGG + Intronic
1042864319 8:73344218-73344240 TTCCCCGAAGTCCCCACCCCAGG + Intergenic
1049709338 8:144056632-144056654 TGCCCCGAAGTCCCCCGCACGGG + Exonic
1050701899 9:8349119-8349141 TTCCCCGAAGCCCCCAGCATGGG + Intronic
1058618505 9:106860804-106860826 TGCCCCGAGCTCCTCCCCACCGG - Intergenic
1059058999 9:111015197-111015219 TGCCATGAAGTCCCACGGACTGG - Intronic
1060239780 9:121892935-121892957 AGCCCAGAACTCCCCCTCACTGG + Intronic
1060408073 9:123382431-123382453 TGCCTCGAAGGCCCCAGAACCGG - Exonic
1060966114 9:127713169-127713191 TGCCCGGAAGGTCCCCACACGGG - Exonic
1061783292 9:133008191-133008213 TGCCCCGCAGTCCCCTCCCCTGG - Intergenic
1061846011 9:133388799-133388821 TGCCCCGAAGAGCCCCTCAGGGG - Intronic
1200155160 X:153971253-153971275 CACCCCCAAGTCCCCAGCACTGG + Exonic
1201960273 Y:19673361-19673383 TGACCTGAAGTCCCCTGCAAGGG + Intergenic