ID: 1049709824

View in Genome Browser
Species Human (GRCh38)
Location 8:144058453-144058475
Sequence CACTGCCCACTCCTGGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 539
Summary {0: 1, 1: 0, 2: 6, 3: 59, 4: 473}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049709824_1049709837 22 Left 1049709824 8:144058453-144058475 CCCAGGCCCAGGAGTGGGCAGTG 0: 1
1: 0
2: 6
3: 59
4: 473
Right 1049709837 8:144058498-144058520 TGAGTTGGCCCTGGAAGCCACGG 0: 1
1: 0
2: 1
3: 23
4: 247
1049709824_1049709833 7 Left 1049709824 8:144058453-144058475 CCCAGGCCCAGGAGTGGGCAGTG 0: 1
1: 0
2: 6
3: 59
4: 473
Right 1049709833 8:144058483-144058505 CTCACAGCCTCACCTTGAGTTGG 0: 1
1: 0
2: 2
3: 16
4: 152
1049709824_1049709834 13 Left 1049709824 8:144058453-144058475 CCCAGGCCCAGGAGTGGGCAGTG 0: 1
1: 0
2: 6
3: 59
4: 473
Right 1049709834 8:144058489-144058511 GCCTCACCTTGAGTTGGCCCTGG 0: 1
1: 0
2: 0
3: 12
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049709824 Original CRISPR CACTGCCCACTCCTGGGCCT GGG (reversed) Intronic
900311979 1:2037909-2037931 CACTGCCCACACCTTGGTTTTGG + Intergenic
900316972 1:2061757-2061779 CACTGCCCACTCGGGGTCCCAGG + Intronic
900317851 1:2068329-2068351 CCCTGGCCACACCTTGGCCTGGG - Intronic
900400049 1:2469310-2469332 CACTGCCCCCTCCTAAGACTAGG - Intronic
900507794 1:3038425-3038447 CACTGCCCAGCTCTAGGCCTCGG + Intergenic
900640991 1:3687988-3688010 CCCTTCCTTCTCCTGGGCCTGGG - Intronic
900651069 1:3730316-3730338 CTCTGCCCACTCCTGGCTGTGGG + Intronic
901250116 1:7771510-7771532 CACCGCCCACCCCCAGGCCTCGG - Intronic
901457524 1:9371738-9371760 CACAGCAAACTCCTGGCCCTGGG - Intergenic
902535596 1:17117972-17117994 CTCTGCCTTCCCCTGGGCCTGGG - Intronic
902707033 1:18212707-18212729 CAGTGCCCTCTCCAGGGCCAGGG - Intronic
902806406 1:18863814-18863836 CACTGCCCTCACCCGGGCCCTGG - Intronic
903070414 1:20724363-20724385 CACTGCCCACTCCTTGGCTGGGG + Intronic
903241135 1:21983461-21983483 CACTGCAGCCTCCTGGGCCAAGG - Intronic
903244645 1:22006639-22006661 CACTGCAGCCTCCTGGGCCAAGG - Intronic
903293442 1:22329091-22329113 TCCTGCCCACCCATGGGCCTGGG + Intergenic
904094413 1:27966191-27966213 CACTCAGCACCCCTGGGCCTTGG - Intronic
904266079 1:29319258-29319280 CCCAGCCCCCTCCTTGGCCTTGG + Intronic
904336705 1:29802580-29802602 CACTGGCCAGCCCTGGGCCTGGG + Intergenic
906288392 1:44603357-44603379 CACTGCCCCCACCTTGGCCCCGG + Intronic
906514296 1:46429738-46429760 CACTACCCTCTCCTGGCTCTTGG - Intergenic
907460059 1:54600277-54600299 CATTGCCCAGTTCTAGGCCTTGG + Intronic
909810053 1:79922534-79922556 CACTGCCCTCTCCTGGGATTAGG + Intergenic
909942770 1:81630305-81630327 CACTGCCCACTCCTCTGGATGGG - Intronic
913010178 1:114675604-114675626 CAATGTCCACTCCTGGGGCTTGG + Exonic
913321323 1:117590642-117590664 CACTGCCCACAACGTGGCCTGGG + Intergenic
914196999 1:145452741-145452763 CTCTGCCTGCTCCTGAGCCTGGG - Intergenic
914198419 1:145463157-145463179 CTTTGTCCACTCCTGGGCATAGG + Intergenic
914343564 1:146779673-146779695 CACTGCCCCCTGCAGGGCCCAGG + Intergenic
914876240 1:151514274-151514296 CTGTGCCCTCTGCTGGGCCTAGG + Intronic
915298900 1:154941070-154941092 CGCTGCCCACCTGTGGGCCTTGG - Intergenic
915459178 1:156059569-156059591 CACTGCCCATCCCAGGCCCTGGG + Intergenic
915571563 1:156747696-156747718 CAGTGCCCACACCTGAGCCAGGG + Intronic
915595474 1:156894152-156894174 CACTGCCCCCTCCCAGGGCTGGG + Intronic
916409268 1:164529173-164529195 CTCTGCTCATTCCTGGGCATAGG - Intergenic
917441087 1:175069595-175069617 CACTGCTCATTCCAGAGCCTTGG + Intronic
917470486 1:175322283-175322305 CATTGCCTGCTCCTGGCCCTGGG - Exonic
917494682 1:175529539-175529561 CACCTCCCAGTCCTGGGCCCTGG - Intronic
918181052 1:182086322-182086344 CACTGCCCACAGATGGCCCTGGG + Intergenic
918437744 1:184533793-184533815 CACTGCCCACTCCCCAGCCCCGG - Intronic
918514959 1:185353355-185353377 CACTGCCTGCTCCTTGGCCGAGG + Intergenic
920196420 1:204230343-204230365 CACTGCCCACTCCCAGGGCATGG - Intronic
920372795 1:205490123-205490145 CACAGCACACTGCTGGGCCCCGG + Intergenic
921493721 1:215811130-215811152 CCCTGTCCATTCCTGGGCATAGG + Intronic
921904783 1:220484938-220484960 CTCTGCCTACCCCTGGGCTTTGG - Intergenic
922792283 1:228317093-228317115 ATCTGCCCACTCCAGAGCCTGGG + Intronic
922903450 1:229156175-229156197 CACTGCCCAATCCTGCCCATTGG - Intergenic
923322759 1:232852045-232852067 CACATCCCACTCTTGGCCCTAGG - Intergenic
923781219 1:237026271-237026293 CACTGCTCACTCCAGCTCCTAGG + Intergenic
924517488 1:244778985-244779007 CACTTACCTCTCTTGGGCCTAGG - Intergenic
924642523 1:245848013-245848035 CACACTCCACTCCTGGGACTAGG - Intronic
1063663655 10:8049724-8049746 CACCGCCCCCTCCTCCGCCTCGG - Intergenic
1065046660 10:21752218-21752240 CACAGCCCTCTCCATGGCCTTGG + Intergenic
1065295444 10:24270009-24270031 TACTGCCCACTCCTGTGGCAGGG - Intronic
1065427264 10:25618734-25618756 CCTTGCCCATTCCTGGGCATAGG - Intergenic
1065739792 10:28786670-28786692 CACTGCCAACTCCTGGAACAGGG + Intergenic
1065830242 10:29608517-29608539 CCCTGCACTCTCCAGGGCCTGGG + Intronic
1067336814 10:45373565-45373587 CACTGGCCATCTCTGGGCCTGGG + Intergenic
1067575169 10:47404234-47404256 CAGTGCCTCCTGCTGGGCCTGGG - Intergenic
1067972834 10:50991780-50991802 CACTTCCCATTCCCGGGCCGCGG - Intronic
1069623569 10:69852852-69852874 CTCGGCCCATTGCTGGGCCTGGG + Intronic
1069825583 10:71253320-71253342 TACTGTCTACTCCTGGGCCTGGG - Intronic
1069847639 10:71383846-71383868 CACTGCCCATTTCTGGGCCTTGG - Intergenic
1069961123 10:72080080-72080102 CTCTGCCCAGTCCTGTCCCTAGG - Intronic
1070457626 10:76632860-76632882 TACTGCCCTCTCCTGGACCTGGG + Intergenic
1070531868 10:77343951-77343973 ACCTGCCCACTCATGGGCCTAGG + Intronic
1070545820 10:77451658-77451680 GACTGCCTACTCCTGGGCAGGGG - Intronic
1070627430 10:78061400-78061422 CTCTGCCCACTCCAGAGCCTTGG + Intergenic
1071358673 10:84822998-84823020 CACTGGACCCTCCTGGGCCTGGG - Intergenic
1072259067 10:93650043-93650065 CACTGTCCACTCCCAGCCCTAGG + Intronic
1074445692 10:113519658-113519680 CACTCTCCCCTCCTGGGGCTCGG + Intergenic
1074568474 10:114602837-114602859 GACTGCCCAGCCCTGGGACTGGG + Intronic
1075405688 10:122194241-122194263 CACTGGCCAAGCCTTGGCCTGGG - Intronic
1076295555 10:129381076-129381098 CTCTGCCAACACCTGGACCTTGG + Intergenic
1076359344 10:129875880-129875902 CAATGCCCAGGGCTGGGCCTGGG - Intronic
1076693748 10:132237141-132237163 AAATGCCCACTCCTGCCCCTGGG + Intronic
1076816058 10:132915253-132915275 CTCTGCCCAGCCTTGGGCCTGGG + Intronic
1076839601 10:133039513-133039535 CACTTCCCAGGCCTGGGACTGGG + Intergenic
1077096177 11:800073-800095 CCCTGGTCACCCCTGGGCCTCGG + Intronic
1077338240 11:2014842-2014864 CAAGGCCCACCCCTGGGCCTAGG - Intergenic
1077342342 11:2031731-2031753 CAATACCATCTCCTGGGCCTTGG - Intergenic
1077360105 11:2137096-2137118 CACGGCCCACGCCTGGGCCTCGG - Intronic
1077435485 11:2536829-2536851 CCCTGCCCACACCTGGGTCTCGG - Intronic
1077544418 11:3163063-3163085 CACTGTGCAACCCTGGGCCTCGG + Intronic
1077777561 11:5288273-5288295 CCCTGCCCATTGCTGGGCCTTGG + Intronic
1077844895 11:6013421-6013443 CACTCCCAACAGCTGGGCCTGGG - Intergenic
1078151835 11:8766213-8766235 TCCTGCCCACTTCTGGGGCTGGG - Intronic
1079210693 11:18458155-18458177 CACTGCCCTATCCTGGGCCCTGG - Intronic
1080041369 11:27762894-27762916 CTCTGCCCACTGCTGGACCTTGG - Intergenic
1080457597 11:32430541-32430563 CCCTGCCTACTCCTGGGCTCAGG - Intronic
1081679911 11:44994879-44994901 CACTGCACCCTAGTGGGCCTGGG - Intergenic
1081740862 11:45439098-45439120 CATTGCCCCTTCCTGGGGCTTGG - Intergenic
1083393265 11:62371190-62371212 CACTGCCCACGCCAGGGCCCAGG + Intronic
1083643402 11:64157995-64158017 CTCTGCCCACACCAGGGCATTGG + Intronic
1083661538 11:64253773-64253795 CACTGCCCAGTCCTGAGAGTAGG + Intronic
1083682923 11:64359505-64359527 GCCTGCTCACTCTTGGGCCTGGG + Intronic
1083688521 11:64392216-64392238 CACTGCACTCTCCAGAGCCTGGG - Intergenic
1083739041 11:64698064-64698086 TACTTCCCTGTCCTGGGCCTCGG - Intronic
1083742428 11:64717947-64717969 TAAAGCCCACTCCTGGGACTGGG + Intronic
1083796103 11:65017652-65017674 CTCACCCCTCTCCTGGGCCTAGG + Intronic
1083934870 11:65864937-65864959 CCCTGCCCAGTCCTCAGCCTTGG - Intronic
1084088262 11:66864658-66864680 CGCTGCCCTCTCCTCGCCCTTGG - Intronic
1084298222 11:68226793-68226815 CAATGACCACCCCTGGGCTTGGG - Intergenic
1084514964 11:69632454-69632476 CCCTGGCTACTCCTGGCCCTTGG - Intergenic
1085210241 11:74770219-74770241 GAGAGCCCATTCCTGGGCCTTGG + Intronic
1086545923 11:87967400-87967422 TACTGCCCACTGGTGGGTCTAGG + Intergenic
1087855598 11:103088505-103088527 CACAACCCCATCCTGGGCCTAGG + Intronic
1088612371 11:111590061-111590083 ATCTGCCGACTCCTGGACCTTGG + Intergenic
1088917681 11:114239709-114239731 TACTGCCCACTCCTGGCCAGGGG + Intronic
1089221536 11:116876117-116876139 CTCTGCCCCTTCCTGGGCCTTGG - Intronic
1089615692 11:119693501-119693523 CACCTTCCACTCCTGGGCCTTGG - Intronic
1089697892 11:120227014-120227036 CACTGCCCGCTGCTGGGCGGAGG + Intronic
1090003600 11:122981782-122981804 CGCTGCTCTCTCCCGGGCCTGGG + Intergenic
1202821224 11_KI270721v1_random:70024-70046 CAAGGCCCACCCCTGGGCCTAGG - Intergenic
1202825328 11_KI270721v1_random:86920-86942 CAATACCATCTCCTGGGCCTTGG - Intergenic
1091537190 12:1422216-1422238 CCCTGCTCATTCCTGGGCATAGG - Intronic
1094216973 12:27952660-27952682 AGCTGCCCATTCATGGGCCTGGG + Intergenic
1095925924 12:47579251-47579273 CCCTTACCACTCCTAGGCCTAGG - Intergenic
1096528895 12:52231270-52231292 CACTGCCCCTCCCTGGGCCATGG - Intergenic
1096587210 12:52630489-52630511 CACTGCCTACTGTTGGCCCTCGG - Intergenic
1098157263 12:67612572-67612594 CACTGACCAGTACTGGTCCTCGG - Intergenic
1101011826 12:100458772-100458794 ACCTGCCCACTCTTGGTCCTTGG - Intergenic
1103549071 12:121723374-121723396 AACTGCCCATACCTGAGCCTGGG - Intronic
1103704824 12:122865837-122865859 CACTGCCCCCTGCTGGGCCCTGG + Exonic
1104536367 12:129621561-129621583 CTCTCCCCACTCCTCTGCCTTGG + Intronic
1104928999 12:132328630-132328652 CACCCCACACTCCTGGACCTAGG + Intronic
1105898558 13:24738759-24738781 CTCTGCCCAAACCTTGGCCTTGG - Intergenic
1107102241 13:36606234-36606256 CACTGCTCACCCCTGGGCTTGGG + Intergenic
1107600927 13:42011889-42011911 CACTGCCCACATCTGGCTCTGGG + Intergenic
1112896269 13:104304131-104304153 CTCTTCCCACTCCTGGGACAGGG - Intergenic
1113327852 13:109300057-109300079 CACTGCTCACTCCTGGGCTCAGG - Intergenic
1113579401 13:111418441-111418463 CGCTGCCTACTCATGAGCCTGGG + Intergenic
1113732472 13:112651314-112651336 CTCTGCCCACTCCGAGGCCCTGG + Intronic
1113874342 13:113585020-113585042 CCCTGCGCGCTCCTGTGCCTCGG + Intronic
1113904626 13:113813449-113813471 CCCTGCCCAGTCCTGGATCTGGG + Exonic
1117873276 14:60222801-60222823 CATTCCCACCTCCTGGGCCTGGG + Intergenic
1118333197 14:64830249-64830271 CAGTGCCTAGTACTGGGCCTGGG + Intronic
1119786355 14:77317217-77317239 CACTGACCACACCTGCTCCTGGG + Intronic
1121221968 14:92292364-92292386 CACTGCCCTTTGGTGGGCCTCGG - Intergenic
1121314279 14:92951891-92951913 AACTGCCCTCCCGTGGGCCTAGG - Intronic
1121362309 14:93272866-93272888 CACTGCAGACACCTGGGCTTAGG - Intronic
1121897646 14:97663395-97663417 CAGTGCACAGTCCTGGCCCTGGG - Intergenic
1122161502 14:99787698-99787720 CCCTGCCCACACCTGGGTTTTGG - Intronic
1122270463 14:100566658-100566680 CACCGCCCCCACCTGGACCTTGG + Intronic
1122692664 14:103538598-103538620 CACTGCCCACTCCTGGACACTGG + Intergenic
1122772197 14:104102488-104102510 CCTTCCCCACCCCTGGGCCTCGG + Intronic
1122818536 14:104327651-104327673 CCCTGCCGACACCTGGACCTCGG - Intergenic
1123032556 14:105458749-105458771 CATGGTCCTCTCCTGGGCCTCGG - Intronic
1123034857 14:105467716-105467738 CATTGCCTAGTCCTGGGCCCAGG + Intronic
1124349164 15:28942910-28942932 CTCTGCTCCTTCCTGGGCCTCGG + Intronic
1124410569 15:29433078-29433100 CACTGCCCTCTCATGAGCCAAGG + Intronic
1124512570 15:30339675-30339697 CGGTGCCCACAGCTGGGCCTTGG - Intergenic
1124689053 15:31806589-31806611 CAATGACCACTGCTGGTCCTGGG + Intronic
1124730345 15:32191075-32191097 CGGTGCCCACAGCTGGGCCTTGG + Intergenic
1127606667 15:60593041-60593063 TACGGCCCACTTCTGGGCCGTGG + Intronic
1127673365 15:61216846-61216868 CACAGCACACACCTGGGTCTTGG + Intronic
1129463654 15:75712231-75712253 CACTCCCCATTCCTGGCCCAGGG + Intronic
1129832846 15:78681923-78681945 ACCTGCTCAGTCCTGGGCCTGGG + Intronic
1129868287 15:78925253-78925275 CACACCCCACTCGTGGGACTTGG - Intronic
1130255104 15:82322340-82322362 TGCTCCCCACGCCTGGGCCTCGG - Intergenic
1130599870 15:85267666-85267688 TGCTCCCCACGCCTGGGCCTCGG + Intergenic
1130666399 15:85873188-85873210 CAGTGCCCACTGCTGGTCCTGGG + Intergenic
1130688679 15:86061466-86061488 CAGTGCCTAATCCCGGGCCTGGG - Intergenic
1130901041 15:88206963-88206985 CGCTGACCAAGCCTGGGCCTGGG - Intronic
1130907269 15:88249527-88249549 CCCTGCCCACTCTGGGCCCTTGG + Intronic
1131063294 15:89417492-89417514 CCCTGCCCACTCCTGGCCCGCGG + Intergenic
1131551792 15:93363710-93363732 CAGGGCCCACTCCTGGAGCTGGG + Intergenic
1132312303 15:100866098-100866120 CACTGACCTCTCATGGGCCCTGG - Intergenic
1132325245 15:100963547-100963569 CACTCCCTAATCCTTGGCCTGGG + Intronic
1132647156 16:1004375-1004397 CCAGCCCCACTCCTGGGCCTGGG + Intergenic
1132710493 16:1264099-1264121 AGCTGCCCACTGCTGTGCCTTGG + Intergenic
1132749709 16:1451938-1451960 CACGGCCCCCTGCTGGGCCTAGG - Intronic
1132765881 16:1533981-1534003 GACGGCGCACTCCTGGCCCTGGG + Exonic
1132826234 16:1907079-1907101 CCCTGGCCTCTCCTGGGCCATGG + Intergenic
1132883814 16:2173688-2173710 CCCTGCCCACCCCTGGCCCAGGG + Intronic
1133103613 16:3493697-3493719 CAGCGCCCAGGCCTGGGCCTCGG - Exonic
1135073761 16:19375449-19375471 TACTGCACCTTCCTGGGCCTTGG - Intergenic
1135602436 16:23794840-23794862 CTTTGCCCATTCCTGGGCATAGG + Intergenic
1135638758 16:24101614-24101636 CCTTGTCCATTCCTGGGCCTAGG - Intronic
1135908858 16:26541066-26541088 CACTCCGCTTTCCTGGGCCTTGG + Intergenic
1136234614 16:28905931-28905953 TGCTGCCCACGCCTGGGCCCCGG + Intronic
1137610336 16:49813481-49813503 CCCTGCCCTCCCCTGGGCCATGG + Intronic
1137937928 16:52652514-52652536 CACTCCCCACAGCTGGGGCTTGG + Intergenic
1138037082 16:53619048-53619070 CACTGCCCACTCTTGGGTTTTGG + Exonic
1139517489 16:67460366-67460388 CTCCTCCCACTCCTGAGCCTAGG - Intronic
1139990427 16:70935661-70935683 CACTGCCCCCTGCAGGGCCCAGG - Intronic
1140412006 16:74746842-74746864 CCCTGACCCCACCTGGGCCTTGG - Intronic
1140423875 16:74843913-74843935 CTCTGGCCACTTCTGGCCCTGGG - Intergenic
1140866299 16:79065496-79065518 CACTGACCCCACCTAGGCCTGGG - Intronic
1141740595 16:85889524-85889546 CCCTGTTGACTCCTGGGCCTGGG + Intergenic
1141811369 16:86378508-86378530 CCCTGCCCACACCTTGACCTTGG - Intergenic
1142003679 16:87679074-87679096 CACTGCCCAGGTCTGCGCCTGGG - Intronic
1142006669 16:87692555-87692577 CACTGGCCACAGATGGGCCTGGG + Intronic
1142006682 16:87692599-87692621 CACTGGCCACAGATGGGCCTGGG + Intronic
1142116223 16:88357477-88357499 CACTCCCCCTCCCTGGGCCTCGG + Intergenic
1142212732 16:88816174-88816196 CACTGCCATCTCCTGGGCACTGG - Intronic
1142709804 17:1716799-1716821 CTCTGCCCACTCCTGCTCCTTGG - Intronic
1143288349 17:5809373-5809395 CCCTGCCCATCTCTGGGCCTTGG - Intronic
1143371575 17:6444044-6444066 CTCTGCCCGCTGCCGGGCCTGGG + Intergenic
1143554769 17:7653153-7653175 CCCAGCCCCCTCCTGGTCCTAGG - Intronic
1143568169 17:7737771-7737793 CCATGCCCACTCCTTGTCCTAGG - Intronic
1144791194 17:17860326-17860348 CACTGCCCACTCCTGTGGAAAGG + Intronic
1144946959 17:18974439-18974461 CCCTGCCCCTCCCTGGGCCTTGG + Intronic
1145242077 17:21245901-21245923 CAGTGGCCACAGCTGGGCCTTGG - Intronic
1146794890 17:35773931-35773953 CTCTGCCCTTTCCAGGGCCTGGG + Intronic
1146824168 17:36009108-36009130 CACTGCGCACACCTGCGGCTGGG - Intergenic
1147239979 17:39084516-39084538 CACTGCCCACTCCTGATGTTCGG + Intronic
1147257631 17:39191631-39191653 CCCTCCCAGCTCCTGGGCCTGGG + Intronic
1147325186 17:39666605-39666627 CAATGCCCACTTCTGGGACCAGG + Intergenic
1147645557 17:42031674-42031696 TACAGCCCCATCCTGGGCCTGGG + Exonic
1147660974 17:42116980-42117002 CACGGCCCACTCCTGAGTTTGGG - Intronic
1147845923 17:43403815-43403837 CACTGCCCACTCTGGGCCTTAGG - Intergenic
1148147766 17:45376788-45376810 CACCTCTCACTCCTGGCCCTGGG + Intergenic
1148183078 17:45620609-45620631 CAGCGCCCACTCGTAGGCCTGGG + Intergenic
1148265773 17:46225082-46225104 CAGCGCCCACTCGTAGGCCTGGG - Intronic
1148511911 17:48178145-48178167 CATTGCCCACTCCTGGGGTAAGG + Intronic
1148558865 17:48594585-48594607 CACTCCCCACGCCTGGGCTAAGG - Intronic
1148687593 17:49509363-49509385 CACTTCCCACGCCTGGGGCAGGG - Intronic
1148756003 17:49973259-49973281 CACTGGCCCCACCTGGGTCTGGG - Exonic
1149079828 17:52641881-52641903 CAATGCCCTTTCCTGGGCATAGG - Intergenic
1149426227 17:56557423-56557445 CACTTCCCAATCATGGGACTCGG - Intergenic
1150465543 17:65389635-65389657 TCCTGCCCACTCCTTGGCTTTGG - Intergenic
1151273348 17:73013975-73013997 CAGTGCCCCCTGCTGTGCCTTGG + Intronic
1151448105 17:74180531-74180553 TTGTGTCCACTCCTGGGCCTGGG - Intergenic
1151945197 17:77315896-77315918 CAGTGCCCACTCCAGGGTGTGGG + Intronic
1152134492 17:78495793-78495815 CTCTGCCCACTCCTTGGCACTGG + Intronic
1152154048 17:78621542-78621564 CTCTGCCGACTCCTGGGACACGG - Intergenic
1152196832 17:78923469-78923491 CACAGCCTCCTTCTGGGCCTTGG + Intronic
1152255102 17:79234384-79234406 CAGTGCCCACTTCTGAGCCAAGG + Intronic
1152298918 17:79484361-79484383 CAGTGCCCACTGCTGGGTGTGGG + Intronic
1152550477 17:81027575-81027597 CACTGGCCCCTCCTGGCACTGGG - Intergenic
1152655623 17:81517997-81518019 CCCTTCCCACCCCAGGGCCTCGG + Intronic
1152718646 17:81911697-81911719 CACCGCCCACACCTGGCGCTCGG + Intergenic
1152775873 17:82201687-82201709 CTCTTCCCACTCCCTGGCCTGGG + Exonic
1152942216 17:83178704-83178726 CTCTCCTCACTCCTGGGCCTGGG - Intergenic
1153988833 18:10376989-10377011 CCCTGCCAGCTGCTGGGCCTGGG + Intergenic
1157177558 18:45465430-45465452 CACTGCCCTGTCCTGGGCCTTGG - Intronic
1157582772 18:48782923-48782945 CACTTCCCACTCCTGCCCCATGG - Intronic
1157606934 18:48931872-48931894 CCCAGCCCCCTCCTGGGACTAGG + Intronic
1158950141 18:62486776-62486798 CACTGCAGCCTCCTGGGCTTAGG - Intergenic
1160225096 18:77006190-77006212 CACTGTCCACCCCTCAGCCTTGG - Intronic
1161009223 19:1952178-1952200 CACTGCCCACTGAGGGGCCAAGG - Intronic
1161127455 19:2566381-2566403 CCCTGCCTACACCTTGGCCTTGG + Intronic
1161321080 19:3641860-3641882 CACTGGGCACTCCTGGGGGTAGG - Intronic
1161326018 19:3664688-3664710 CACAGCCCACACCTGTCCCTGGG + Intronic
1162367366 19:10257577-10257599 GTCTGCCCTCGCCTGGGCCTTGG - Intronic
1162725731 19:12688990-12689012 CGCTTCCCACTCTTGGGCCCTGG - Exonic
1162797140 19:13092751-13092773 CGCTTCCCACCCCCGGGCCTGGG + Intronic
1162804255 19:13128863-13128885 CAGTGCCTAGTCCTGGCCCTGGG - Intronic
1163691490 19:18741058-18741080 CAGTGTCCACTCCTGGCCCAGGG + Intronic
1163720666 19:18896694-18896716 CACGGCCCACGCCAGGGCGTTGG + Intronic
1164080390 19:21857281-21857303 CACAGCCCTCTGCTGGACCTAGG - Intergenic
1164438549 19:28253403-28253425 CAGAGCCCACCCCTGGGGCTGGG - Intergenic
1164760156 19:30722626-30722648 CCCTGCCCACAACTGGGCATGGG - Intergenic
1164910393 19:32006416-32006438 CACTGCCCATTACTGACCCTGGG + Intergenic
1165362291 19:35344410-35344432 CAGTGCCCTCTTCAGGGCCTAGG + Intronic
1166230872 19:41425351-41425373 CACTCCCCACTCTGAGGCCTGGG - Exonic
1166231521 19:41427771-41427793 CACTGCCGCCTCCTGGCCATGGG - Intronic
1166294311 19:41881462-41881484 CACTCCCCACACCTGGGACCAGG + Intergenic
1166536366 19:43577240-43577262 CTCTGCACCCTCCTGGGTCTTGG + Intronic
1166870692 19:45868704-45868726 CACTGCCTCCTCCGAGGCCTGGG - Intronic
1167234090 19:48303437-48303459 CCCTCCTAACTCCTGGGCCTGGG - Intronic
1167604599 19:50475213-50475235 CACTGCCAGCTCCTGGCCCTGGG + Intronic
1167685450 19:50953025-50953047 CACTGCCTCCTCCTGGGCTCTGG + Exonic
925203591 2:1988385-1988407 TACTGCCCACTACAGGGCCCTGG - Intronic
925409399 2:3631467-3631489 CACTGGGCACAGCTGGGCCTGGG - Intronic
925870533 2:8266019-8266041 CATGGCCAACTCCTGAGCCTCGG - Intergenic
926118035 2:10225554-10225576 CCCTGCCCTCTCCTGAGGCTGGG + Intergenic
927052505 2:19344676-19344698 TTCTCACCACTCCTGGGCCTTGG - Intergenic
927059073 2:19397193-19397215 CCGTGCCCACCCCTGGCCCTCGG + Intergenic
927146915 2:20172338-20172360 CCCTGCCCACTCCCAGGTCTGGG + Intergenic
927646101 2:24877889-24877911 CACTGCCCAGTCCCGGGTCCTGG + Intronic
929000791 2:37345083-37345105 CACTGGCCTCTCCTGGGCTGCGG + Intronic
930010011 2:46929768-46929790 CACTGCCCATCTCTGGGCATTGG + Intronic
930037412 2:47095471-47095493 CACTGCCAACACCTTGGGCTGGG + Intronic
931450223 2:62362323-62362345 CACTCCACACTCCTGGACATAGG + Intergenic
932157944 2:69435237-69435259 GACTGCCCATTCCCGGGCTTGGG - Intronic
932337054 2:70937533-70937555 CACTGCATATTTCTGGGCCTTGG - Intronic
934554583 2:95280594-95280616 GACTGCTCACTTCTGTGCCTAGG - Intronic
935103766 2:100020746-100020768 CACTGCCAACTCCTTGGCCCAGG + Intronic
935156106 2:100484962-100484984 CACTTCCCATTCCTGTGCCTCGG + Intergenic
935294601 2:101638116-101638138 CATGGCCCAGTGCTGGGCCTTGG + Intergenic
936343484 2:111657763-111657785 CATTTCCAATTCCTGGGCCTTGG - Intergenic
937319325 2:120951520-120951542 CACTGTCAACTCCTCAGCCTTGG + Intronic
937904592 2:127046733-127046755 CCCAGCCCACTTCTGAGCCTGGG - Intergenic
938339134 2:130523801-130523823 CTCTGCCCTCTCCCAGGCCTGGG + Intronic
938381009 2:130836760-130836782 CCCTGCCCGCCCCTGGGCTTTGG - Intergenic
941890816 2:170579632-170579654 CCCTGACAACTTCTGGGCCTTGG - Intronic
942220425 2:173763514-173763536 CACTGCATGCCCCTGGGCCTTGG + Intergenic
942489249 2:176473547-176473569 CACTGCCAAGTCTTGGGCTTGGG - Intergenic
943941725 2:194006808-194006830 CACTGCAAACTCCTCCGCCTGGG - Intergenic
943984938 2:194606334-194606356 CCCTGCCCAGCCCTGGGCATAGG - Intergenic
944065553 2:195616029-195616051 CACTGCAAACTCCACGGCCTGGG + Intronic
946488685 2:220126340-220126362 CACTGCCCAGTCCTATTCCTAGG - Intergenic
946757997 2:222965777-222965799 AATAGCCCACTCCTGGGCCTTGG - Intergenic
948679117 2:239620393-239620415 CCCTTTCCACTCCAGGGCCTTGG + Intergenic
948907701 2:240987670-240987692 TGCTGCCCAATCCTGGGCCAGGG + Intronic
1168791991 20:584240-584262 CCCAGCCTACTCCTGGACCTGGG - Intergenic
1169044046 20:2521557-2521579 CACTACCCACACCTGAGTCTAGG - Intronic
1169483371 20:6005899-6005921 CCCCGCCCACCCCCGGGCCTTGG + Intergenic
1171009995 20:21504374-21504396 CTGTTCTCACTCCTGGGCCTGGG - Intergenic
1171383114 20:24748075-24748097 CCCTGCCCACACCTGGACCTGGG + Intergenic
1171969049 20:31552006-31552028 CACTGCCCTCTCCAGGGCCTGGG + Intronic
1172808526 20:37630795-37630817 CCCTCCCAACTCCTGGGCCACGG - Intergenic
1172945038 20:38680761-38680783 ATCTGCCCACTCCTGTGCCAGGG + Intergenic
1173019967 20:39258862-39258884 AAGTGCCAACTCCTGGGCCAGGG - Intergenic
1173056216 20:39615832-39615854 CCCTGACCCCTCCTGGGCCTAGG - Intergenic
1173158005 20:40631286-40631308 CACTGGGCATTCTTGGGCCTGGG + Intergenic
1173859533 20:46273831-46273853 CTCTGCCCACTCCTAGCTCTTGG - Intronic
1174080381 20:47967217-47967239 CACAGCCCACTGCTGGGGCTGGG + Intergenic
1174137212 20:48388056-48388078 CACAGCCCACTGCTGGGGCTGGG - Intergenic
1174187414 20:48716520-48716542 CCCAGTCCTCTCCTGGGCCTTGG - Intronic
1175244324 20:57572503-57572525 CTCTCCCCACGCCTGGACCTGGG - Intergenic
1175472207 20:59238422-59238444 CTCTGCCCACCCCTCTGCCTGGG + Intronic
1175910389 20:62402582-62402604 CACTGCCCACACTTGGAGCTGGG - Intronic
1176065118 20:63190459-63190481 CATTGCCCACCCCTGTGCCCTGG + Intergenic
1176111122 20:63411289-63411311 CACGGCCCAGACCTGGGCCCTGG - Intronic
1176373536 21:6076439-6076461 CACTGCCCACACCATGACCTTGG + Intergenic
1179630388 21:42674395-42674417 CTCTGCCGAGTCCTGGCCCTTGG + Intronic
1179749941 21:43461804-43461826 CACTGCCCACACCATGACCTTGG - Intergenic
1179818146 21:43921236-43921258 CACTGGACACTCCTGTGCCCTGG + Intronic
1180066834 21:45416515-45416537 CAGTGTGCTCTCCTGGGCCTCGG + Intronic
1180137665 21:45871680-45871702 CACTGCCCTCTCCCCGCCCTTGG + Intronic
1180144537 21:45911988-45912010 CACTGGCTGCTCCTGAGCCTCGG - Intronic
1180833843 22:18919981-18920003 CACTGCCCTATGCGGGGCCTAGG + Intronic
1180853168 22:19031577-19031599 CACTGCGCTCTGATGGGCCTGGG - Intergenic
1180999946 22:19983346-19983368 CTCTGCCCATTCTTGGGCCTGGG + Intronic
1181042156 22:20197278-20197300 CCCTGCTCACTCCTGTGCCTCGG - Intergenic
1182350407 22:29696025-29696047 CACGGCTCACTCCTTGGTCTGGG + Exonic
1182461359 22:30486056-30486078 CACTGCCCCCTGCTGAGCTTCGG + Intergenic
1182509611 22:30809569-30809591 CACTCCCCAGTCCCAGGCCTTGG - Intronic
1183280386 22:36929084-36929106 CACTGCCCACGCTGCGGCCTGGG - Intronic
1183389802 22:37539102-37539124 CACTGCCCACTCTGGGCCCTAGG + Intergenic
1183440342 22:37819277-37819299 GACTTCGCACTCCTGGCCCTTGG - Intergenic
1184676512 22:46045941-46045963 CACAGACCTGTCCTGGGCCTGGG + Intergenic
1185148825 22:49152959-49152981 CACTGTCCTCTCCTGGTCCTTGG - Intergenic
1185208910 22:49555664-49555686 CCCTGCCCACACCTTGACCTCGG + Intronic
1185288911 22:50014479-50014501 CACTGTCCTTCCCTGGGCCTTGG - Intergenic
1203283929 22_KI270734v1_random:145279-145301 CACTGCCCTATGCGGGGCCTAGG + Intergenic
949919646 3:8990759-8990781 CACAGCCCGCCCCGGGGCCTGGG - Exonic
949947880 3:9204396-9204418 CCCCGCTCACTCCTGGGCCTGGG + Intronic
950502080 3:13370991-13371013 GACTGCCCACCTCTGGGCCCTGG + Intronic
950970278 3:17179616-17179638 CACTCACCCTTCCTGGGCCTTGG + Intronic
952798436 3:37264775-37264797 CACAGCTCACTGCTGGGCTTAGG + Intronic
953978368 3:47399751-47399773 CACTTCCCCTTCCTGGGACTTGG + Intronic
954293140 3:49660315-49660337 CCCTGCCCACCCATAGGCCTTGG - Intronic
954300693 3:49699380-49699402 CACCCCCCACCCCGGGGCCTGGG - Intronic
954431991 3:50475784-50475806 CACTGACCCCTCCTGGGCCTGGG + Intronic
955051146 3:55412239-55412261 CACTGCCCCTCTCTGGGCCTTGG + Intergenic
955054320 3:55442419-55442441 CCCTGCTCACTTCTGGGCCAAGG - Intergenic
955225036 3:57053320-57053342 CGCTGCCCACACCTGGGGCAGGG + Intronic
960060785 3:113317910-113317932 CCAGGTCCACTCCTGGGCCTTGG - Intronic
960098340 3:113710041-113710063 CACTGCAAACTCCTGGGCTCAGG + Intergenic
960990277 3:123305717-123305739 CCCTGCTCACCCCTGGGTCTTGG + Intronic
960996760 3:123345282-123345304 CACCGGCCACCCCTGCGCCTCGG - Intronic
961039980 3:123671428-123671450 CACAGCCCTCTCCTGTGTCTCGG - Intronic
961537449 3:127578765-127578787 CACAGCCCACTCCTCTGACTGGG + Intronic
962938635 3:140105518-140105540 GACTGCCCACTCCTAGGACCTGG + Intronic
964443842 3:156739874-156739896 CACTGTCCACTCCTGCCCCAAGG - Intergenic
966154697 3:176903034-176903056 CACTCCCCACCCCTGAGTCTGGG - Intergenic
966595511 3:181721775-181721797 CACTGCCCACTCCTGGTTCTTGG + Intergenic
967778235 3:193406833-193406855 TTCTGCCTTCTCCTGGGCCTTGG - Intronic
967985691 3:195094114-195094136 CACTGGCCTCTCCTGTTCCTAGG + Intronic
968541133 4:1168979-1169001 CACTGCCCACTCTGGTCCCTCGG + Intronic
969080084 4:4611343-4611365 CCCTGCCCTATCCTGGGGCTGGG + Intergenic
969267072 4:6071504-6071526 CCCTGCTCACTCCTGGCGCTGGG + Intronic
969336940 4:6516533-6516555 TACTGCCCACACCTGGGGCAGGG - Intronic
969415065 4:7052608-7052630 CACTGCCCATCTCTGAGCCTCGG - Intronic
969431426 4:7157043-7157065 CCCTGCCCACTCCTTGGCTTTGG + Intergenic
969516916 4:7653041-7653063 CCCTGCCCCTTCCTGGGCCCAGG + Intronic
971302247 4:25451217-25451239 AAATGCACATTCCTGGGCCTCGG - Intergenic
971479569 4:27102255-27102277 CCTTCCCCACTCCTGGACCTGGG + Intergenic
972563690 4:40250807-40250829 CCCTGCCCTCCTCTGGGCCTGGG + Intergenic
973760025 4:54107164-54107186 CACTGCCCAGGCCTGAGCGTGGG + Intronic
974794603 4:66732183-66732205 CACTGCCCACCAGGGGGCCTGGG - Intergenic
976262174 4:83156058-83156080 CCTTGCTCACTCCTGGGCATAGG + Intergenic
976492934 4:85693231-85693253 CCATGTCCACTCCTGGGCCTTGG + Intronic
978471667 4:109074262-109074284 CACTGACCAGTCCTGCTCCTTGG - Intronic
980922771 4:139103388-139103410 CACTCCCAACCTCTGGGCCTCGG + Intronic
980930398 4:139177880-139177902 CAGTTCCCACTCCTCAGCCTTGG + Intergenic
985061822 4:186087863-186087885 CACTCCCCATTCCTGTTCCTAGG - Exonic
985318190 4:188680833-188680855 CACCGCCCCTGCCTGGGCCTGGG - Intergenic
985427116 4:189841728-189841750 CACTGCCTAGTGGTGGGCCTGGG - Intergenic
986328915 5:6703118-6703140 CACTGCAGCCTCCTGAGCCTGGG + Intergenic
988726158 5:33928455-33928477 CCTTGCTCACTCCTGGGCATAGG - Intergenic
992693222 5:79259831-79259853 CTCTGCACTCTCCGGGGCCTGGG - Intronic
993048447 5:82896193-82896215 CCCTTCCTACTCCTGGGCCCAGG - Intergenic
994753318 5:103764748-103764770 CCCTGCCCTCTCAGGGGCCTGGG - Intergenic
996093133 5:119370612-119370634 CACTGGCCCCTCCTGGGCTTGGG + Intronic
997361645 5:133299091-133299113 CACTGCTCACTCTGGGGCCTGGG + Intronic
998093367 5:139383472-139383494 CCCTGCCCACATCTGCGCCTGGG + Intronic
999191289 5:149749331-149749353 CACTTCACATCCCTGGGCCTTGG - Intronic
999284219 5:150384471-150384493 CACTCTCCTCTCCTGGGCTTGGG + Intronic
1001031682 5:168267851-168267873 TTCTCCCCTCTCCTGGGCCTGGG + Intergenic
1001231332 5:169991171-169991193 CACCTTCCATTCCTGGGCCTGGG + Intronic
1001242859 5:170083414-170083436 TCCTGCCCAGTCCTGGGCCCAGG - Intergenic
1001732088 5:173968229-173968251 CACTGCCCAGTGCAGGGGCTAGG + Intergenic
1001785574 5:174409783-174409805 CTCTGCACACTCCTGACCCTTGG + Intergenic
1002570246 5:180136049-180136071 CAGAGCCCTGTCCTGGGCCTTGG - Intronic
1002639408 5:180623627-180623649 CCCTGTCCCCTCCTGGTCCTGGG + Intronic
1002653200 5:180719345-180719367 CCCTGCCCACACCTTGGTCTTGG + Intergenic
1002910803 6:1489567-1489589 CCCTGCTCACACCTGGACCTTGG - Intergenic
1003136147 6:3435960-3435982 CCCTGCCCACACCTGGATCTAGG + Intronic
1004194184 6:13488611-13488633 CAGTGCCCCCTCGAGGGCCTGGG - Intergenic
1004426168 6:15508597-15508619 CCCTGCCGAAGCCTGGGCCTGGG + Intronic
1004604409 6:17180284-17180306 CTCTGCTCATTCCTGGGCATAGG - Intergenic
1004975656 6:20963331-20963353 CTCTGCCCATACCTGGGTCTCGG + Intronic
1006143967 6:31947238-31947260 GAGTGCCCACTCCTCGGGCTGGG - Intronic
1006445579 6:34077947-34077969 CAGTGGCCACTGCTGGGCCCTGG + Intronic
1006670635 6:35727923-35727945 CCCTGCCCACTCACCGGCCTTGG - Intronic
1007109189 6:39303356-39303378 CACTGCCACCTGCTGGGCATCGG + Intronic
1007290178 6:40779804-40779826 CAGTGCCTATTCCTGGTCCTGGG - Intergenic
1007607163 6:43125378-43125400 CAGCACCCACTCCTGGGGCTGGG - Intronic
1007769692 6:44183024-44183046 CAAGGCCCACTCCTGACCCTTGG - Intronic
1012749604 6:103140693-103140715 CACTGCACTCTCCAGGGCCAAGG - Intergenic
1012860708 6:104555986-104556008 CACTGCCAACTTCTGGCTCTTGG + Intergenic
1014897631 6:126922658-126922680 CACTTCCCACTGATGGGGCTGGG - Intergenic
1015857596 6:137641681-137641703 CACTGCCCTCTCCTGGCCTCTGG + Intergenic
1016387573 6:143543475-143543497 TAGTGCCCTGTCCTGGGCCTGGG + Intronic
1016528914 6:145036709-145036731 CACTCCCCTCTGCTGTGCCTTGG + Intergenic
1017561479 6:155633024-155633046 CACTGCCCACACCTCGACGTGGG - Intergenic
1017710411 6:157162744-157162766 CACTGCGCTCGCCTGGGCCAGGG - Intronic
1018738932 6:166712700-166712722 CACAGCCCACCTGTGGGCCTCGG - Intronic
1018801142 6:167223080-167223102 TTCTGCTCACTTCTGGGCCTGGG - Intergenic
1018808990 6:167284106-167284128 TTCTGCTCACTTCTGGGCCTGGG + Intronic
1018823530 6:167392785-167392807 CACTGCTTCCTCCTGGGCTTTGG - Intergenic
1019082230 6:169442675-169442697 ATGTGCCCACTCCTGGGCCAGGG - Intergenic
1019477582 7:1251467-1251489 CCCTGCCCACACCTGGATCTCGG + Intergenic
1019551165 7:1603398-1603420 CCCTGCCCACGCCTTGGTCTCGG + Intergenic
1019700262 7:2471435-2471457 GCCTGCCCGCTCCTGGTCCTGGG - Intergenic
1019709035 7:2510008-2510030 AGCTGCCCACCCCTTGGCCTGGG + Intergenic
1019747678 7:2709655-2709677 CTCTGCCACCTTCTGGGCCTGGG + Exonic
1019751774 7:2735173-2735195 TCCTGCCCTCCCCTGGGCCTCGG + Intronic
1020040270 7:4996296-4996318 CACTCAGCACCCCTGGGCCTTGG - Intronic
1020079944 7:5281967-5281989 CGCTGCCCACCCCTCAGCCTTGG - Intronic
1020946926 7:14622868-14622890 CACTGCACATTTGTGGGCCTTGG + Intronic
1021538668 7:21732942-21732964 CACTGCCCAGGCCTGAGACTGGG - Intronic
1022507960 7:30918516-30918538 CACTGCCCAGTGCTGAGTCTTGG + Intronic
1022509345 7:30925339-30925361 CTCTCCCCACTCCTGGCCCCTGG - Exonic
1023259221 7:38341550-38341572 GACTGCCCCCTCCTAGGGCTGGG - Intergenic
1023260625 7:38354569-38354591 GACTGCCCCCTCCTAGGGCTGGG - Intergenic
1023261606 7:38363713-38363735 GACTGCCCCCTCCTAGGGCTGGG - Intergenic
1023560678 7:41470366-41470388 CACTGCCCGCTCCCGTCCCTTGG + Intergenic
1023904568 7:44513194-44513216 CAGTGCCTCCTCCTGGGCCTGGG - Exonic
1024153931 7:46601038-46601060 CAGTGCTCACTCCTGGACCCTGG - Intergenic
1024457978 7:49630612-49630634 CACTGCCCACCCCCGGGTCTTGG - Intergenic
1024645883 7:51369844-51369866 CCTTGTCCACTCCTGAGCCTTGG - Intergenic
1024962994 7:54996998-54997020 CACTCACCACTCCTGGAGCTGGG - Intergenic
1025198969 7:56950249-56950271 CGCTGCCCACCCCTCAGCCTTGG + Intergenic
1025672977 7:63626684-63626706 CGCTGCCCACCCCTCAGCCTTGG - Intergenic
1025753053 7:64310546-64310568 CACTGACCAGCCCTGTGCCTGGG - Intronic
1027788869 7:82614372-82614394 CTCTGCCCACACCTTGACCTTGG - Intergenic
1028844794 7:95467722-95467744 CACTGCCCACAGGTGGGGCTAGG - Intergenic
1029364251 7:100107001-100107023 CATTGCCCCCTCCTGGTCTTGGG - Exonic
1029569918 7:101362757-101362779 CACTGCCGCCTCCTCGGCCCCGG + Intergenic
1029709654 7:102292759-102292781 CACTGCCCACCCCAGGACATAGG + Intronic
1029714785 7:102319988-102320010 CACTCCCCCTCCCTGGGCCTTGG + Intronic
1030112633 7:106039590-106039612 CAATGCTCACTCCAGGCCCTAGG - Intergenic
1032095885 7:128938347-128938369 CGCTGCCCACTCCGCCGCCTGGG - Intronic
1032266888 7:130375721-130375743 CACTTCACATCCCTGGGCCTTGG - Intergenic
1033436307 7:141336442-141336464 CACTGTCCACTGCATGGCCTTGG + Intronic
1034178085 7:149116079-149116101 CCCTGCTGGCTCCTGGGCCTCGG + Intronic
1034336863 7:150329540-150329562 CACAGCCCACTCTTGGGACAGGG - Intronic
1034396894 7:150833180-150833202 CACTGCCCAGTCCAGTGCCTGGG - Intronic
1034964798 7:155384351-155384373 CCCTGCCCACGCCTGGACTTTGG - Intronic
1034990062 7:155542521-155542543 CACTGCACACCCCTGGGGCTGGG + Intergenic
1035295278 7:157863872-157863894 CTCTGCCCACGCCTCGACCTCGG + Intronic
1035333585 7:158112087-158112109 CCCTGCCCACACCTGGGTCTTGG + Intronic
1035382480 7:158448614-158448636 CAGCTCCCACTCCTGGGCCAAGG + Intronic
1036208058 8:6819598-6819620 CACTGCCCAGACCTGAGTCTGGG - Intronic
1036779299 8:11634668-11634690 CACTGCCCCCACCTGGGCCAAGG + Intergenic
1037156966 8:15713586-15713608 CCCTGCTGACTCCTGGGTCTCGG - Intronic
1037659376 8:20913826-20913848 CACTGCCAACCTCTGGCCCTAGG - Intergenic
1037891757 8:22627411-22627433 CACTGTCCACCCCGGGGCTTTGG - Intronic
1039303145 8:36231847-36231869 CCTTGCTCATTCCTGGGCCTGGG - Intergenic
1039727312 8:40232768-40232790 CATTGCTCATTCCTGGGCATAGG + Intergenic
1039735298 8:40324916-40324938 CTCTGCCCACTGAGGGGCCTTGG - Intergenic
1040498533 8:47987878-47987900 CATTGTTCATTCCTGGGCCTAGG - Intergenic
1042224929 8:66508024-66508046 CAGTCCCCAGTCCTGGGCCTGGG + Intronic
1043379962 8:79691966-79691988 CTGTGCTCATTCCTGGGCCTAGG - Intergenic
1043735107 8:83731340-83731362 CTCTGCGCTCTCCGGGGCCTGGG - Intergenic
1043798739 8:84579281-84579303 CTCTGCCCACTCCTGGTGCCCGG - Intronic
1045402914 8:101836399-101836421 CACTTACCCGTCCTGGGCCTTGG + Intronic
1045972570 8:108095973-108095995 AACCGCCAACTCCTGGGCTTAGG - Intergenic
1047916760 8:129591972-129591994 CACAGCCCACCCCTGGCTCTGGG - Intergenic
1049230202 8:141477924-141477946 CACTGCACACTCCCGCGCCCTGG - Intergenic
1049268731 8:141683076-141683098 CCCTGCCCTCTCCATGGCCTGGG + Intergenic
1049285318 8:141771837-141771859 CCCTGCCAACGCCTGGGTCTGGG - Intergenic
1049521823 8:143095248-143095270 CACTGGCCACCCCTTGGCCCTGG - Intergenic
1049578104 8:143398769-143398791 CAGTACCCACAGCTGGGCCTGGG - Intergenic
1049651835 8:143773383-143773405 CCCACCCCACTCCTGGGCCTGGG - Intergenic
1049709824 8:144058453-144058475 CACTGCCCACTCCTGGGCCTGGG - Intronic
1049850363 8:144827275-144827297 CACCGCCCACTCCGGGCTCTGGG + Intergenic
1051617468 9:19019830-19019852 CAATGACCACTCATGGGTCTTGG + Intronic
1053169992 9:35871728-35871750 CGATGCCAAATCCTGGGCCTGGG + Intergenic
1053200533 9:36148916-36148938 CAACCCCCACTCCTCGGCCTGGG - Intronic
1055101219 9:72467567-72467589 CACTGCCCTTTCCTGGGGTTGGG + Intergenic
1055493014 9:76825506-76825528 CTCTGCCCCCTCCTGCCCCTGGG + Intronic
1057228397 9:93304454-93304476 CACTGAGCAGTCCAGGGCCTTGG + Intronic
1057789108 9:98110966-98110988 CACTGCAACCTCCTGGGCTTAGG - Intronic
1057874575 9:98744060-98744082 CACTGCCCAACTCTGAGCCTGGG + Intronic
1057912549 9:99031274-99031296 CACTACCCAGTTCTTGGCCTAGG - Intronic
1059483139 9:114607733-114607755 CCCTGCCCTGTCCTGGGCCTAGG - Intergenic
1059540686 9:115127332-115127354 CCCTGCCCACTCCTGTCCATGGG - Intergenic
1060422100 9:123476575-123476597 CAATGCCCGTTCCTGGGCCATGG + Intronic
1060774694 9:126364461-126364483 CACTCCCCACTCCAGGGCAGAGG + Intronic
1060811436 9:126613279-126613301 CACTCCCCGTTCCTGGGCCTGGG + Intergenic
1060821419 9:126663795-126663817 CCTTGCCCTCTCCTTGGCCTTGG + Intronic
1061203172 9:129148672-129148694 CACTGCCCCCTCCTGTGTCTGGG + Exonic
1061242604 9:129383275-129383297 CAGTGACCACTGCAGGGCCTGGG + Intergenic
1061315986 9:129796116-129796138 CACTGCAAACTCCTGGGCTCAGG + Intergenic
1061414479 9:130438891-130438913 CACTGCCCAAGCCTGGGCATTGG - Intergenic
1061896255 9:133649785-133649807 CACTGCCCCTTGCAGGGCCTTGG + Intronic
1062042989 9:134412611-134412633 CTCTGCCCACCCCTGGTCCCGGG - Intronic
1062052790 9:134456175-134456197 CTCGGCCCACTGCTGGGCCAGGG + Intergenic
1062235977 9:135507795-135507817 CTCTGCTCACGCCTGGCCCTGGG + Intergenic
1062697735 9:137884101-137884123 CTCTGCCTGCTCCTGAGCCTGGG + Intronic
1185746097 X:2574688-2574710 CCCTGCCCACACCTGGATCTCGG + Intergenic
1186247766 X:7632096-7632118 CCAGGCCCACTCCTGGGCCTTGG - Intergenic
1186371672 X:8953245-8953267 CCCTGCCCACACCTGGATCTCGG - Intergenic
1186493385 X:9992787-9992809 CACTCCCAGCCCCTGGGCCTAGG - Intergenic
1186499745 X:10041767-10041789 GACTGCCCACCTCTGTGCCTTGG + Intronic
1186733421 X:12434705-12434727 CAGGGCCCACTCCTGGTGCTGGG + Intronic
1187484447 X:19688948-19688970 CACTGTCAGCTTCTGGGCCTTGG + Intronic
1188860022 X:35244771-35244793 CACTCCTGACTGCTGGGCCTGGG - Intergenic
1189059612 X:37738606-37738628 AACTGCCCAGTCCAGGCCCTTGG - Intronic
1189705526 X:43755651-43755673 CAATGCCCTCTCCTGGGACAGGG + Intergenic
1189989123 X:46577993-46578015 CACTGCCAAATCCTGGCCATTGG - Intronic
1190248404 X:48705588-48705610 CACTGCGCAGCCCTGGGCCGAGG + Intronic
1191902572 X:66055041-66055063 GCCTGCCCACCCCTGGGACTGGG + Intergenic
1192694217 X:73398036-73398058 CTAGGTCCACTCCTGGGCCTTGG + Intergenic
1193649124 X:84109064-84109086 CACTTGCCACTCCTGGGCCAAGG + Intronic
1195093393 X:101485124-101485146 CCCTACCCACTCCCGGCCCTTGG - Intronic
1198210578 X:134512225-134512247 CCCTACCCACTTCAGGGCCTTGG - Intronic
1198277714 X:135112408-135112430 CCAAGTCCACTCCTGGGCCTTGG + Intergenic
1198311033 X:135425833-135425855 CCCTGCCAACTCCTGGCCATGGG - Intergenic
1198586523 X:138128349-138128371 CCAGGTCCACTCCTGGGCCTTGG + Intergenic
1199419792 X:147631737-147631759 CACTGCCAACACCTTGGTCTCGG - Intergenic
1199777997 X:151032605-151032627 CCCTGCCCACACCTTGGTCTTGG - Intergenic