ID: 1049710026

View in Genome Browser
Species Human (GRCh38)
Location 8:144059283-144059305
Sequence GGAAGAAGCTGCCTTCGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 215}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049710026_1049710035 1 Left 1049710026 8:144059283-144059305 CCCCCACGAAGGCAGCTTCTTCC 0: 1
1: 0
2: 0
3: 13
4: 215
Right 1049710035 8:144059307-144059329 GAAACGCAGCAGTAGGTGCGGGG No data
1049710026_1049710031 -6 Left 1049710026 8:144059283-144059305 CCCCCACGAAGGCAGCTTCTTCC 0: 1
1: 0
2: 0
3: 13
4: 215
Right 1049710031 8:144059300-144059322 TCTTCCGGAAACGCAGCAGTAGG No data
1049710026_1049710038 28 Left 1049710026 8:144059283-144059305 CCCCCACGAAGGCAGCTTCTTCC 0: 1
1: 0
2: 0
3: 13
4: 215
Right 1049710038 8:144059334-144059356 ACCCCTCCTCTGCCTGAACAGGG No data
1049710026_1049710037 27 Left 1049710026 8:144059283-144059305 CCCCCACGAAGGCAGCTTCTTCC 0: 1
1: 0
2: 0
3: 13
4: 215
Right 1049710037 8:144059333-144059355 CACCCCTCCTCTGCCTGAACAGG No data
1049710026_1049710033 -1 Left 1049710026 8:144059283-144059305 CCCCCACGAAGGCAGCTTCTTCC 0: 1
1: 0
2: 0
3: 13
4: 215
Right 1049710033 8:144059305-144059327 CGGAAACGCAGCAGTAGGTGCGG No data
1049710026_1049710034 0 Left 1049710026 8:144059283-144059305 CCCCCACGAAGGCAGCTTCTTCC 0: 1
1: 0
2: 0
3: 13
4: 215
Right 1049710034 8:144059306-144059328 GGAAACGCAGCAGTAGGTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049710026 Original CRISPR GGAAGAAGCTGCCTTCGTGG GGG (reversed) Intronic
900191685 1:1354769-1354791 GGAAGACGCGGCGTTCGTGCAGG + Exonic
900981007 1:6046169-6046191 GGACTCACCTGCCTTCGTGGGGG - Exonic
902396704 1:16135800-16135822 GTAAGAAGCTGCCTACGAGCAGG + Intronic
903212186 1:21824474-21824496 GCAGGAAGCTGGCTTCCTGGTGG - Exonic
906319728 1:44808548-44808570 GGAAGAAGCTGGCTGGCTGGCGG - Exonic
907318431 1:53587536-53587558 GAAACAAGCTCCCTTCCTGGAGG - Intronic
907329199 1:53660306-53660328 GGAAGGAGCTGCTTTCTGGGTGG + Intronic
907390541 1:54155276-54155298 GGCAGAAGCTGCCTGCATGATGG + Intronic
910251067 1:85200456-85200478 GGAAGGAGGGGCCTTCCTGGCGG + Exonic
910507513 1:87966840-87966862 GGAAGAAGATCCCTTCTTGCAGG - Intergenic
910925321 1:92392183-92392205 GGAAGAAGCTGACTTGATCGTGG - Exonic
911508947 1:98787861-98787883 GGATGAAGCTGCCTTGATCGTGG - Intergenic
912315257 1:108661894-108661916 GGACGAAGCTGCCTTCTTTAGGG + Intergenic
913020700 1:114786664-114786686 GGATGAAGCTGACTTGGTTGTGG + Intergenic
913720025 1:121583504-121583526 GGATGAAGCTGGCTTGATGGTGG + Intergenic
915077005 1:153316599-153316621 GGATGAAGCCGACTTCGTTGTGG + Intergenic
915722809 1:157996438-157996460 GGAGGGAGCTGCCTCCGTGGGGG + Intronic
917768236 1:178246908-178246930 GGATGAAGCTGCCTTGATTGTGG + Intronic
919599340 1:199603315-199603337 GGATGAAGCTGACTTGATGGTGG - Intergenic
922175368 1:223193269-223193291 GGAAGAATCTGTCTGGGTGGAGG + Intergenic
923087743 1:230714101-230714123 GGAAGAAGCTGCCGTTGTTCTGG - Exonic
1063052417 10:2467354-2467376 GGATACAGCTGCCTTTGTGGTGG - Intergenic
1063355296 10:5393576-5393598 GGAAGAAGCAGAGTTCTTGGAGG - Exonic
1064938797 10:20709915-20709937 GGAAGAAGTTGCCTTTGTTGAGG - Intergenic
1066755556 10:38708651-38708673 GGATGAAGCTGACTTCATAGTGG - Intergenic
1070667961 10:78358737-78358759 GGAAGAAGCTGGGTTCAGGGTGG - Intergenic
1073933933 10:108607726-108607748 GGATGAAGCTGACTTGGTCGTGG + Intergenic
1074599493 10:114899489-114899511 GGCAGACGTTGCCTTCATGGTGG + Intronic
1075009794 10:118857808-118857830 GGCAGAAGCTGCCTTCTTTGAGG + Intergenic
1075070803 10:119318867-119318889 AGAAGAGGCTGTCTTGGTGGGGG - Intronic
1075292005 10:121238694-121238716 GGAAGAAGCTAACATCCTGGGGG - Intergenic
1076124737 10:127964934-127964956 GGAAGAAGCTGTCTCCATGAAGG + Intronic
1077009027 11:371910-371932 AGAAGAAGTTGCCTTGCTGGGGG + Intronic
1079300189 11:19271649-19271671 GGATGAAGCTGACTTGGTCGTGG - Intergenic
1079325009 11:19484347-19484369 GGAACAAGCTCCCTTGGAGGAGG - Intronic
1082115547 11:48324464-48324486 GGAAGAAACTGACTTGGTTGTGG - Intergenic
1083510576 11:63205948-63205970 GGATGAAGCTGACTTGATGGTGG - Intronic
1083518688 11:63286006-63286028 GGATGAAGCTGACTTCGTAGTGG - Intronic
1083758024 11:64801836-64801858 GGAAGAAGCAGCCTGAGTGGGGG - Intronic
1084558310 11:69888589-69888611 GGCAGAAGATGCCTTCTTGTAGG - Intergenic
1089400400 11:118161091-118161113 AGAACAAGCTGCCTTGGTGGGGG - Intergenic
1091114423 11:132999906-132999928 GAAACAAGCTGCCTTTGAGGGGG - Intronic
1091726187 12:2848289-2848311 GGAAGAAGCTGAAATGGTGGGGG - Intronic
1093618254 12:21254579-21254601 GGATGAAGCTGACTTGGTCGTGG + Intergenic
1093710084 12:22320415-22320437 GGAAGGAGCTGCCTTGGGAGTGG + Intronic
1095952270 12:47788068-47788090 GGAAGAAGTTGCCGTCGTCATGG + Exonic
1096114727 12:49049175-49049197 GGAAGACGCCGGCCTCGTGGAGG - Exonic
1096139960 12:49234643-49234665 GGCGGAAGTGGCCTTCGTGGCGG - Intronic
1098452024 12:70630218-70630240 GGATGAAGCTGACTTGGTTGTGG - Intronic
1104048801 12:125183152-125183174 GGCAGCAGCTGCCTGCGTGTTGG + Intergenic
1109126055 13:58518462-58518484 GGAAGAAGCTGCACATGTGGTGG + Intergenic
1109541001 13:63778769-63778791 GGATGAAGCTGACTTGGTTGTGG + Intergenic
1109607900 13:64721699-64721721 GGATGAAGCTGACTTCATCGTGG - Intergenic
1109771355 13:66977762-66977784 GGTAGAAGCTGGGTTCCTGGTGG - Intronic
1113923551 13:113928206-113928228 CCAAGAAGCTCCCATCGTGGAGG + Intergenic
1114342913 14:21763855-21763877 GGATGAAGCTGACTTGGTCGTGG - Intergenic
1114487292 14:23070464-23070486 GGGGGAAGCTGCCTGTGTGGGGG - Intronic
1115048345 14:29025718-29025740 GGAAGAAGCTGTCTTTATCGTGG + Intergenic
1115396481 14:32914809-32914831 GAAAGAAGCAGCCTTCATGGAGG - Intergenic
1115894699 14:38073296-38073318 GGGAGGAGCTGCTTTCATGGTGG - Intergenic
1120419969 14:84272298-84272320 GGAAGAAACTGCCTAATTGGAGG + Intergenic
1120877860 14:89391516-89391538 GGAAGAAGCAGCCTTTGTTTGGG - Intronic
1121589916 14:95096344-95096366 TGAAGAAGATGACTTTGTGGTGG - Exonic
1122411135 14:101526784-101526806 GGAAGGAGCTGCCTCCATGCTGG + Intergenic
1122921628 14:104882719-104882741 GTAAGAGGCTGCCTCTGTGGAGG - Exonic
1125469101 15:39985193-39985215 GGATGAAGCTGACTTGGTCGTGG + Intronic
1127153867 15:56108350-56108372 GGATGAAGCTGACTTGATGGTGG - Intronic
1128514790 15:68335488-68335510 GGAAGCAGCTGGCATCCTGGAGG + Intronic
1128889433 15:71317693-71317715 GGAAGAGGCTGCCTGTGTAGGGG + Intronic
1130769179 15:86907126-86907148 GGATGAACCTGCCTGCTTGGAGG + Intronic
1131048510 15:89331620-89331642 GGAAGAAGCTGCCCTGTGGGAGG + Intronic
1131059092 15:89393432-89393454 GGAAGACGCTGCCTGCCTTGAGG - Intergenic
1131090661 15:89622648-89622670 GGAAGACCCTGCCTGCCTGGGGG - Intronic
1131520049 15:93107578-93107600 AGGAGAAGCTGCCTTGGTGCAGG + Intergenic
1131569980 15:93524760-93524782 GGAAGAGGCTAACTTCATGGAGG - Intergenic
1132393760 15:101457514-101457536 GGATGCAGCTCCCTTTGTGGGGG + Intronic
1132633225 16:929803-929825 GGATGAAGCTGCGTTCGTCAGGG - Intronic
1133036265 16:3035983-3036005 GGAAGGAGCTGGATTCCTGGGGG - Intronic
1134257877 16:12626507-12626529 GGAAGAAGCCCCCTTTTTGGGGG - Intergenic
1134772194 16:16818922-16818944 GGAAGAACCTGGCTGCCTGGTGG - Intergenic
1137779129 16:51082372-51082394 GGAAGAAGCTGTTTTCTTGAAGG - Intergenic
1138229861 16:55328950-55328972 GGAAGAAGCTGACTTCCTCTCGG + Exonic
1138626157 16:58253628-58253650 GAAAGAAACTGCATCCGTGGGGG - Intronic
1141741193 16:85894216-85894238 GGAAGAAGATGCCTCTGTTGAGG - Intergenic
1142173708 16:88635436-88635458 GGAGGAGGGTGCCTTCGTGCAGG - Intergenic
1143085921 17:4416103-4416125 GGAGGCAGATGCCTTCTTGGGGG + Intergenic
1145836082 17:27955255-27955277 GCAAGAAGGTGCCTGCATGGTGG - Intergenic
1145941975 17:28747381-28747403 GGAACAGGCTACCTTTGTGGAGG - Intronic
1146459332 17:33033333-33033355 GGCAGGATCTGCCTTCCTGGGGG + Intronic
1147814638 17:43200231-43200253 GGAAGAAGCTGTCATGGAGGAGG + Exonic
1148021984 17:44559313-44559335 GCAAGACGCTGCACTCGTGGAGG + Exonic
1148961310 17:51395630-51395652 TGAAGAATCTGTTTTCGTGGAGG + Intergenic
1151908651 17:77066607-77066629 GGAAGAAGGTGCCCTTGGGGAGG - Intergenic
1152883214 17:82832191-82832213 GGAAGAGGCTGGCTTCGCCGTGG + Exonic
1153163746 18:2238627-2238649 GGGAGACGCAGCCTTCTTGGGGG + Intergenic
1153775897 18:8453670-8453692 GGAAGAAGCTGCCTCTTAGGAGG + Intergenic
1154286504 18:13062216-13062238 GTTAAAAGCTGCCTTCTTGGAGG + Intronic
1157430329 18:47619470-47619492 GGAAGAAGCTGCCCAGGGGGAGG - Intergenic
1160025261 18:75211106-75211128 GGAAGAAGCGGCGATCCTGGCGG + Exonic
1160239178 18:77110909-77110931 AGAAAAAGATGCCTTCATGGTGG - Intronic
1160410154 18:78670300-78670322 TGGAGAAGCTGCGTTCCTGGAGG - Intergenic
1160597055 18:79982987-79983009 AGAAAAAGCTGCCTTTGTTGAGG - Intronic
1162525408 19:11203588-11203610 GGAAGAAGCGGGATTCGGGGGGG + Intronic
1165949832 19:39468075-39468097 GGAAGGAGCCTCCTTCATGGAGG - Intronic
1166701728 19:44886072-44886094 GGGAGAAGCTGGCTGGGTGGTGG + Intronic
925432911 2:3811921-3811943 GGAGGAAGCTGACTTCATTGTGG + Intronic
930203059 2:48562865-48562887 GGAGGAAGCTCCCTTAATGGGGG - Intronic
932708840 2:74047513-74047535 GGAAGAGGCTGCGCTTGTGGTGG - Exonic
938567767 2:132535406-132535428 GGATGAAGCTGACTTCATGGTGG + Intronic
940025462 2:149202380-149202402 GGAAGAAGCTTGCCTCATGGGGG - Intronic
943270544 2:185796925-185796947 GTAAGAAACTGCCTTCAGGGAGG - Exonic
944018933 2:195077465-195077487 GGATGAAGCTGACTTGGTCGTGG - Intergenic
945042747 2:205755656-205755678 GGAAGCAGCTGGCTTGGTTGGGG + Intronic
948145742 2:235707188-235707210 GGAAGAAGATGCCTGGGAGGCGG - Intronic
948983813 2:241508317-241508339 GGAGGAAGCTGCCTTGGAAGAGG - Intronic
949010188 2:241673945-241673967 GGATGTGGCTGCCTGCGTGGCGG + Intergenic
1168818370 20:756443-756465 GGCAGAAGGTGCCTTCCAGGAGG - Intergenic
1170647145 20:18207656-18207678 GGTAGAAGCTGACTCCGTGTTGG + Intergenic
1171107118 20:22445118-22445140 GGAAGAATCTGCCATTCTGGAGG + Intergenic
1175192443 20:57220574-57220596 GGAAGAATGGGCTTTCGTGGAGG - Intronic
1175285316 20:57833649-57833671 GGGAGAAGGAGCCCTCGTGGGGG + Intergenic
1175760204 20:61557303-61557325 GGAAGAGGCTGCCCTCCTGCAGG + Intronic
1175894005 20:62328082-62328104 GGAGGATGCTGCCTGGGTGGGGG - Intronic
1176681112 21:9819840-9819862 GGACACAGCCGCCTTCGTGGCGG - Intergenic
1177092244 21:16783581-16783603 GGATGAAGCTGACTTGGTTGTGG - Intergenic
1178579873 21:33829335-33829357 GCAAGGAGCGGACTTCGTGGAGG + Intronic
1180222282 21:46366626-46366648 GGAACAAGATGCCTTCCTGCAGG + Exonic
1184646131 22:45896473-45896495 GGAAGCAGCTGCCCTCCTTGTGG - Intergenic
1185385912 22:50531284-50531306 GGAAGTACCTGCCTGCGGGGCGG + Exonic
949440506 3:4075142-4075164 GGATGAAGCCGACTTGGTGGTGG - Intronic
949456068 3:4240109-4240131 GGATGAAGCTGACTTGATGGTGG + Intronic
949921727 3:9008387-9008409 CGAAGCACCTGCCTTCCTGGGGG - Intronic
950106732 3:10393282-10393304 GGGAGAAGGTGCCTGAGTGGAGG + Intronic
950677218 3:14561593-14561615 GGAAAAAGCAGCATTGGTGGAGG - Intergenic
951676101 3:25243650-25243672 GGATGAAGCTGACTTGGTCGTGG + Intronic
951702774 3:25512645-25512667 GGAAGAAGGTGGCTTCAAGGAGG - Intronic
952766626 3:36959934-36959956 GGAAGATTCGGCCTTCATGGTGG + Intergenic
953660923 3:44890994-44891016 TACAGAGGCTGCCTTCGTGGGGG + Intronic
955657473 3:61260157-61260179 GGATGAAGCTGACTTCATCGTGG + Intergenic
961389187 3:126542365-126542387 GGAGGACGCGGCCTTCGTGCTGG + Exonic
961493195 3:127270756-127270778 GTGAGAAGCTGCCTTGGCGGTGG + Intergenic
961808012 3:129502973-129502995 GAGAGAAGCTGCCCTCGTGATGG + Intronic
965097937 3:164258180-164258202 GGAAGAAGCTGACTTGATCGTGG - Intergenic
965909910 3:173761316-173761338 GAAAGAAGCTGTCTCCCTGGAGG + Intronic
967048790 3:185762722-185762744 GGAAGAAGCAGCCTTCAAGAGGG + Intronic
968189949 3:196660378-196660400 GGGAGAGGCTGCCTTCGAGCTGG + Exonic
968503815 4:962969-962991 GGAAGAGGCAGCCTGGGTGGGGG - Intronic
969719873 4:8887741-8887763 TGAAGAAGCTCCCCTCCTGGTGG - Intergenic
969877850 4:10149183-10149205 TGAGGAGGCTGCCTTGGTGGTGG + Intergenic
970318772 4:14855284-14855306 AGAAGGAGGTGCCTTCATGGGGG - Intergenic
972381807 4:38526393-38526415 GGTAGAAGCTGCCTGACTGGTGG - Intergenic
973251153 4:48061613-48061635 GGATGAAGCTGACTTGGTCGTGG - Intergenic
973299050 4:48559602-48559624 GGAAGATGATGGCTTTGTGGGGG + Intronic
974647614 4:64715195-64715217 GGAAGGAGCTGCCTGTTTGGGGG + Intergenic
976669858 4:87640065-87640087 GGATGAAGCTGACTTGGTCGTGG - Intergenic
977560928 4:98533030-98533052 GGATGAAGCTGACTTCATCGTGG + Intronic
979529390 4:121752840-121752862 GGATGAAGCTGCCTTCATCATGG - Intergenic
984846798 4:184115266-184115288 GGAAGCAACTGTCTTCCTGGGGG - Intronic
985333009 4:188861288-188861310 GGATGAAGCTGACTTGATGGTGG + Intergenic
985749636 5:1667037-1667059 GGAAGGTGCTGCCTTCTAGGAGG - Intergenic
986391048 5:7288641-7288663 AGAAGAAGCTGCTTGGGTGGTGG - Intergenic
986723315 5:10576086-10576108 GGAAGATGCTACCTTTGGGGAGG + Intronic
986735348 5:10663716-10663738 GGACAGAGCTGCCTTCCTGGGGG + Intergenic
989582104 5:43042743-43042765 TGAAGAAGTTGCCCACGTGGCGG + Intronic
989734859 5:44691160-44691182 GAAAGAAGTTGCCTTTGTTGGGG + Intergenic
989826831 5:45866592-45866614 GGAAGGGGCTGCCTGGGTGGGGG - Intergenic
991393938 5:66183864-66183886 GCAAGAAGCTGAATTTGTGGCGG - Intergenic
991562595 5:67970259-67970281 GCAGGAAGCTGCCTTCGTCTTGG - Intergenic
991976448 5:72187950-72187972 GAAAGGAGCTGCCTGCCTGGGGG - Intronic
992078229 5:73210861-73210883 GGATGAAGCTGACTTGATGGTGG - Intergenic
993541954 5:89162870-89162892 GGATGAAGCTGACTTGATGGTGG - Intergenic
994004727 5:94824385-94824407 GGATGAAGCTGACTTGGTAGTGG + Intronic
994216958 5:97148429-97148451 GGAAGAAGTTGACTTCGCAGAGG + Intronic
996171306 5:120294841-120294863 GGAGGAATCTGACTTTGTGGAGG - Intergenic
996433049 5:123402198-123402220 GGCAGCAGCTGCTTTCGGGGTGG - Intronic
996529446 5:124512304-124512326 AGCAGAAGCTGCCATCATGGAGG + Intergenic
996668589 5:126089751-126089773 GGATGAAGCTGACTTCATTGTGG - Intergenic
996894177 5:128459605-128459627 GGACGAAGCTGACTTGATGGTGG - Intronic
997070031 5:130610809-130610831 GGATGAAGCTGACTTGGTTGTGG - Intergenic
997258696 5:132448918-132448940 GGAAGAAGCTTCCCAGGTGGAGG - Intronic
997283906 5:132664941-132664963 GGAAGGTGCTGCCTTCTTGGGGG + Intergenic
999374414 5:151076769-151076791 GGAAGGGGCTGCCTACGAGGTGG + Intronic
1000020559 5:157315073-157315095 GGAAAAATTTGCCTTCGTTGAGG + Exonic
1003682662 6:8271445-8271467 AGATCAAGCTGTCTTCGTGGTGG + Intergenic
1004904033 6:20219756-20219778 GGTAGAAGGTGCCTTCTTTGAGG - Intergenic
1008493236 6:52107309-52107331 GGGAGAAGCTGGCTTCCTGGAGG - Intergenic
1014013625 6:116504681-116504703 GGATGAAGCTGACTTGATGGTGG - Intronic
1014539426 6:122655623-122655645 TGAAGACACTGCCTTCATGGAGG + Intronic
1015651695 6:135469159-135469181 GGATGAAGCTGACTTGATGGTGG - Intronic
1017988958 6:159469807-159469829 GGTCCAAGCTGCCTTGGTGGTGG - Intergenic
1019744101 7:2689863-2689885 GGAGGGAGCCGCCTTAGTGGGGG - Intronic
1023367441 7:39477660-39477682 GGATGAAGCCGACTTCATGGTGG - Intronic
1027596299 7:80178093-80178115 GGAAGAAGCTGCAGATGTGGTGG + Intronic
1035308906 7:157952499-157952521 GGGAGACGCTGACTCCGTGGTGG + Intronic
1038266591 8:26043351-26043373 GGAAGGAGCAGACTTAGTGGGGG - Intronic
1038548069 8:28441386-28441408 GGAAGGAGCTGTCTTCTTGAGGG - Intronic
1039901905 8:41758686-41758708 GGAAGAATCAGCCTTTGAGGGGG + Intronic
1041267733 8:56081569-56081591 GGAAGGAGCTGCCATGTTGGAGG + Intergenic
1045670413 8:104545124-104545146 GGAAGAAACTGCAGACGTGGTGG + Intronic
1046001123 8:108421765-108421787 GGGAGAAGCTGGCTTAGAGGAGG + Intronic
1046358663 8:113121492-113121514 GGGAGAAGCTCCCTTGGTGTAGG - Intronic
1048389386 8:133947299-133947321 GGATGTGGCTGCCTTGGTGGAGG - Intergenic
1048997782 8:139804803-139804825 GGAGAGAGCTGCCTTGGTGGTGG - Intronic
1049324827 8:142016434-142016456 GGACGGAGCTGCCTGCCTGGAGG - Intergenic
1049710026 8:144059283-144059305 GGAAGAAGCTGCCTTCGTGGGGG - Intronic
1049820424 8:144629985-144630007 GTAAGAAGTTGCCCTTGTGGTGG - Intergenic
1052828669 9:33197040-33197062 TGGAGAAGCTGCCTTCATAGAGG - Intergenic
1052904032 9:33817910-33817932 TGAAGTAGCCGCCTTCGTAGAGG - Exonic
1053729729 9:41041280-41041302 GGAAGAAGCAGCATTTCTGGTGG + Intergenic
1054698776 9:68390782-68390804 GGAAGAAGCAGCATTTCTGGTGG - Intronic
1055284774 9:74716749-74716771 GGCAGAAGGTGCCTTCCTGTGGG - Intergenic
1057023419 9:91718448-91718470 GGAAGTAGCTGCCATCCTGGGGG + Intronic
1057985060 9:99704713-99704735 AGAAGAAGGTGCCTTCTTGGAGG - Intergenic
1061118707 9:128630096-128630118 GGAAGCTGCTGCCTTGGTGTGGG - Intronic
1061724616 9:132575292-132575314 GGAAGAACCAGGCTTGGTGGGGG - Intergenic
1062204614 9:135329173-135329195 GGAGGAAGCTGACTTCCTGCAGG - Intergenic
1062236954 9:135514935-135514957 GGCAGCAGCTGCCTGAGTGGCGG + Intergenic
1185612897 X:1402793-1402815 GGAAGAGGCTGCATTTGGGGAGG - Intergenic
1186505924 X:10092138-10092160 GCAAAAAGCTGCCTCCATGGTGG + Intronic
1187298571 X:18026509-18026531 GGAAGAAGCTATCTTCGTCACGG - Intergenic
1187454725 X:19431131-19431153 GGAAGATGATGCCCTGGTGGTGG + Intronic
1187839589 X:23473292-23473314 GGATGAAGCTGACTTCGTCGTGG + Intergenic
1190977453 X:55420018-55420040 GGAAGAAGCTGACTTGATTGTGG - Intergenic
1191186398 X:57617527-57617549 GGATGAAGGTGACTTCATGGTGG - Intergenic
1192716774 X:73650988-73651010 GGATGAAGCTGCCTTGATCGTGG - Intronic
1194420260 X:93664258-93664280 GGATGAAGCTGACTTGATGGTGG - Intergenic
1196516151 X:116614568-116614590 GGATGAAGCTGACTTGATGGTGG - Intergenic
1201409454 Y:13684241-13684263 GGATGAAGCTGACTTGATGGTGG - Intergenic
1201961166 Y:19682154-19682176 GGAAGACACTGACTTCCTGGTGG + Intergenic