ID: 1049710528

View in Genome Browser
Species Human (GRCh38)
Location 8:144061002-144061024
Sequence GACGTCCTTCCCCGTGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049710518_1049710528 6 Left 1049710518 8:144060973-144060995 CCAGGCCACAACAGGGCTTCCCA 0: 1
1: 0
2: 1
3: 19
4: 308
Right 1049710528 8:144061002-144061024 GACGTCCTTCCCCGTGGAGGGGG No data
1049710520_1049710528 1 Left 1049710520 8:144060978-144061000 CCACAACAGGGCTTCCCACTGGC 0: 1
1: 0
2: 0
3: 13
4: 147
Right 1049710528 8:144061002-144061024 GACGTCCTTCCCCGTGGAGGGGG No data
1049710517_1049710528 7 Left 1049710517 8:144060972-144060994 CCCAGGCCACAACAGGGCTTCCC 0: 1
1: 0
2: 0
3: 20
4: 177
Right 1049710528 8:144061002-144061024 GACGTCCTTCCCCGTGGAGGGGG No data
1049710513_1049710528 29 Left 1049710513 8:144060950-144060972 CCTGGGCAAGGGGAGCTGGCAGC 0: 1
1: 0
2: 4
3: 46
4: 399
Right 1049710528 8:144061002-144061024 GACGTCCTTCCCCGTGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049710528 Original CRISPR GACGTCCTTCCCCGTGGAGG GGG Intronic
No off target data available for this crispr