ID: 1049711126

View in Genome Browser
Species Human (GRCh38)
Location 8:144063838-144063860
Sequence GCGGCTGGTGCAGCTCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049711126_1049711133 25 Left 1049711126 8:144063838-144063860 CCTGGATGAGCTGCACCAGCCGC No data
Right 1049711133 8:144063886-144063908 GCCGCTGGATCTCCTGCCGCAGG No data
1049711126_1049711130 10 Left 1049711126 8:144063838-144063860 CCTGGATGAGCTGCACCAGCCGC No data
Right 1049711130 8:144063871-144063893 CGTTCTCCTGTGCCAGCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049711126 Original CRISPR GCGGCTGGTGCAGCTCATCC AGG (reversed) Intergenic
No off target data available for this crispr