ID: 1049711130

View in Genome Browser
Species Human (GRCh38)
Location 8:144063871-144063893
Sequence CGTTCTCCTGTGCCAGCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049711125_1049711130 19 Left 1049711125 8:144063829-144063851 CCTGGTTCTCCTGGATGAGCTGC 0: 1
1: 0
2: 1
3: 42
4: 253
Right 1049711130 8:144063871-144063893 CGTTCTCCTGTGCCAGCCGCTGG No data
1049711128_1049711130 -9 Left 1049711128 8:144063857-144063879 CCGCCGCAGCTCTTCGTTCTCCT No data
Right 1049711130 8:144063871-144063893 CGTTCTCCTGTGCCAGCCGCTGG No data
1049711127_1049711130 -5 Left 1049711127 8:144063853-144063875 CCAGCCGCCGCAGCTCTTCGTTC No data
Right 1049711130 8:144063871-144063893 CGTTCTCCTGTGCCAGCCGCTGG No data
1049711126_1049711130 10 Left 1049711126 8:144063838-144063860 CCTGGATGAGCTGCACCAGCCGC No data
Right 1049711130 8:144063871-144063893 CGTTCTCCTGTGCCAGCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049711130 Original CRISPR CGTTCTCCTGTGCCAGCCGC TGG Intergenic
No off target data available for this crispr