ID: 1049711133

View in Genome Browser
Species Human (GRCh38)
Location 8:144063886-144063908
Sequence GCCGCTGGATCTCCTGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049711126_1049711133 25 Left 1049711126 8:144063838-144063860 CCTGGATGAGCTGCACCAGCCGC No data
Right 1049711133 8:144063886-144063908 GCCGCTGGATCTCCTGCCGCAGG No data
1049711129_1049711133 3 Left 1049711129 8:144063860-144063882 CCGCAGCTCTTCGTTCTCCTGTG No data
Right 1049711133 8:144063886-144063908 GCCGCTGGATCTCCTGCCGCAGG No data
1049711128_1049711133 6 Left 1049711128 8:144063857-144063879 CCGCCGCAGCTCTTCGTTCTCCT No data
Right 1049711133 8:144063886-144063908 GCCGCTGGATCTCCTGCCGCAGG No data
1049711127_1049711133 10 Left 1049711127 8:144063853-144063875 CCAGCCGCCGCAGCTCTTCGTTC No data
Right 1049711133 8:144063886-144063908 GCCGCTGGATCTCCTGCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049711133 Original CRISPR GCCGCTGGATCTCCTGCCGC AGG Intergenic
No off target data available for this crispr