ID: 1049713436

View in Genome Browser
Species Human (GRCh38)
Location 8:144078094-144078116
Sequence CTGCATCCTCAAAGGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049713432_1049713436 1 Left 1049713432 8:144078070-144078092 CCTCTCTGGAAAGGATGAGGAAA No data
Right 1049713436 8:144078094-144078116 CTGCATCCTCAAAGGGAAAAGGG No data
1049713431_1049713436 2 Left 1049713431 8:144078069-144078091 CCCTCTCTGGAAAGGATGAGGAA No data
Right 1049713436 8:144078094-144078116 CTGCATCCTCAAAGGGAAAAGGG No data
1049713430_1049713436 3 Left 1049713430 8:144078068-144078090 CCCCTCTCTGGAAAGGATGAGGA No data
Right 1049713436 8:144078094-144078116 CTGCATCCTCAAAGGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049713436 Original CRISPR CTGCATCCTCAAAGGGAAAA GGG Intergenic
No off target data available for this crispr