ID: 1049717572

View in Genome Browser
Species Human (GRCh38)
Location 8:144100153-144100175
Sequence CCCTGGCATGGACTGAGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 290}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049717572_1049717582 23 Left 1049717572 8:144100153-144100175 CCTCACCTCAGTCCATGCCAGGG 0: 1
1: 0
2: 1
3: 31
4: 290
Right 1049717582 8:144100199-144100221 GCCACACCTTCTCCCAGCCTTGG 0: 1
1: 1
2: 1
3: 54
4: 371
1049717572_1049717585 29 Left 1049717572 8:144100153-144100175 CCTCACCTCAGTCCATGCCAGGG 0: 1
1: 0
2: 1
3: 31
4: 290
Right 1049717585 8:144100205-144100227 CCTTCTCCCAGCCTTGGCTCTGG 0: 1
1: 0
2: 5
3: 49
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049717572 Original CRISPR CCCTGGCATGGACTGAGGTG AGG (reversed) Intronic
900116800 1:1032550-1032572 CTCTGGGGTGGACTGAGGTGAGG + Intronic
900122696 1:1055621-1055643 CCCTCGCAGGGCCTGGGGTGTGG - Exonic
900955079 1:5881777-5881799 GCCTGGCTTGGACTGAGATCCGG - Intronic
901658737 1:10785665-10785687 CCCTGACATGGATGGAGCTGAGG - Intronic
902784643 1:18725237-18725259 CTCTGGCAGGGACTGAGCGGTGG - Intronic
903557992 1:24206922-24206944 CCCTGGGAGGGAGGGAGGTGAGG + Intergenic
904613688 1:31738680-31738702 CCATGGCATGGGCAGTGGTGGGG - Intronic
905416719 1:37808744-37808766 CCCTGGGCTGGGCTGGGGTGGGG + Intronic
905656834 1:39691109-39691131 CATGGGCCTGGACTGAGGTGGGG + Intronic
906506018 1:46380185-46380207 CCCTGGCACCCTCTGAGGTGGGG - Intergenic
906742149 1:48192986-48193008 CCCTGTCCTGGAGGGAGGTGGGG + Intergenic
907870240 1:58436513-58436535 CCATGGCATGGAGTGAGAGGTGG - Intronic
908473737 1:64469882-64469904 CCCTGGCGCGGACGGAGGCGGGG + Intergenic
910445399 1:87294698-87294720 ACCAGGCAGGGACTGTGGTGGGG + Intergenic
911983767 1:104597646-104597668 GCCTGGCAGGGACTGACCTGAGG - Intergenic
912273604 1:108234019-108234041 CACAGGCATGGTCTGAGATGAGG + Intronic
912294616 1:108460303-108460325 CACAGGCATGGTCTGAGATGAGG - Intronic
912431574 1:109630867-109630889 CCCTGGGATGGCTTGGGGTGGGG + Intronic
913989405 1:143596592-143596614 CACAGGCATGGCCTGAGATGAGG + Intergenic
915099059 1:153485461-153485483 CCCTGGGCTGGAAAGAGGTGGGG - Intergenic
915280089 1:154816582-154816604 CCCAGGCATGGAATAAGGGGTGG - Intronic
915558679 1:156674347-156674369 CACTGGCAAGGACAGAGGTGAGG - Intronic
915851752 1:159331756-159331778 GCCTGTCATGGAGTGAGGGGAGG - Intergenic
915922852 1:159990192-159990214 CCCTGGCAAGGGGTGGGGTGTGG - Intergenic
916090625 1:161305652-161305674 CTCTGGCAGGGCCTGGGGTGGGG + Exonic
917977750 1:180251118-180251140 CCCTGGCCTGGGCTGTGGGGTGG - Intronic
918428956 1:184438572-184438594 GCCAGACATGGACTGAGGTCTGG + Intronic
920065134 1:203263820-203263842 CCCTGGGAAGGTCTGTGGTGCGG + Intronic
920385498 1:205568366-205568388 CCCTGGAAGGGCCTGAGATGAGG - Intergenic
922674915 1:227544087-227544109 TCCTGGCAGGGGCTGAGCTGGGG - Intergenic
922859211 1:228801562-228801584 TGTTGGGATGGACTGAGGTGTGG - Intergenic
923146765 1:231203785-231203807 CCCTGGGATGGGGTGGGGTGGGG + Intronic
923879136 1:238084327-238084349 CCCTGCCATGGCCAGGGGTGGGG + Intergenic
1063118309 10:3086524-3086546 CCCTGGAATGTACTGGGGAGAGG + Intronic
1063419195 10:5897697-5897719 CCCTGGGAGGAACTGAGGTTCGG - Intronic
1065041828 10:21705373-21705395 CTCTGGCATGGGCTGAGGGTGGG + Intronic
1068186582 10:53593617-53593639 CCCTGGGATGGAGTGGGATGAGG - Intergenic
1069041324 10:63698628-63698650 CACTGGCAGGGCCTGAGGTAAGG + Intergenic
1069620293 10:69833333-69833355 TCCTGGCCTGGGCTGAGGTGAGG - Intronic
1069817473 10:71207528-71207550 CCCTGGCATTGCCGGGGGTGGGG - Intergenic
1069871150 10:71533963-71533985 CCCTGGCCGGGAATGAGGAGGGG - Intronic
1070257514 10:74825228-74825250 CCAGGGCTGGGACTGAGGTGCGG - Intergenic
1070397520 10:76024627-76024649 CCCTGGAATGGACTCAGGCCAGG - Intronic
1071161824 10:82755580-82755602 CCCTGGCTTCCACTGGGGTGGGG + Intronic
1071224496 10:83512613-83512635 CCCTGGCCCTGCCTGAGGTGGGG - Intergenic
1073183447 10:101600883-101600905 GTCTTGCACGGACTGAGGTGGGG + Intronic
1073509649 10:104035080-104035102 CCGTGGCAGGGACAGAGGTGGGG - Intronic
1075054512 10:119207547-119207569 CCCCGGGAGGGACTGAGGGGAGG + Intergenic
1075841864 10:125511663-125511685 CACTGGGATGGACAGAGCTGGGG - Intergenic
1076846546 10:133072085-133072107 TCCAGGCAGGGACTCAGGTGAGG + Intronic
1077146976 11:1050738-1050760 CCCTCCCAGGGACTGACGTGTGG - Intergenic
1080577737 11:33615245-33615267 GCCTGGAAAGGACTGAGGAGCGG - Intronic
1083314176 11:61804071-61804093 CACTGGCATGGACTGAGCCATGG - Intronic
1085695813 11:78703554-78703576 AGCTGGCATGGTCTGAGGGGAGG + Intronic
1085948265 11:81298356-81298378 ACATGGCATGGAATGATGTGAGG + Intergenic
1089743636 11:120602054-120602076 ACCTGGCTGGGACTGAGCTGGGG - Intronic
1089868500 11:121652181-121652203 GCCTAGCAGGGAGTGAGGTGAGG + Intergenic
1089938745 11:122393695-122393717 CCCTGGCTGAGGCTGAGGTGGGG + Intergenic
1091187469 11:133659097-133659119 CCCTGGCAGGATGTGAGGTGTGG - Intergenic
1091216708 11:133906767-133906789 CCCTGGGATGCACTGGGATGTGG - Intergenic
1091740277 12:2956278-2956300 CCCTGGGAAGGGCTGATGTGTGG + Intergenic
1092141176 12:6184536-6184558 ACCTGGCAGGGATTAAGGTGTGG + Intergenic
1092769251 12:11881941-11881963 CCAGGGGATGGGCTGAGGTGGGG - Intronic
1095084924 12:38050554-38050576 CTGTGGCATAGAATGAGGTGTGG + Intergenic
1098293420 12:68980527-68980549 CACTGTCAGGGACTGAGATGGGG - Intergenic
1099721094 12:86362329-86362351 GCCTGGCATGGGGTGAGGGGAGG + Intronic
1101071207 12:101077757-101077779 CCCTGACCTGGACTGATGTGAGG - Intronic
1101310550 12:103574954-103574976 TACTGGCATGGACTGTGGGGAGG + Intergenic
1101870225 12:108559881-108559903 TCCTGTCAAGGATTGAGGTGGGG - Intronic
1101877091 12:108603256-108603278 CCCTGGCACAGATCGAGGTGGGG - Intergenic
1102471629 12:113162820-113162842 CCCGGGCATGGAGGGAGGGGCGG + Intronic
1102867117 12:116383189-116383211 CCCTGGCATGTGCTAAGTTGTGG - Intergenic
1108065390 13:46572167-46572189 CCCAGGCATGGCCTGCAGTGGGG - Intronic
1111103358 13:83614176-83614198 GCCTGGCATGGGGTGAGGGGAGG - Intergenic
1113676173 13:112209409-112209431 CTCTGGACTGGACTGAGGTCTGG - Intergenic
1113946279 13:114045538-114045560 CCCTGGCTGGGACACAGGTGGGG - Intronic
1115440261 14:33426316-33426338 TCCTGGCAGGGAGGGAGGTGTGG + Intronic
1115770546 14:36661368-36661390 ACCTGGCATGGACTGAAGTGAGG + Intronic
1115847651 14:37555696-37555718 CCCTGTCAGGGAGGGAGGTGGGG - Intergenic
1117018059 14:51539273-51539295 GACAGACATGGACTGAGGTGGGG - Intronic
1117245731 14:53884644-53884666 ACCTGGCATGTACTGTGGTAAGG + Intergenic
1120890171 14:89484603-89484625 CCCTGGCCTGGGCTTAGGAGGGG + Intronic
1121035987 14:90704027-90704049 GCCAGGCATGCACTGAGATGGGG + Intronic
1121428303 14:93869160-93869182 ACCTGGCATGGGCTTAGGTCTGG - Intergenic
1122777533 14:104127901-104127923 GGCTGGCAGGGAGTGAGGTGGGG - Intergenic
1122918061 14:104867899-104867921 CCCAGGCAGGGCCTGGGGTGAGG - Intronic
1125514072 15:40308187-40308209 CCCAGGCCTGGACTGAGGGAAGG + Intergenic
1125861662 15:43005404-43005426 CCCTGTCTTGGAGGGAGGTGGGG + Intronic
1125862923 15:43014955-43014977 CCCTGTCAGGGAGGGAGGTGGGG + Intronic
1126925468 15:53580476-53580498 CCCTGGCATGGACTCAGTTCAGG - Intronic
1128332309 15:66763642-66763664 CCCTGGAGAGGACAGAGGTGAGG - Intronic
1128557101 15:68639272-68639294 ACCCGGCATGGAGTGGGGTGGGG + Intronic
1128698925 15:69789839-69789861 CCCTGACATGGTCTGAGGGCGGG - Intergenic
1129360696 15:75022098-75022120 CCCTGCCCTGAGCTGAGGTGGGG - Intergenic
1129894757 15:79094942-79094964 CCCTAGCTTGGGCTGGGGTGGGG + Intergenic
1130678916 15:85979447-85979469 CCCAGGCAGGGAGTGAGCTGGGG - Intergenic
1132415480 15:101615867-101615889 CCCTGGGAGGGTCTGAGCTGTGG - Intergenic
1132872857 16:2123396-2123418 CCCTGGGCAGGACTCAGGTGTGG + Intronic
1132903152 16:2269026-2269048 CTCTGGCAGGGACAGAGGAGGGG + Intergenic
1134215486 16:12313712-12313734 ACCCGGCATGGGGTGAGGTGTGG - Intronic
1134551945 16:15142575-15142597 CCCTGGGCAGGACTCAGGTGTGG + Intergenic
1135424881 16:22327448-22327470 CGCTGGAGTGGACAGAGGTGAGG + Intronic
1138460964 16:57147375-57147397 GCCTGGCCTGGGCTGAGATGAGG + Intronic
1138561161 16:57801925-57801947 CCCTGGCAGGGCCTGGGGCGGGG - Intronic
1138630709 16:58292268-58292290 CCCTGGCAGGTGCTGAGGTAGGG + Intronic
1139546813 16:67653414-67653436 CACAGGCATGGCCTGGGGTGGGG - Intronic
1139969454 16:70764820-70764842 TCCTGGCGTGGACTGTTGTGTGG - Intronic
1142131501 16:88433512-88433534 GACTGGCATTGACTGAGGCGTGG - Exonic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1142968761 17:3597221-3597243 CCCTGGCATGGCTGGAGGAGGGG - Intergenic
1143206408 17:5143112-5143134 CCCCGGCCTGGAGGGAGGTGAGG + Intronic
1143388814 17:6548132-6548154 TGCTGGCATGGAGTGGGGTGGGG - Intronic
1144783668 17:17820187-17820209 CCCTGGCAGGGGCTGTGGGGTGG + Exonic
1145115921 17:20210836-20210858 GCCTGGCATGGAGGGAGGGGTGG - Intronic
1145302117 17:21648116-21648138 ACATGGCACGGACAGAGGTGAGG - Intergenic
1145328461 17:21850899-21850921 ACATGGCACGGACAGAGGTGAGG - Intergenic
1145348193 17:22055200-22055222 ACATGGCACGGACAGAGGTGAGG + Intergenic
1145415386 17:22710183-22710205 ACATGGCATGGACAGAGGTGAGG - Intergenic
1145933802 17:28703550-28703572 CCCTGGCCTCAACTGAGGTTGGG + Exonic
1150265888 17:63832235-63832257 CTCTAGCATGGCCTGAGGTATGG - Exonic
1151970389 17:77454648-77454670 CTCTGGGAGGGGCTGAGGTGGGG - Intronic
1152394382 17:80023617-80023639 TCCTGGCCTGCACCGAGGTGAGG - Intronic
1152603771 17:81278714-81278736 CCCTGGTGTGGACTCAGCTGTGG - Intronic
1152901476 17:82943518-82943540 CCCTGGCCTGCTCTCAGGTGGGG + Intronic
1203193053 17_KI270729v1_random:207077-207099 ACATGGCATGGACAGAGGTGAGG - Intergenic
1203202417 17_KI270730v1_random:6512-6534 ACATGGCATGGACAGAGGTGAGG - Intergenic
1153310503 18:3673161-3673183 CCCAGGCACGCACAGAGGTGTGG - Intronic
1157558791 18:48631899-48631921 CCCTGGCCCGGACTGAGGAGCGG + Intronic
1157963148 18:52179276-52179298 GCCTGGGATGTAGTGAGGTGAGG - Intergenic
1158523122 18:58188392-58188414 CCTTGGCCTGGAGTGAGATGTGG + Intronic
1160768200 19:818046-818068 CCCGGGGAGGGTCTGAGGTGGGG + Intronic
1160811146 19:1013450-1013472 CCCTGGCCTGGTCAGTGGTGGGG - Intronic
1161028438 19:2047254-2047276 TCCTGGCACGGAGTGGGGTGGGG + Intronic
1161036862 19:2089879-2089901 CCCTGGCATGGAGTGGGTGGAGG - Intronic
1161078968 19:2300955-2300977 CCCTGGCATGGAGTGGGTGGAGG - Intronic
1161138586 19:2635117-2635139 CCCTGGCATGGAGTGGGTGGAGG - Intronic
1161142292 19:2654867-2654889 CCCTGGCATGGAGTGGGTGGAGG - Intronic
1161144799 19:2671153-2671175 TCCTGGCATGGACTGGGTGGAGG - Intronic
1161197699 19:2996218-2996240 CCCTGGCATGGAGTGGGTGGGGG + Intergenic
1161202030 19:3020370-3020392 CCCTGGCATGGAGTGGGTGGAGG - Intronic
1161211343 19:3067688-3067710 CCCTGGCATGGAGTGAGTAGAGG - Intergenic
1161212814 19:3076424-3076446 GCCTGGCATGGAGTGAGTGGAGG - Intergenic
1161265800 19:3363794-3363816 CCCTGGCATGGAGTGGGTGGAGG + Intronic
1161294075 19:3510829-3510851 TCCTGGCATGGAGTGAGTGGAGG + Intronic
1161328647 19:3675819-3675841 CCCTGGCATGGAGTGGGTGGAGG - Intronic
1161405939 19:4091097-4091119 CCCTGGCATGGAGTGGGTGGAGG - Intronic
1161517923 19:4706947-4706969 CCCTGGCATGGAGTGGGCGGAGG - Intronic
1161588698 19:5118931-5118953 CCCTGGCAGGCCCTGGGGTGTGG + Intronic
1162153783 19:8663398-8663420 AACTGCCATGAACTGAGGTGGGG + Intergenic
1163327928 19:16617245-16617267 CCCTGGCCTGGAATGGGGAGGGG - Intronic
1164525502 19:29010429-29010451 GCCTCGCAGGGACTGAGATGGGG - Intergenic
1165906126 19:39196087-39196109 CCCTGCCTGGGACTGGGGTGGGG - Intergenic
1166297952 19:41897808-41897830 CCAGGGCAGGGACAGAGGTGGGG - Intronic
1167863865 19:52308100-52308122 CCCTAGCATGGATGGAGATGGGG + Intronic
1168349146 19:55666120-55666142 CTCTGGCAGGGGCTGAGCTGAGG + Intronic
1168477689 19:56688979-56689001 CCCTGGCATGGACACAGCTGTGG - Intergenic
1168485739 19:56760397-56760419 CCCTGGCATGGACACAGCTGTGG - Intergenic
927693083 2:25222043-25222065 CCCTGGAATGGATGGAGGAGAGG + Intergenic
929481440 2:42312270-42312292 CCCTGGCAGGGACGATGGTGGGG - Intronic
931172490 2:59818507-59818529 ACCTGGCTGGGACTAAGGTGAGG - Intergenic
932126846 2:69152274-69152296 ACCTTGCATGGCCTGAGGTTTGG - Intronic
932396401 2:71451771-71451793 CACTGGGCAGGACTGAGGTGGGG - Intergenic
932569824 2:72932760-72932782 CCCTGGCAAGGTATGGGGTGGGG - Intronic
932580290 2:72988961-72988983 CCCAGGCAGGGGCTGGGGTGGGG - Intronic
932793819 2:74678317-74678339 CCCTTGGATGAACTGAGGTATGG - Intronic
933606361 2:84388637-84388659 CCCAGGCCTGGACTGTGCTGGGG + Intergenic
934050918 2:88210161-88210183 CCTTGGTATGGACAGAGCTGAGG + Intergenic
935159502 2:100517175-100517197 CCATGGCATGGCCTCAGGGGTGG + Intergenic
936062098 2:109301625-109301647 TCTCGGCATGGCCTGAGGTGGGG - Intronic
936502614 2:113078124-113078146 CCAGGGCTTGGACTGAGGAGTGG + Intergenic
937333353 2:121045596-121045618 GCCTGGCATGGACAGAGTGGTGG + Intergenic
937463644 2:122110583-122110605 CCCTGTCATGGGCTGGGGAGAGG - Intergenic
937973597 2:127567619-127567641 CCACGCCATGGACTGAGTTGGGG - Intronic
939570978 2:143839368-143839390 CCCTGTCATGAAGTGAGCTGTGG + Intergenic
942039776 2:172048134-172048156 CCCTGTGATGGAGTGAGGAGAGG + Intronic
942370242 2:175276138-175276160 CCAAGTCATGGAGTGAGGTGGGG - Intergenic
943419677 2:187655054-187655076 CCCTGGGAGTGACTGAGATGGGG - Intergenic
943526634 2:189024762-189024784 TGCTGGCATGTACTGAGATGGGG - Intergenic
944591297 2:201220310-201220332 CTCTGGCATAGAGGGAGGTGGGG + Exonic
947841206 2:233208956-233208978 CCCTGGGTTTGACTGTGGTGGGG - Intergenic
948510696 2:238462452-238462474 CCCTGGCAGGGACAGAACTGGGG - Intergenic
948907929 2:240988683-240988705 TCCTGGCAGGGAGTGAGGTCAGG - Intronic
948988290 2:241539470-241539492 GCCTGGCAAGGAGAGAGGTGTGG - Intergenic
1169236067 20:3930874-3930896 CCCTGGGAAGGTCTGAGCTGAGG - Intronic
1169940440 20:10931442-10931464 CCCTGGCCAGGACTTAGGAGTGG - Intergenic
1170546200 20:17437379-17437401 CCCAGGCTTGGACAGAGCTGAGG + Intronic
1171122001 20:22576544-22576566 CCCTGGCTTGGAGGGAGGGGTGG - Intergenic
1171151204 20:22827832-22827854 CCCTGGCATGCAATGGAGTGAGG - Intergenic
1171192768 20:23170945-23170967 ATCAGGCATGGACTGGGGTGTGG - Intergenic
1171518703 20:25759543-25759565 ACATGGCACGGACAGAGGTGAGG - Intergenic
1171558150 20:26096666-26096688 ACATAGCATGGACAGAGGTGAGG + Intergenic
1171983084 20:31640559-31640581 CCCTGGAATTGAGTGATGTGGGG + Intronic
1172110482 20:32541755-32541777 CCTGGGCATGGACAGAGGGGAGG - Intronic
1172977740 20:38919347-38919369 TCCTGGCATGGGCAGAAGTGTGG - Exonic
1174069077 20:47887428-47887450 CCCTGGCAAGGCCTGTGATGTGG + Intergenic
1176098008 20:63353094-63353116 CCCTGACCTGGACTGGGGTCGGG - Intronic
1176204871 20:63882853-63882875 ACCTGGCCAGGAGTGAGGTGAGG + Intronic
1176553245 21:8239335-8239357 CTGTGGCACGGAATGAGGTGTGG - Intergenic
1176572167 21:8422359-8422381 CTGTGGCACGGAATGAGGTGTGG - Intergenic
1176580076 21:8466919-8466941 CTGTGGCACGGAATGAGGTGTGG - Intergenic
1176652852 21:9565948-9565970 ACATGGTATGGACAGAGGTGAGG - Intergenic
1178155974 21:29854533-29854555 GCCTGGAATGGACTTGGGTGGGG + Intronic
1178248031 21:30973030-30973052 CCATGGCAAGGACTGAGAAGTGG + Intergenic
1178883584 21:36467340-36467362 GCCTGGCCAGGACTGAGGGGTGG + Intronic
1179908804 21:44437420-44437442 CCCAGGCATGGGCTGGGCTGCGG + Intronic
1180541546 22:16453196-16453218 GCCTGTCATGGAGTGGGGTGAGG + Intergenic
1180711191 22:17840861-17840883 CCCCGGCATGCACGGAGGAGCGG + Intronic
1180784401 22:18538833-18538855 CCCAGAGATGGAGTGAGGTGGGG + Intergenic
1181127975 22:20712886-20712908 CCCAGAGATGGAGTGAGGTGGGG + Intronic
1181241304 22:21478190-21478212 CCCAGAGATGGAGTGAGGTGGGG + Intergenic
1182095260 22:27621512-27621534 CCCTGGCAGGGAGTGAGTAGGGG + Intergenic
1182134525 22:27888903-27888925 CCCTGGCAAGGCCTGAGCTAGGG + Intronic
1182603888 22:31489228-31489250 CCCTGACATGGCCACAGGTGCGG - Intronic
1183545677 22:38453958-38453980 CCCTGGCTTGGCCTGTGCTGAGG - Intronic
1183639212 22:39083085-39083107 CCCTGGAGTGGACAGAGGGGAGG - Intronic
1183779397 22:39989036-39989058 AACTGGCATGGATTGAGGAGAGG + Intergenic
1184389721 22:44196411-44196433 CCCAGGTAGGGACTGAGCTGCGG + Exonic
1184743435 22:46442463-46442485 CCCTGGCCTGGGCAGAGGGGAGG - Intronic
1185161270 22:49231354-49231376 CCCTGGCAGGGACAGAGGATGGG - Intergenic
1185327701 22:50235146-50235168 TGCTGCCATGGACTGGGGTGTGG - Intronic
1203258243 22_KI270733v1_random:156363-156385 CTGTGGCACGGAATGAGGTGTGG - Intergenic
950703939 3:14768551-14768573 ACCTGGCAGGGACTGGGTTGGGG + Intronic
950715939 3:14847966-14847988 CCCTGGGAAGGCCTGAGGTGTGG + Intronic
951709450 3:25573945-25573967 CCCTGCCCTGGCCTGAGGTGGGG - Intronic
952887234 3:38019170-38019192 TCCTGCCATTGGCTGAGGTGTGG - Intronic
953975093 3:47376463-47376485 CCCAGGCCTGGACTGGGGAGGGG - Intergenic
954689796 3:52389611-52389633 CCCAGGCAGGGCCTGTGGTGTGG + Intronic
955001144 3:54928949-54928971 CCCTGCCATTTGCTGAGGTGGGG + Intronic
960032573 3:113069711-113069733 CCCTGGCTGGGGATGAGGTGAGG - Intergenic
960369466 3:116815984-116816006 CCCTGGCAAGAACTGAGGCTGGG - Intronic
961326000 3:126109787-126109809 ACCTGGGATGGACTGGGCTGTGG - Intronic
963427639 3:145152845-145152867 CCACAGCATGGTCTGAGGTGAGG + Intergenic
965759263 3:172057758-172057780 CCAAGGCATGCACTGAGGTGGGG - Intronic
968050695 3:195653035-195653057 CGCTGGCATGGATTGGGTTGTGG + Intergenic
968303421 3:197632896-197632918 CGCTGGCATGGATTGGGTTGTGG - Intergenic
968494035 4:905634-905656 CCGTGGCATGGCCTGGGGCGTGG - Intronic
968509769 4:990425-990447 ACCTGGCATGGCCCGAGGGGTGG + Intronic
968517503 4:1021102-1021124 CCCAGGCAGGGAATGGGGTGGGG + Intronic
968523499 4:1045122-1045144 CCCTGGCCTGCACTGTGGGGAGG - Intergenic
968961201 4:3744542-3744564 CCCTGCCATGGACTGCTGGGCGG - Intergenic
969272839 4:6114445-6114467 CCCAGGGATGGTCTGGGGTGGGG + Intronic
969299119 4:6287159-6287181 CCAAGGCACAGACTGAGGTGAGG + Exonic
969722320 4:8899165-8899187 CCCTGGCAGGGACTCGGGTGCGG + Intergenic
970140072 4:12972627-12972649 TCCTGGCTTGGAGTGGGGTGGGG - Intergenic
976646037 4:87388445-87388467 GCCTGGCATAGACTGAGGGAAGG - Intronic
978319537 4:107478791-107478813 CTCTGGCATGCCCTGAGGTCAGG + Intergenic
979649817 4:123115611-123115633 CCCTGGGATCCACTCAGGTGGGG - Intronic
980282383 4:130737819-130737841 CCCTGGGAAGCACTGAGGTCTGG - Intergenic
983380201 4:166981861-166981883 CTCTGGTGGGGACTGAGGTGGGG + Intronic
984949278 4:184994722-184994744 TCCTGGCGTGTCCTGAGGTGTGG + Intergenic
985740488 5:1613075-1613097 CACTGGCATTGATTGAGTTGTGG - Intergenic
985783119 5:1881203-1881225 CCCTGGGATGCACTCAAGTGGGG + Intronic
987163771 5:15172695-15172717 CCCTGGGAGGGAATGAGCTGAGG + Intergenic
990621774 5:57567711-57567733 CCCTGGAATGCAGTGAGGAGAGG + Intergenic
992942436 5:81775288-81775310 CCCTGGCCTGGCCTGAGCTGAGG + Intergenic
993306968 5:86286069-86286091 CACAGGCATGGTCTGAGATGAGG - Intergenic
995517456 5:112968212-112968234 CTGTGGCCTGGACTAAGGTGGGG + Intergenic
997470000 5:134112355-134112377 CCCTGGCTTGGGCTGTGGAGAGG - Intergenic
998132657 5:139659240-139659262 CCCGGGGAAGGACTGAGGTGGGG + Intronic
998415552 5:141943799-141943821 CTCTGGCCTAGAGTGAGGTGAGG + Exonic
999532596 5:152479913-152479935 CCCCGGCAGGGAGGGAGGTGGGG - Intergenic
1001286873 5:170430246-170430268 CACTGGCATGGTCAGAGGTTTGG - Intronic
1001918006 5:175577575-175577597 CCCTGGCATGGGTAAAGGTGAGG + Intergenic
1002586680 5:180253074-180253096 CCCTGGCAGGGACAGAGGGTAGG - Intronic
1004018960 6:11759058-11759080 ACCTGGCAGGGAGTGAGATGGGG + Intronic
1005379424 6:25218257-25218279 CCCTGGGAGGGAGTGGGGTGGGG - Intergenic
1006513591 6:34534259-34534281 CTCTGGCAGGGCCTGAGCTGGGG + Exonic
1006603333 6:35240064-35240086 GCCTGGCAAGGACTGAGGGATGG + Intronic
1007629304 6:43263926-43263948 CAGTGGCTTGGGCTGAGGTGGGG + Intronic
1007778766 6:44238992-44239014 CTCTGGGATGAACTGAGTTGGGG + Intergenic
1007934203 6:45718830-45718852 GCCAGGCATAGAGTGAGGTGAGG + Intergenic
1008506150 6:52231919-52231941 CCTTTGTATGGCCTGAGGTGAGG - Intergenic
1010260643 6:73811976-73811998 CCCTCCCATGGGCAGAGGTGAGG + Intronic
1012496992 6:99844420-99844442 CCCTGGGATGGAATGAAGTGAGG + Intergenic
1013242539 6:108260146-108260168 CCCTGCCAAAGGCTGAGGTGTGG - Intronic
1015518576 6:134109450-134109472 CCTTGGGATGGAGTGAAGTGGGG + Intergenic
1015830710 6:137365903-137365925 CCCTGGCATCTACTGAGCTCTGG - Intergenic
1017650064 6:156572521-156572543 CCCTGGCATGGTGTGAGCAGTGG - Intergenic
1018034654 6:159871781-159871803 ACCTGGGATGGACTGAAATGGGG + Intergenic
1018229674 6:161663563-161663585 TCCTGGCATGAACTGCAGTGAGG - Intronic
1018973622 6:168546712-168546734 GCTTGGCAGGGACTGGGGTGGGG - Intronic
1019448340 7:1082975-1082997 GCCTGGCAGTGACCGAGGTGGGG + Intronic
1019835856 7:3382491-3382513 CCTTGGCAATGATTGAGGTGAGG - Intronic
1024098058 7:46000736-46000758 CCGTGGCATCGTCTGAGGTGGGG + Intergenic
1024465437 7:49707218-49707240 CTCTGGCTTGGTCTGAGCTGGGG - Intergenic
1025279197 7:57614660-57614682 ACATGGCAGGGACAGAGGTGAGG - Intergenic
1025305534 7:57850840-57850862 ACATGGCAGGGACAGAGGTGAGG + Intergenic
1025677920 7:63658311-63658333 CGCTGGCATGGCCTGAGGGAGGG - Intergenic
1026442334 7:70455353-70455375 CAATGGCAAGGACTGAAGTGGGG + Intronic
1026947959 7:74328174-74328196 AGCAGGCATGGACTGAGGGGTGG + Intronic
1030548632 7:110931069-110931091 CCCTGACAATGACTGAAGTGGGG + Intronic
1032436657 7:131906434-131906456 CCCTGGCCTGGCCTGAAGTGGGG + Intergenic
1032884716 7:136124962-136124984 CCCTGGCACAGAGTGAGGTGTGG - Intergenic
1035645280 8:1214146-1214168 GCCTGGCAGGGAATGAGGTGTGG - Intergenic
1039574517 8:38612654-38612676 CCCAGGCCTGGACTGAGTTGGGG - Intergenic
1040008759 8:42643383-42643405 CCCTCACATGAACTCAGGTGTGG - Intergenic
1045341156 8:101255577-101255599 CACTGGCATGGAGTCTGGTGAGG - Intergenic
1046198913 8:110896348-110896370 GACTGACATGGACTGAGGCGGGG + Intergenic
1047315158 8:123726454-123726476 TCCTGCCATGCACTGAGCTGTGG + Intronic
1047329913 8:123877490-123877512 CACTGGCATCGAATGAGATGAGG + Intronic
1048494059 8:134920736-134920758 CACTGGCATGGCCTGGGGAGGGG - Intergenic
1049446685 8:142634564-142634586 CCCTGGCAGGGGCTGGGGTGGGG - Intergenic
1049717572 8:144100153-144100175 CCCTGGCATGGACTGAGGTGAGG - Intronic
1051502014 9:17788364-17788386 TCAGGGCATGGACTGAGGGGCGG + Intronic
1055625080 9:78168250-78168272 TCCTGGCATGGACTGAATTGTGG + Intergenic
1057735779 9:97658426-97658448 CACTGGCTTGCACTGAGGTGCGG - Intronic
1060235476 9:121859753-121859775 CCGTGGCCTGGACACAGGTGAGG - Intronic
1061925993 9:133806314-133806336 CCCTGGCATGCACAGAGATGTGG - Intronic
1061950930 9:133935471-133935493 CCCTGCCGTGGACAGAGGGGAGG - Intronic
1062025329 9:134337623-134337645 CCCTGGCATGCAGAGAGTTGGGG + Intronic
1062308346 9:135921971-135921993 CCTAGGCATGGACGGAGGAGTGG + Intergenic
1203474437 Un_GL000220v1:138377-138399 CTGTGGCACGGAATGAGGTGTGG - Intergenic
1187365244 X:18661271-18661293 CCCTTGCATGCCCTGAGATGGGG - Intronic
1188005056 X:25011351-25011373 CCCTGGGTTGGAAAGAGGTGGGG + Intronic
1189079826 X:37959165-37959187 CTCTAGCACTGACTGAGGTGTGG + Intronic
1189152942 X:38726307-38726329 CCCTGGCAGGGAGTGGGGAGCGG - Intergenic
1190937441 X:55009312-55009334 TGCTGGCTTGGACTGCGGTGGGG - Exonic
1192970865 X:76228434-76228456 CACTGGCATGGACAGAGTTGAGG - Intergenic
1193151131 X:78125574-78125596 TCCTGGCATCCACTGAGGCGGGG + Intronic
1197447294 X:126566023-126566045 CCCTGTCATGGGGTGAGGGGAGG + Intergenic
1199049450 X:143220052-143220074 CTCTGGCTTGGACTTAGGTGTGG + Intergenic
1201774639 Y:17649467-17649489 CTGTGGCATAGAATGAGGTGTGG - Intergenic
1201826917 Y:18256522-18256544 CTGTGGCATAGAATGAGGTGTGG + Intergenic