ID: 1049718819

View in Genome Browser
Species Human (GRCh38)
Location 8:144106238-144106260
Sequence CTGGGTGAGGGTCAGGTGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 815
Summary {0: 1, 1: 0, 2: 5, 3: 62, 4: 747}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049718803_1049718819 14 Left 1049718803 8:144106201-144106223 CCCGCAGCCATGAGTTCAGCCGG 0: 1
1: 1
2: 0
3: 12
4: 107
Right 1049718819 8:144106238-144106260 CTGGGTGAGGGTCAGGTGGAGGG 0: 1
1: 0
2: 5
3: 62
4: 747
1049718809_1049718819 -5 Left 1049718809 8:144106220-144106242 CCGGGAGCCCAGCCTTAGCTGGG 0: 1
1: 1
2: 1
3: 35
4: 293
Right 1049718819 8:144106238-144106260 CTGGGTGAGGGTCAGGTGGAGGG 0: 1
1: 0
2: 5
3: 62
4: 747
1049718805_1049718819 13 Left 1049718805 8:144106202-144106224 CCGCAGCCATGAGTTCAGCCGGG 0: 1
1: 0
2: 3
3: 11
4: 149
Right 1049718819 8:144106238-144106260 CTGGGTGAGGGTCAGGTGGAGGG 0: 1
1: 0
2: 5
3: 62
4: 747
1049718807_1049718819 7 Left 1049718807 8:144106208-144106230 CCATGAGTTCAGCCGGGAGCCCA 0: 1
1: 0
2: 1
3: 12
4: 126
Right 1049718819 8:144106238-144106260 CTGGGTGAGGGTCAGGTGGAGGG 0: 1
1: 0
2: 5
3: 62
4: 747

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049718819 Original CRISPR CTGGGTGAGGGTCAGGTGGA GGG Exonic
900019669 1:180354-180376 TTGGGTGAGGGTGAGGTGTGAGG - Intergenic
900164263 1:1238427-1238449 CTGGGTCAGGGTCAGGCTGAGGG + Intergenic
900509420 1:3051512-3051534 ATGGGTGGGTGTCAGGTTGATGG - Intergenic
900802881 1:4748197-4748219 CAGGGTGAGGGTCAATGGGAGGG - Intronic
900931239 1:5739221-5739243 CTGGGTGGGGGTGATGGGGAGGG - Intergenic
900989208 1:6090366-6090388 CTGGGGGAGGACCAGGTGGGGGG - Intronic
901420735 1:9149478-9149500 CTTGGGGAGGCCCAGGTGGATGG - Intergenic
901672820 1:10866304-10866326 CAGGTTGGGGGGCAGGTGGAGGG - Intergenic
902329404 1:15723944-15723966 CTGGGTGAGGGTCAATGGCAAGG - Intronic
902390499 1:16101742-16101764 CTGGAGGAGGGTCTGGTGGAGGG - Intergenic
902532447 1:17099046-17099068 CTGGGTGTGGGGCAGATTGACGG + Intronic
903033729 1:20481206-20481228 CTGGAGGAGGGTCAGGTGCCTGG + Intergenic
903272813 1:22202191-22202213 CTTGGGGAGGCTGAGGTGGATGG + Intergenic
903280851 1:22249033-22249055 CTGGGTGTGGGGCAGGGGGGAGG + Intergenic
903412208 1:23154429-23154451 CTTGGGGAGGCTGAGGTGGAAGG + Intronic
904313893 1:29647331-29647353 CTGGGTGAGGGACCGGAGGCAGG + Intergenic
905423463 1:37864056-37864078 CTTTGTGAGGCTCAGGTGGACGG - Intronic
905434741 1:37948672-37948694 CTGGGTGGGGGTCAGGCAGGAGG + Intergenic
906390506 1:45411326-45411348 TCGGGTGAGGGTCAGGTGGAGGG + Intronic
906782400 1:48584382-48584404 CTGGGTGAGGGTGTTGTTGAAGG - Intronic
908382008 1:63605683-63605705 CAGGCTGAGGCTCAGGTGGGAGG - Intronic
908692583 1:66799439-66799461 GAGGGTGAGGGTGAGGGGGATGG + Intronic
909527147 1:76638070-76638092 CTTTGGGAGGGTGAGGTGGATGG - Intergenic
909562005 1:77017444-77017466 ATGGGTGAGGGTCAAGGGCACGG + Intronic
910319391 1:85926667-85926689 TGGGGTGAGGGGCAGGGGGAGGG + Intronic
911588484 1:99718570-99718592 CTGTGGGAGGGTCTGGTGGGCGG - Intronic
911745430 1:101437067-101437089 CTTGGTGAGGCTGAGGTGGGAGG - Intergenic
915158699 1:153900622-153900644 TTGGGAGAGGCTAAGGTGGAAGG - Intronic
915170281 1:153972814-153972836 CTTGGTGAGGGGCAGGTGAGAGG - Exonic
915629102 1:157138190-157138212 CTGGGTGAGGCCCAGCTGGGTGG + Intronic
915943246 1:160132270-160132292 CTGGGTCAGAGCCAGTTGGAAGG + Intronic
915962723 1:160280624-160280646 CTTGGGGAGGCTCAGGTGGGAGG - Intronic
916027763 1:160849442-160849464 GTGGGTGAGGGGCAAGGGGAGGG - Intronic
916498315 1:165365113-165365135 CTGGCTGAGCCTCAGTTGGATGG + Intergenic
916712927 1:167427781-167427803 CTGGGTGGGGGCCGGGTGGGGGG + Intergenic
918447790 1:184632226-184632248 GTGTGTGAGGGTCTGGTGGGTGG - Intergenic
918465432 1:184817017-184817039 CAGGGTGAGGGGCAGGTGGAGGG - Intronic
919350058 1:196439889-196439911 GTGGGTGTGGGTCAAGGGGAGGG + Intronic
919832662 1:201552887-201552909 CTGTCTGAGGGTCAGATGGACGG + Intergenic
920093180 1:203468720-203468742 CTGAGGAAGAGTCAGGTGGAGGG + Intergenic
920400889 1:205675766-205675788 CTGGGCAGGGCTCAGGTGGAGGG - Intronic
920825874 1:209423856-209423878 CTGGGTGAGGGGGAGGTGTGGGG + Intergenic
920842398 1:209565733-209565755 CTGACTGTGAGTCAGGTGGATGG - Intergenic
921276311 1:213524272-213524294 CTGGGTGATGGTGAGGAGCAGGG - Intergenic
921729875 1:218566041-218566063 TTGGGTGAGGTCCAGGTGGAGGG - Intergenic
922013692 1:221620873-221620895 CTGGAAGAGGGCCAGGTGGATGG - Intergenic
922095906 1:222442615-222442637 CTGGGAGAGAGTCAGAAGGATGG + Intergenic
922208054 1:223466538-223466560 CTGGGTGAGGATCATGTAGAAGG - Intergenic
922420590 1:225458760-225458782 GTGGGAGAGGGTCAGGAGGCAGG + Intergenic
922800262 1:228361873-228361895 CTGGCTGATGACCAGGTGGACGG + Intronic
923086070 1:230704313-230704335 TTGGGGCATGGTCAGGTGGATGG + Exonic
924214187 1:241803235-241803257 CTTGGGGAGGCTGAGGTGGAAGG + Intergenic
924788611 1:247222206-247222228 CTTGGGGAGGCTGAGGTGGACGG - Intergenic
1062949490 10:1487197-1487219 CTGGGTGAGACTCAGGTGAAGGG + Intronic
1063020033 10:2117965-2117987 CTTGGTTGGGCTCAGGTGGATGG - Intergenic
1063120310 10:3101306-3101328 CTGAGAGAGCGCCAGGTGGATGG - Intronic
1063234606 10:4099950-4099972 CTTTGGGAGGGTGAGGTGGAGGG - Intergenic
1064111235 10:12540999-12541021 CTGTGTAATTGTCAGGTGGAGGG + Intronic
1064624747 10:17251045-17251067 CTGGGGTAGAGGCAGGTGGATGG - Intergenic
1065512836 10:26496324-26496346 GTGGATTAGGGTCAGGAGGAGGG - Exonic
1067060485 10:43075770-43075792 CTTGCTGAGGGGCAGGTGGCCGG - Intergenic
1067067732 10:43113126-43113148 CAGGGTCAGGGACAGGGGGAAGG + Intronic
1067160201 10:43819220-43819242 CTGTCTGGGGGTCAGGTAGATGG + Intergenic
1068173010 10:53421046-53421068 GTGGGTGAGGGGCAAGGGGAGGG - Intergenic
1069623138 10:69850080-69850102 CTGGGTGAGCTGGAGGTGGAGGG + Intronic
1069718901 10:70537936-70537958 CTGGGAGAGGCCCAGGAGGAGGG - Intronic
1069878285 10:71576367-71576389 CTTGGGGAGGGTGAGGTGGGGGG + Intronic
1070069282 10:73070936-73070958 CTGTGGGAGGCTGAGGTGGAAGG + Intronic
1070749448 10:78955332-78955354 CAGGGTGAGGATCAGGAGGTAGG - Intergenic
1070830843 10:79417315-79417337 TGGGGTGATGGTGAGGTGGAGGG - Intronic
1070854100 10:79592449-79592471 CGGGGTGGGGGCCTGGTGGAGGG + Intergenic
1071945991 10:90645560-90645582 GTGGGTGAGGGGCTGGGGGAGGG - Intergenic
1072564976 10:96609939-96609961 CTGTGAGAGAGGCAGGTGGAGGG - Intronic
1072953732 10:99870781-99870803 CTGCGTGAGGCTGAGGTGGGAGG - Intergenic
1074208456 10:111305177-111305199 TTGGGGGAGGGGCAGGTGGGAGG + Intergenic
1074869245 10:117564074-117564096 CTGAGAGAGGGGCAGGAGGAGGG - Intergenic
1075226426 10:120633685-120633707 CTGCCTGAGGGTGAGGAGGAAGG + Intergenic
1075256657 10:120930750-120930772 GTAGGTGAGGGACAGGGGGATGG + Intergenic
1075456779 10:122590001-122590023 TTAGGTGAGGGTGAGGTGGATGG + Intronic
1075618061 10:123905784-123905806 CTGGGTGAGGGTGGGGTGGGAGG - Intronic
1075781489 10:125020287-125020309 CTGGGTGGGGGTTGGGGGGATGG + Intronic
1076368903 10:129939259-129939281 CTGGGAGAGGGGAGGGTGGAGGG - Intronic
1076620262 10:131782732-131782754 CGGGGTGAGGCTCATGGGGAAGG - Intergenic
1076790687 10:132775212-132775234 CAGGGGGAGGGGCAGGGGGAGGG + Intronic
1076834467 10:133014188-133014210 ATGTGTGAGGCTCAGGTGGGAGG + Intergenic
1076907942 10:133372766-133372788 GTGGGTGCGGGTCAGGTGGGGGG + Intronic
1076963697 10:133787268-133787290 CAGGGTCAGGGTCAGGGTGAGGG + Intergenic
1076963701 10:133787280-133787302 CAGGGTGAGGGTGAGGGTGAGGG + Intergenic
1076963707 10:133787298-133787320 GAGGGTGAGGGTCAGGGTGAGGG + Intergenic
1076963711 10:133787310-133787332 CAGGGTGAGGGTGAGGGTGAGGG + Intergenic
1077032742 11:477015-477037 CTGGGTGGGGGGCAGGGAGAAGG + Intronic
1077073453 11:688746-688768 GTGGGAGCGGCTCAGGTGGAAGG - Intronic
1077132231 11:978847-978869 GTGGGTGAGGGTCAGAAGGTCGG + Intronic
1077403157 11:2368928-2368950 CTGGGTGGGAGACAGGAGGAAGG - Intergenic
1077411782 11:2407070-2407092 CTGGGTGAGGCCGAGGTGGCGGG - Intronic
1077739121 11:4825649-4825671 CTGGATGAAGTTCAGGTGGAAGG - Intronic
1078065686 11:8077830-8077852 CTTAGTGGGGGTCAGGTGCATGG - Intronic
1078655917 11:13239023-13239045 GTGGGTAAGGGTTTGGTGGAGGG - Intergenic
1078857936 11:15221574-15221596 CTGGGTGACGGGCAGGTGTGGGG - Exonic
1080123589 11:28705132-28705154 AAGGGTGAGGTTCAGGTGGGAGG + Intergenic
1080217904 11:29866673-29866695 TTGGGAGAGGTTCAGGTGGATGG + Intergenic
1081753331 11:45527659-45527681 CTGGGTGAGCCTCAGCTGGTGGG + Intergenic
1081871429 11:46384345-46384367 CAGGGTGAGGCTGTGGTGGATGG - Intergenic
1082768498 11:57187326-57187348 CAGGGTCAGGGTCAGGTGGCAGG - Exonic
1083188778 11:61034799-61034821 CTGGGTGGGGGTGGGGTAGAGGG - Intergenic
1083783109 11:64928250-64928272 CAGGGTCAGGGTCAGGGGAAAGG - Intronic
1084107816 11:66991666-66991688 CTGTGGGAGGCTGAGGTGGATGG - Intergenic
1084372107 11:68751164-68751186 CGGGGTGGGGGTCAGGTGAGGGG + Intronic
1084718388 11:70888571-70888593 TTGGGTGAGGCTGAGGTGGGTGG + Intronic
1084785641 11:71440331-71440353 ATGGATGACGGGCAGGTGGATGG + Intronic
1084785720 11:71440617-71440639 GTGGGTGATGGATAGGTGGATGG + Intronic
1084862744 11:72031549-72031571 CTTGGGGAGGCTGAGGTGGAAGG + Intronic
1084969758 11:72764690-72764712 CTTGGGGAGGGACAGGTGGCGGG + Intronic
1085055957 11:73403944-73403966 CTGTGTGGGGATCAGATGGAGGG + Intronic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085413742 11:76306874-76306896 TAGGGTGGGAGTCAGGTGGAAGG + Intergenic
1085481342 11:76825221-76825243 CTGGGTGTGGGCTATGTGGAAGG + Intergenic
1086079536 11:82889110-82889132 CTTTGTGAGGTACAGGTGGAAGG + Intronic
1086887370 11:92221766-92221788 CTGGGTGGGGGTAAGATGCAAGG + Intergenic
1086993487 11:93330801-93330823 TTGGGTGAGGGTCAGGGGCGAGG - Intronic
1087777459 11:102269275-102269297 CTGGGTGTTGGACAGGTAGAGGG + Intergenic
1087786481 11:102360816-102360838 GTGGGTGAGGGTGAGGGTGAGGG + Intronic
1087904124 11:103675753-103675775 CAGGGTGAGGGACAAGGGGAGGG + Intergenic
1089044900 11:115491946-115491968 TGGGGTGAGGGGCAGGGGGAGGG + Intronic
1089145296 11:116325217-116325239 CTGAGAGAGGGTCATGTGGTTGG - Intergenic
1089161325 11:116439740-116439762 GTGGGTGAGGCCAAGGTGGATGG + Intergenic
1089275913 11:117336069-117336091 CAGGGTGAGGCTCAGGTTGGGGG + Intronic
1089355101 11:117844431-117844453 CTGGGAGAGAGGCAGGGGGATGG - Intronic
1089733135 11:120532024-120532046 CTGGATGTGGGGCAGGTGGAAGG + Intronic
1090799908 11:130163942-130163964 CAGAGTGAGGGTCAGGTAGGGGG - Intronic
1090862181 11:130663708-130663730 CGGGGTGCGGGGCAGGGGGAGGG + Intergenic
1091239675 11:134044022-134044044 CTGGGTGAGGGTCTCTTGAAGGG - Intergenic
1092361508 12:7840526-7840548 CTGGGTGTGGGTGTGGTGGCGGG - Intronic
1092839739 12:12528310-12528332 CTGGGAGAGGGGCCGGTGTATGG + Intronic
1092923886 12:13256838-13256860 CTGGGTGAGGTTGTGGTGGAGGG + Intergenic
1092962611 12:13610510-13610532 CTGGATGAAGCACAGGTGGAAGG + Intronic
1093079121 12:14789026-14789048 CTGGGGGAGGGCCAGGGGGTCGG + Exonic
1093881928 12:24414588-24414610 CTGGGTGAGAGGCAGGCAGATGG - Intergenic
1095646549 12:44555133-44555155 CTGGTTGGGGTTCAGGTGGAGGG + Intronic
1096078420 12:48818631-48818653 CGGGGAGGGGGTCAGGTGGGCGG + Intronic
1096460395 12:51818928-51818950 CTGGGAGAGGGTGAGGGAGATGG - Intergenic
1096563393 12:52453464-52453486 ATGGGTGAGGAAGAGGTGGAGGG + Intergenic
1096908899 12:54962515-54962537 CTGGGTGATGGACAGGTCCAAGG + Exonic
1097185127 12:57192659-57192681 CTGTGGGAGGGCCAGGTGCATGG - Intronic
1097729423 12:63110850-63110872 CGGGGTGAGGGTCTAGGGGAGGG - Intergenic
1098023797 12:66182030-66182052 CTTTGTGAGGCTAAGGTGGAAGG + Intergenic
1098486757 12:71030422-71030444 CTGGGTGAGTGACACGTGGAAGG + Intergenic
1098918364 12:76280040-76280062 CTGGGCTAGGGCCAGGTGGAAGG + Intergenic
1098918389 12:76280215-76280237 CTGGGCTAGGGCCAGGTGGAAGG + Intergenic
1099206351 12:79732397-79732419 CTTTGTGAGGCTGAGGTGGAAGG + Intergenic
1099725897 12:86427497-86427519 CTGTGTGTGTGTAAGGTGGATGG - Intronic
1101876064 12:108597661-108597683 CTGTGTGAGGGTGATGTGGACGG - Intronic
1102519574 12:113470188-113470210 ATGGGTGAGGCTCAGGTTGGGGG + Intronic
1102742026 12:115216478-115216500 TTGCCTGAGGGTCAGGAGGAAGG + Intergenic
1102756123 12:115342472-115342494 CGGGGTGGGGGGCAGGTGGGGGG - Intergenic
1102813723 12:115845347-115845369 CTGGGAGAATGCCAGGTGGAAGG - Intergenic
1103023466 12:117555100-117555122 CTGGGTGAGGGGTAGGAGGGAGG - Intronic
1103541622 12:121670116-121670138 CTTGGAGAGGCTGAGGTGGATGG - Intronic
1103599177 12:122043411-122043433 GTGGGTGGGGGTCAGGGGGCGGG + Intronic
1104205252 12:126632338-126632360 CTGGGTGGGGGTTGGGGGGATGG + Intergenic
1104856455 12:131904569-131904591 CTGGGTGAGTGGCTGGGGGATGG + Intronic
1104904647 12:132206714-132206736 CTGGGTCACGGTCAGGTCCACGG - Intronic
1104912377 12:132245538-132245560 CTGGGCGAGGGTCAGCAGGCTGG - Intronic
1104912399 12:132245598-132245620 CTGGGCGAGGGTCAGCAGGCTGG - Intronic
1106012215 13:25835820-25835842 CTGGCTGAGGGTGCGGTGTAAGG - Intronic
1106192023 13:27462014-27462036 CTTTGGGAGGGTGAGGTGGAAGG - Intergenic
1106192659 13:27467204-27467226 CAGGGTGGGGGTGAGGTGGGAGG + Intergenic
1106536046 13:30643851-30643873 CTGTGGGAGGCTCAGGTGGCTGG - Intronic
1106931304 13:34668626-34668648 GGGGGTGGGGGTCAGGAGGAGGG - Intergenic
1107059305 13:36139461-36139483 CTGGGTGGGGGGCAGTGGGAGGG - Intergenic
1107239022 13:38210175-38210197 CTGGTAGAAGGACAGGTGGAAGG - Intergenic
1107440741 13:40425387-40425409 CTGGAGCAGGGTGAGGTGGAGGG - Intergenic
1107684972 13:42887550-42887572 CTGGGGGACGGTGAGGCGGAGGG + Exonic
1108178301 13:47817091-47817113 TTGGGTGAGGCTGAGGTGGTGGG - Intergenic
1108399380 13:50023894-50023916 CTTTGGGAGGGTGAGGTGGAAGG - Intergenic
1108625552 13:52225058-52225080 CTTTGTGAGGCTGAGGTGGAAGG + Intergenic
1108660511 13:52581360-52581382 CTTTGTGAGGCTGAGGTGGAAGG - Intergenic
1110569049 13:76984970-76984992 TTGTGTGAGGTTCAGGTGGAAGG + Intergenic
1111463154 13:88572533-88572555 CTTTGGGAGGGTGAGGTGGAAGG + Intergenic
1112411172 13:99164882-99164904 CTTGGGGAGGCTGAGGTGGATGG + Intergenic
1112648150 13:101359027-101359049 CGGGGTGAGGGGCAGGGGGAGGG + Intronic
1112854792 13:103754509-103754531 GTGGGTGAGGGGCGGGGGGAGGG + Intergenic
1112907805 13:104445896-104445918 CGGGGTGGGGGTCAAGGGGAGGG + Intergenic
1113366443 13:109681080-109681102 CAGGATGAGGGACAGGTGGCTGG - Intergenic
1113934158 13:113984613-113984635 ATGGGTGAGTGATAGGTGGATGG - Intronic
1113934835 13:113988523-113988545 ATGGGTGAGTGATAGGTGGATGG - Intronic
1113935035 13:113989444-113989466 ATGGGTGAGTGACGGGTGGATGG - Intronic
1113935087 13:113989677-113989699 ATGGGTGAGTGACGGGTGGATGG - Intronic
1115079919 14:29437835-29437857 GCGGGTGGGGGTCAGGGGGAGGG - Intergenic
1115838414 14:37436762-37436784 TTGGGATAGGGCCAGGTGGAAGG - Intronic
1116243708 14:42380434-42380456 GTGGGTGGGGGTCTGGGGGAGGG + Intergenic
1117313449 14:54551152-54551174 CTGGGTGGGGGTGAGGAGGCAGG - Intergenic
1119313772 14:73673783-73673805 CTCGGGGAGGCTGAGGTGGAAGG + Intronic
1119740649 14:77011923-77011945 CAGGGTGAGAGTCAGGTGCTGGG - Intergenic
1119852315 14:77874901-77874923 ATGGTTAAGGGACAGGTGGATGG + Intronic
1119886992 14:78151664-78151686 CAGGGTGTGGTTCAGGAGGAAGG - Intergenic
1121008391 14:90504940-90504962 CTGGGTGGGGGTCAAGCGGGGGG + Intergenic
1121276217 14:92669633-92669655 CTGGGTGGGGGTGAGGTGGGGGG + Intronic
1122100945 14:99409117-99409139 CTGGGCGAGGAGGAGGTGGAAGG - Intronic
1122261574 14:100526267-100526289 CAGGGTAAGGGTCTGGTGGGGGG + Intronic
1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG + Intergenic
1122383836 14:101330678-101330700 CCTGGTGGGGGTGAGGTGGAAGG - Intergenic
1122675491 14:103409295-103409317 CGGGGTGAGGGGCAAGGGGAGGG + Intronic
1122877464 14:104675470-104675492 ATGGATGTGGGACAGGTGGATGG + Intergenic
1123017584 14:105382734-105382756 TTTGGTGAGGGTCAGGTGCTGGG + Intronic
1123701397 15:22917163-22917185 CTGCAGGAGGGTCAGGGGGACGG - Intronic
1124844491 15:33277204-33277226 CTGGGTGAGGGCCTGGGGAAAGG - Intergenic
1124921481 15:34030859-34030881 CTTTGGGAGGGTGAGGTGGAAGG - Intronic
1125097786 15:35874468-35874490 TTGGGATAGAGTCAGGTGGAGGG - Intergenic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1125730883 15:41892306-41892328 CAGGGTGAGGGGCTGGTGCAGGG - Intronic
1125866831 15:43059306-43059328 CTGTGAGAGGCTGAGGTGGAAGG - Intronic
1125888967 15:43251656-43251678 CTGGGTGTGGGGCAGGGTGAGGG + Intronic
1126101243 15:45119503-45119525 CTGGCTGAGGGGCATGTGGCTGG + Intronic
1126492328 15:49251660-49251682 CTGGTGCAGGGTGAGGTGGATGG - Intronic
1126637453 15:50793106-50793128 CTGGTTGGGGGTGAAGTGGATGG + Intergenic
1126760382 15:51964400-51964422 TGGGGTGAGGGGCAGGGGGAGGG + Intronic
1127269032 15:57384213-57384235 CTGGGTGTGAGGCAGCTGGATGG + Intronic
1127960648 15:63887927-63887949 CAGGGGTAGGGTCAGGAGGAAGG - Intergenic
1127966629 15:63927557-63927579 CTGGGTGTGAGTTAGGTGTATGG + Intronic
1128099723 15:64989168-64989190 CTGAGTGTGGGCCAGGTGTAAGG - Intronic
1128468079 15:67929398-67929420 CTGTGTGATGGTTAGGTGTATGG - Intergenic
1128556938 15:68638186-68638208 TGGGCTGAGGGTCAGGAGGAGGG - Intronic
1128669195 15:69561637-69561659 CTGGGGGACAGTCAGGTGCAGGG - Intergenic
1128902598 15:71438133-71438155 CTGGGCGAGGGTGAGGGCGAGGG - Intronic
1129249880 15:74302993-74303015 CTGGGTGTGGGTCTGGGGGCAGG - Intronic
1129797149 15:78386574-78386596 CAGGGTGGGGGTCTGGAGGAGGG - Intergenic
1129890507 15:79068798-79068820 CTCTGTGAGGGTCAGGTGTGTGG + Intronic
1130232875 15:82109866-82109888 CTTAGTAAGGGTCAGGTGGAGGG + Intergenic
1130381913 15:83378966-83378988 CGGGGTGGGGGTGAGGAGGAGGG + Intergenic
1131064450 15:89424862-89424884 CTGGGTTTGGGGCAGGGGGAAGG + Intergenic
1131449444 15:92527295-92527317 CTGGGTGAGTGCCAGGTACATGG + Intergenic
1131898513 15:97061523-97061545 CTTGTTGAAGGTCTGGTGGAGGG + Intergenic
1132455428 16:19535-19557 CAGGGTGAGGGTCAGGGTCAGGG - Intergenic
1132455489 16:19724-19746 TAGGGTGAGGGTCAGGGTGAGGG - Intergenic
1132455499 16:19753-19775 CAGGGTCAGGGTCAGGGTGAGGG - Intergenic
1132455503 16:19765-19787 CAGGGTGAGGGTCAGGGTCAGGG - Intergenic
1132477571 16:148936-148958 GAGGCTGAGGGTCAGGCGGAGGG - Intergenic
1132804359 16:1768864-1768886 CCGGGCGGGGGTCAGGTGGTCGG - Exonic
1132839402 16:1971719-1971741 CAGGGGCAGGGTCAGGTTGACGG + Intergenic
1132850097 16:2020991-2021013 CAAGGTGGGGCTCAGGTGGAGGG - Intergenic
1133009711 16:2904450-2904472 CCGGGTGGGGGTCAGGCGGGTGG - Intergenic
1133976983 16:10606481-10606503 GTGGGGGTGGGTCAGGAGGAAGG - Intergenic
1134504054 16:14791048-14791070 CTGGGTGAAGAACAGGTGGGTGG - Intronic
1134576518 16:15337860-15337882 CTGGGTGAAGAACAGGTGGGTGG + Intergenic
1134610101 16:15601294-15601316 CTGGGTCAGTGTTAGATGGAGGG - Intronic
1134725925 16:16418639-16418661 CTGGGTGAAGAACAGGTGGGTGG - Intergenic
1134868225 16:17628147-17628169 CTGGGTGAGGAAAAGGAGGAAGG - Intergenic
1134941509 16:18293220-18293242 CTGGGTGAAGAACAGGTGGGTGG + Intergenic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1135566582 16:23515945-23515967 CTGTGGGAGGCTGAGGTGGAAGG - Intronic
1135605774 16:23823279-23823301 CTTTGTGAGGCTGAGGTGGACGG + Intergenic
1135657315 16:24262223-24262245 CTGGGAGAAGGTCAGGAGTAGGG - Intronic
1135664829 16:24326906-24326928 CTGGTTCAGGATCAGGTGGCAGG - Intronic
1135748338 16:25036481-25036503 CTGGGGAAGGGTCAGGGTGAAGG - Intergenic
1135829531 16:25761115-25761137 CTGGGTGAGGCTCAGGTCTTGGG + Intronic
1136426488 16:30171169-30171191 CTGGGGGCGGGTGAGGTGGGAGG - Intergenic
1136717950 16:32300211-32300233 CTTGGTGAGGTTAAGGTGGGTGG + Intergenic
1136836325 16:33506481-33506503 CTTGGTGAGGTTAAGGTGGGTGG + Intergenic
1138493584 16:57393087-57393109 CTGGGAGAGGGTGAGAAGGATGG - Intergenic
1138647296 16:58434662-58434684 ATGGGTGCTGGTCAGGGGGATGG - Intergenic
1138647337 16:58434815-58434837 ATGGGTGCTGGTCAGGGGGATGG - Intergenic
1138694236 16:58796842-58796864 GGGGGTGAGGGGCAGGGGGATGG - Intergenic
1139281907 16:65778528-65778550 TTGGGTGAGGGTGAGGGTGAGGG + Intergenic
1139827109 16:69766116-69766138 CTGTCTGAGGGGCAGGTGTAGGG - Intronic
1140088138 16:71814524-71814546 CTTGGGGAGGGTGAGGTGGGAGG - Intergenic
1140315338 16:73891026-73891048 CTGAGCGGGGGTGAGGTGGAGGG - Intergenic
1140339979 16:74148317-74148339 CTGTGGGAGAGGCAGGTGGATGG - Intergenic
1141138750 16:81483605-81483627 CTGGGGGAGGGTCAGGGAGAGGG - Intronic
1141533188 16:84660863-84660885 CTTTGTGAGGGTGAGGTGGGTGG - Intronic
1141553510 16:84821623-84821645 CTGTGTGAAGGTCAGGTTCATGG - Intronic
1141641897 16:85346415-85346437 ATGGGTGATGGACAGGTGGATGG + Intergenic
1141641929 16:85346548-85346570 ATGGGTGATGGACAGGCGGATGG + Intergenic
1141641992 16:85346833-85346855 ATGGATGATGGGCAGGTGGATGG + Intergenic
1141641996 16:85346852-85346874 ATGGGTGATGGACAGGTAGATGG + Intergenic
1141642263 16:85348223-85348245 ATGGATGATGGACAGGTGGATGG - Intergenic
1141735593 16:85850323-85850345 CATGGTGAGTTTCAGGTGGACGG - Intergenic
1141882335 16:86868265-86868287 TTGTGTGAGGGTGAGGTGGGCGG + Intergenic
1141984829 16:87572898-87572920 CTGGCTGAAGGTCAGGGGGCAGG - Intergenic
1142153050 16:88521095-88521117 GTGGATGATGGACAGGTGGATGG + Intronic
1142443984 16:90122116-90122138 TTGGGTGAGGGTGAGGTGTGAGG + Intergenic
1203008478 16_KI270728v1_random:217555-217577 CTTGGTGAGGTTAAGGTGGGTGG - Intergenic
1203146506 16_KI270728v1_random:1806774-1806796 CTTGGTGAGGTTAAGGTGGGTGG + Intergenic
1142619342 17:1154876-1154898 CTTGGTGAGGGCCAGGTAGGAGG - Intronic
1142864499 17:2782416-2782438 CTGAGGGCGGGTCAGGTGGAGGG - Intronic
1143557606 17:7671852-7671874 CTTGGGGAGGCTGAGGTGGAAGG + Intronic
1143583866 17:7841888-7841910 CTGGGGGAGGGGGAGGCGGAGGG - Intronic
1143866101 17:9925299-9925321 CTGGGTGTGGGTCAGAGAGAAGG + Intronic
1144122751 17:12172307-12172329 CTGGGTCGGGGGCAGGGGGATGG - Intergenic
1144994818 17:19260273-19260295 ATGGGAGAGGGCCAGGAGGAAGG + Intronic
1146533589 17:33631056-33631078 CTGGGTAAGGAGCAAGTGGAAGG + Intronic
1147531417 17:41281606-41281628 TGGGGTGGGGGTCAGGGGGAGGG + Intergenic
1147965944 17:44194204-44194226 CTGGGTGGGGGTCAGGAGAGAGG + Exonic
1147976903 17:44253068-44253090 GGGGGTGAGGGGCAGGAGGATGG + Intronic
1148333831 17:46828444-46828466 CTGTGGGAGGCTGAGGTGGATGG - Intronic
1148350277 17:46936508-46936530 CAGGGTGTGAGGCAGGTGGAGGG - Intronic
1148458292 17:47822656-47822678 CTCGGTGAGGATGAAGTGGAAGG - Intergenic
1148693649 17:49546699-49546721 CTGGGTGAGGGCCAGTGGCAGGG - Intergenic
1148738057 17:49875841-49875863 GTGGGGGTGGGGCAGGTGGAAGG + Intergenic
1148805575 17:50262202-50262224 CTGGGTGAGTCTCTGGTGAAAGG - Intergenic
1148898713 17:50858231-50858253 CTGGGTCAGGGGGAGGGGGATGG - Intergenic
1149306512 17:55352064-55352086 CTGGTTGAGGCTGAGATGGAAGG + Intergenic
1149352788 17:55808842-55808864 CTGGGTGGGGTTGAGGGGGAAGG - Intronic
1150227053 17:63529992-63530014 CTGAGTGAAGGTCAAGTGAAGGG - Intronic
1150656232 17:67041643-67041665 CTGGCTGCGGAGCAGGTGGAAGG - Intergenic
1151384170 17:73745119-73745141 ATGCATGGGGGTCAGGTGGACGG + Intergenic
1151466237 17:74287269-74287291 CTGGGGGCGGGTCTGGTTGATGG + Intronic
1151573932 17:74941806-74941828 CGGGGTGAGTGTCAGGTTGCTGG + Exonic
1151898091 17:76993957-76993979 CTGGGGGAGGGTGGGGTGGGAGG - Intergenic
1151950796 17:77352600-77352622 CAGGGTGAAGGCCAGGTGGGGGG - Intronic
1151962897 17:77416562-77416584 CTGGGTGAGGATGCGGTGGGAGG + Intronic
1152016944 17:77757012-77757034 CTGGGGGAGGCGCAGGTTGATGG - Intergenic
1152386404 17:79977414-79977436 CTGGGAAGGGGCCAGGTGGAGGG - Intronic
1152411296 17:80124627-80124649 GTGGGTGAGGGCCAGAGGGAAGG + Intergenic
1152592440 17:81220296-81220318 CTGGATGATGGACAGGTGGGTGG + Intronic
1152657059 17:81524611-81524633 CTTGGTGAGGGTCAGTGGGAGGG + Intergenic
1152737779 17:82005715-82005737 CTGAGTGAGGTTCGGGTTGAAGG - Intronic
1152767638 17:82149728-82149750 CTGGGTGCGGGTCAGGTTCTGGG - Intronic
1152767658 17:82149800-82149822 CTGGGTGTGGGTCAGGTTCCGGG - Intronic
1152767723 17:82150088-82150110 CTGGGTGTGGGTCAGGTTCTGGG - Intronic
1152767736 17:82150142-82150164 CTGGGTGTGGGTCAGGTTCTGGG - Intronic
1152767811 17:82150484-82150506 CTGGGTGCGGGTCAGGTTCTGGG - Intronic
1152767861 17:82150736-82150758 CTGGGTGCGGGTCAGGTTCTGGG - Intronic
1152767872 17:82150790-82150812 CTGGGTGTGGGTCAGGTTCTGGG - Intronic
1152767892 17:82150880-82150902 CTGGGTGTGGGTCAGGTTCTGGG - Intronic
1152767897 17:82150898-82150920 CTGGGTGCGGGTCAGGTTCTGGG - Intronic
1152767929 17:82151042-82151064 CTGGGTGCGGGTCAGGTTCTGGG - Intronic
1152767940 17:82151096-82151118 CTGGGTGTGGGTCAGGTTCTGGG - Intronic
1152767977 17:82151258-82151280 CTGGGTGCGGGTCAGGTTCTGGG - Intronic
1152767986 17:82151294-82151316 CTGGGTGCGGGTCAGGTTCTGGG - Intronic
1152768006 17:82151384-82151406 CTGGGTGTGGGTCAGGTTCTGGG - Intronic
1152862449 17:82703948-82703970 TTGGGTGAGAGTCAGGTTGGAGG - Intergenic
1152871738 17:82757747-82757769 TTGGGAGAGGGTCAGCTGCAGGG + Intronic
1152964888 18:105589-105611 GAGGGTGAGGGTCAGGGTGAGGG - Intergenic
1152964894 18:105607-105629 CAGGGTGAGGGTCAGGGTGAGGG - Intergenic
1152964898 18:105619-105641 CAGGGTGAGGGTCAGGGTGAGGG - Intergenic
1152964902 18:105631-105653 TAGGGTGAGGGTCAGGGTGAGGG - Intergenic
1153023075 18:648899-648921 CTTGGGGAGGCTGAGGTGGAAGG - Intronic
1154415528 18:14173637-14173659 CTGGGTCAGGGCCAGGAGCAAGG + Intergenic
1154980891 18:21501404-21501426 ATGGGTGAGGGGCAAGAGGAGGG - Intronic
1155544456 18:26901265-26901287 CAGGATGAGGTTCAAGTGGAAGG - Intergenic
1156191195 18:34722710-34722732 ATGGGGGAGGGACAGGTGGGAGG - Intronic
1156550907 18:38015654-38015676 CTGTCTGGGGGTAAGGTGGAGGG - Intergenic
1157307524 18:46528108-46528130 CTGGCTGAGGGTCAGGTTTAAGG + Intronic
1157349602 18:46872814-46872836 CTGGGTGAGCTTCAGGTATAAGG - Intronic
1157377457 18:47179428-47179450 CTGTGGGAGGCTGAGGTGGATGG - Intergenic
1157564214 18:48668749-48668771 TTGGGCGAGGGGCAGGAGGAAGG - Intronic
1157689425 18:49668878-49668900 CCAGGTGAGGGGCAGGTGGTAGG + Intergenic
1157725906 18:49963669-49963691 CTGTGGGAGGCTGAGGTGGATGG - Intronic
1159915104 18:74181913-74181935 CTGGGCGTGGGTCATGTGCAGGG - Intergenic
1160409149 18:78663144-78663166 CTGGGGGAGGGCCGGGTGGGAGG + Intergenic
1160507057 18:79433047-79433069 CTGACTGAGGGCCAGGAGGAGGG - Intronic
1160613652 18:80108377-80108399 CTAGGTGAGGTTCAGGTGCAGGG + Intergenic
1161306530 19:3572267-3572289 CTGGGTGTGGGTCAGGCAGGGGG - Intronic
1161393252 19:4032087-4032109 CTGGGTGGGGGTCAGGAAGGAGG + Intronic
1161401799 19:4069085-4069107 CTGTGGGAGGCTCAGGTGGGAGG - Intergenic
1162322493 19:9978532-9978554 CTGGGTGGGGGCAGGGTGGAGGG - Intronic
1162395021 19:10412909-10412931 CTGAGTCAGAGTCAGGGGGATGG - Intronic
1162515855 19:11147240-11147262 CTGGGTGCTGTCCAGGTGGATGG + Exonic
1162741129 19:12774572-12774594 CTGGGTGATGGGCAGGAAGAGGG - Intronic
1163054053 19:14705376-14705398 CTGGGGGAGGGTCTGGTTGTTGG + Intronic
1163258645 19:16173260-16173282 CTGTGTGAGTGTGGGGTGGAGGG - Intronic
1163353738 19:16796094-16796116 ATGGGGGAGGGGCAGGTGGTAGG + Intronic
1163406376 19:17125744-17125766 CTGGTTGCTGGTCAGATGGACGG - Intronic
1163421093 19:17214066-17214088 CTTTGGGAGGGTGAGGTGGATGG - Intronic
1163456997 19:17412814-17412836 CTGTCTCAGGGTCTGGTGGAGGG + Intronic
1163729598 19:18941322-18941344 CTGGGAGAGGGTATGGGGGAGGG + Intergenic
1163744103 19:19034535-19034557 CTGGTAGAGGGACATGTGGATGG + Intronic
1164300347 19:23956590-23956612 CAGGCTTAGGCTCAGGTGGATGG - Intergenic
1164422314 19:28105541-28105563 CTGGGTGTAGGTCAGTTGGTGGG + Intergenic
1164590712 19:29505331-29505353 CTGGGGGAGGGACAGGAGGAGGG + Intergenic
1165175391 19:33925740-33925762 CTGGGTGAGGGATAGGAGGAAGG + Intergenic
1165202334 19:34155275-34155297 ATGGGTGAGGGTCAGGGTGTAGG - Intergenic
1165250358 19:34527958-34527980 CTTTGGGAGGCTCAGGTGGATGG - Intergenic
1165313490 19:35041684-35041706 CTGGGCGAGGGGCGGGTGAAGGG - Intronic
1165323869 19:35102793-35102815 GTGAGTGAGGGGCAGGTGGGAGG - Intergenic
1165343997 19:35232247-35232269 CTGGGTGAGGGTCAAGGGCAGGG + Intergenic
1165407177 19:35638008-35638030 CTTGGTGAGAGTCTGCTGGATGG - Intergenic
1165745476 19:38227994-38228016 CTGGGCCAGGGTCAGGGTGAGGG + Intronic
1165831926 19:38734781-38734803 CTGGGATAGGGGCAGGAGGAGGG - Intronic
1166303647 19:41925875-41925897 ATGGGTGAGGGCCAGGAGGCTGG + Intronic
1166427928 19:42696533-42696555 CTGGGTCAGGGTCTGCTGGTTGG + Intronic
1166596323 19:44053308-44053330 CTTGGTGAGGGGGATGTGGAAGG + Intronic
1166625948 19:44356355-44356377 CTGGTTGATGGTCAGGGGAAAGG + Intronic
1166806282 19:45489141-45489163 CAGGGTCAGGGTCAGGGGAAGGG + Intronic
1167132211 19:47594279-47594301 GTTGGTGAGGGGCTGGTGGAAGG - Intergenic
1167158673 19:47754439-47754461 CTGGATGAGGGACAGATGGGAGG + Intronic
1167909336 19:52689502-52689524 CAGGGTGAGGGAGAGGAGGAGGG - Intronic
1167991819 19:53366666-53366688 CAGGGTGAGGGAGAGGAGGAGGG + Intronic
1167999469 19:53432912-53432934 CAGGGTGAGGGAGAGGAGGAGGG + Intronic
1168003841 19:53469673-53469695 CAGGGTGAGGGAGAGGAGGAGGG + Intronic
1168017265 19:53583523-53583545 CTTGGGGAGGCTGAGGTGGACGG + Intergenic
1168095049 19:54109795-54109817 CTGAGGGAGGGCCGGGTGGAGGG - Intronic
1168296095 19:55377924-55377946 CAGGGGGAGGGTCCGGCGGAGGG + Intronic
1168682558 19:58326746-58326768 CTGTGTGAGGGTGAGGGTGAGGG - Intergenic
925129600 2:1485048-1485070 TGGGGTGGGGGTCAGGGGGAGGG - Intronic
925260198 2:2522054-2522076 ATGGGGGATGGGCAGGTGGATGG - Intergenic
925872617 2:8284216-8284238 CTGGGAAAGGGACAGTTGGAGGG - Intergenic
926688130 2:15714300-15714322 GTGGGTGAGGGTGAGTGGGAAGG + Intronic
926766980 2:16330526-16330548 GTGGGTGGGGGCCAGGGGGAGGG - Intergenic
927219215 2:20691418-20691440 CTTTGTGAGGGTGAGGTGGGTGG - Intronic
927291827 2:21412326-21412348 CAGGGTGAGCTTCAAGTGGAAGG - Intergenic
927943159 2:27118532-27118554 CTGGGGGAGGGGCAGCTGGCGGG - Intronic
928349797 2:30539356-30539378 CAGGAGGAGGGTGAGGTGGAAGG - Intronic
928364181 2:30689124-30689146 CTGGTGGAGGGACAGGTTGAGGG - Intergenic
928989338 2:37215871-37215893 CTGGGTGATGGTAATGGGGAGGG + Intronic
929743608 2:44631247-44631269 TTGGGTGGGGGTAAGGGGGAGGG + Intronic
929943298 2:46351583-46351605 CAGGCTGTGGGTCAGGTGGAGGG + Intronic
930704301 2:54489075-54489097 CTTGGGGAGGCTGAGGTGGAAGG + Intronic
931255673 2:60569964-60569986 TTGGGGCAGGGTTAGGTGGAGGG - Intergenic
931372006 2:61672298-61672320 CTGGGTGAGGGAAGGGTGGATGG + Intergenic
931450298 2:62362634-62362656 CTGGCTGAGGGCCAGGTGATGGG + Intergenic
932338272 2:70943422-70943444 CTGGGGGAGGGCCAGGCAGAGGG - Intronic
932763512 2:74455933-74455955 CTGGGTGAGGATCTGGAGGTGGG + Exonic
933726567 2:85430649-85430671 CTGGGTGAGGGCTAGGAGGTGGG + Intronic
934981869 2:98849619-98849641 CTGGCTGAGAGTAGGGTGGAAGG - Intronic
935943939 2:108269358-108269380 ATGGGTCAGGGCCAGCTGGATGG - Intergenic
936007564 2:108904804-108904826 CTAGGTGAGGGTGGGGTGGGTGG + Intronic
936078619 2:109417530-109417552 CTGGCTGAGGGTCCTGTGGAGGG - Intronic
937279444 2:120707325-120707347 CTGGGAGGGGGAAAGGTGGAGGG + Intergenic
937883678 2:126886281-126886303 CTGGGCTAGGGCCAGGTGGCCGG - Intergenic
937890589 2:126935486-126935508 CTGGCTGTGTGTCTGGTGGATGG - Intergenic
937940929 2:127285445-127285467 CAGGGTGAGGCTGAGGTGGGCGG + Intronic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
938269019 2:129952489-129952511 CTGTGGGAGGGTGAGGTGGGTGG - Intergenic
938423785 2:131167245-131167267 CGGGGTGGGGGGCAAGTGGAGGG - Intronic
938456387 2:131467910-131467932 CTTGGTGAGGCTGAGGTGGGCGG - Intronic
938463934 2:131514795-131514817 CAGGATGAGGAGCAGGTGGAAGG + Intergenic
938547497 2:132347793-132347815 CTGGCTGATGGTCAGGGGAAAGG - Intergenic
938845165 2:135200997-135201019 CTTGGGGAGGCTGAGGTGGATGG - Intronic
938899670 2:135789516-135789538 AAGGGTGAAGGGCAGGTGGAAGG - Intronic
938928617 2:136066635-136066657 ATGGATGAGGGTGAGGTGGATGG + Intergenic
939089024 2:137757449-137757471 ATGGGGGAGGCTGAGGTGGAAGG - Intergenic
939882893 2:147650199-147650221 CTGGGTGTGTGTCATGTGGCAGG - Intergenic
939936747 2:148301977-148301999 TCAGGTGAGAGTCAGGTGGATGG - Intronic
940908664 2:159191145-159191167 CGGGGTGGTGGTCAGGTGGTTGG + Intronic
940925741 2:159361956-159361978 GGGGGTGAGGGTCTGGGGGAGGG + Intronic
941598080 2:167503357-167503379 CTGGCTGTTGGTCAGGTGAAGGG - Intergenic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942226992 2:173825741-173825763 CTGGGTGAGGGCAGGATGGAAGG + Intergenic
944536748 2:200717726-200717748 CTGTGGGAGGCTGAGGTGGAAGG + Intergenic
944582952 2:201148715-201148737 CTAGGTGAGGAACAGGTGGCTGG - Intronic
944797078 2:203198254-203198276 CTTTGTGAGGCTCAGGTGGGAGG - Intronic
946229558 2:218282989-218283011 CAGGGTGGGGGTAAGGGGGAGGG - Intronic
946324974 2:218980590-218980612 TGGGGTGAGGGGCGGGTGGAAGG + Intergenic
946324997 2:218980660-218980682 TGGGGTGAGGGGCGGGTGGAAGG + Intergenic
946325033 2:218980746-218980768 TGGGGTGAGGGTTGGGTGGAAGG + Intergenic
946365708 2:219247754-219247776 CTGGGTGAGGAGCATGTGGGTGG + Exonic
946522286 2:220479434-220479456 CTGAGGGAGGCTGAGGTGGAAGG + Intergenic
946856515 2:223955661-223955683 TTGGGTTAAGGTCAGGTGGAAGG - Intergenic
947332757 2:229047282-229047304 CAGGGTGGGGGCCAGATGGAAGG - Intronic
947694107 2:232168679-232168701 CTATGTGTGGGTCAGGTGGTAGG - Intronic
947909705 2:233792953-233792975 CTGGGTAAGGAGCAGATGGAGGG + Intronic
947946454 2:234107213-234107235 CGGGGTGGGGGTCAAGGGGAGGG + Intergenic
947984305 2:234436040-234436062 CTGGGTGTGTGTCAGAGGGAGGG - Intergenic
948348791 2:237321511-237321533 CTTGGGGAGGGTCATGTGGAGGG + Intergenic
948975300 2:241460099-241460121 CTGGGGGAGAGTCTGGTAGAGGG - Intronic
949027489 2:241773418-241773440 GAGGGTTAGGGGCAGGTGGAGGG + Intergenic
949034428 2:241810095-241810117 CTGGGGCAGGGGCAGGTGGGTGG - Intronic
1169141374 20:3229063-3229085 GTGGGTGAGGGTGGGGTGGGCGG - Intronic
1170821493 20:19758630-19758652 TGGGGTGAGGGACAGCTGGAGGG + Intergenic
1171230110 20:23477384-23477406 GTGGCTGAGGCTCAGGTGTAAGG + Intergenic
1171238897 20:23549357-23549379 CTTGCTGGAGGTCAGGTGGAAGG - Intergenic
1171876364 20:30580548-30580570 CTGGCTGATGGTCAGGGGAAAGG - Intergenic
1171994829 20:31723317-31723339 CTGGGTGAGGGTGAGGCGCTGGG + Intronic
1172666949 20:36606666-36606688 CTGGGTGAGTGTGAGGTGTGGGG + Intronic
1172738171 20:37144540-37144562 CTGGGGGAGGCTGAGGTGGGTGG - Intronic
1173005062 20:39133952-39133974 CTGGGTGGGGGTCGGTGGGAGGG + Intergenic
1173577753 20:44123999-44124021 CTGGGTGAGGGTCTGGAGGATGG + Intronic
1173691847 20:44966750-44966772 GTGGGTGAGGGTCCGGCTGAGGG + Intronic
1173852653 20:46228569-46228591 GTGGGGGAGGGTCAGGTGGAGGG + Intronic
1174116894 20:48232418-48232440 CTGGGAGAGGGAGAGGTAGAGGG - Intergenic
1174156966 20:48521833-48521855 CTGGGTGAGGATCAGGGTGGGGG - Intergenic
1174396225 20:50248345-50248367 CTGGGTGAGGGGCAGATGGGTGG - Intergenic
1174976754 20:55344464-55344486 GTGGTGGAGGCTCAGGTGGAAGG + Intergenic
1175244823 20:57575678-57575700 CTGCGTGAGGATTGGGTGGATGG + Intergenic
1175337713 20:58206933-58206955 CTGGGCGAGGGTGAGATGGTGGG - Intergenic
1175422004 20:58840567-58840589 CTGGGTGAGGGACTGGCCGAAGG - Intronic
1175545366 20:59774573-59774595 CTGGGGGAGGAACAGGTCGAGGG + Intronic
1175862838 20:62159363-62159385 CTGGGTGTGGGTGGGGTGAAGGG + Intronic
1176144532 20:63559676-63559698 CGGAGTCAGGGTCAGGTGGGAGG + Intronic
1176230481 20:64030205-64030227 CTGAGTGTGGGTCAGGAGGCTGG + Intronic
1176239153 20:64067911-64067933 CTGGGTGAGGGGCTGGGGGCGGG + Intronic
1176278372 20:64286996-64287018 CAGGGTGAGGGTGAGGGTGAGGG + Intronic
1176386163 21:6139410-6139432 CTGGCTGAGGGTCACCTGCAGGG + Intergenic
1176857792 21:13985631-13985653 CTGGGTCAGGGCCAGGAGCAAGG - Intergenic
1176866798 21:14058558-14058580 CTGGGTCAGGGCCAGGAGCAAGG + Intergenic
1178935238 21:36856059-36856081 GTGGGTGGGGGGCAGGGGGAAGG + Intronic
1179010017 21:37549308-37549330 CTAGGTGATGGTCAGGCGGCTGG - Intergenic
1179126822 21:38598395-38598417 CTTGTTCAGGGCCAGGTGGATGG - Intronic
1179554498 21:42163590-42163612 CTGGATGAGGGGGAGGAGGAGGG + Intergenic
1179602484 21:42489409-42489431 CTGGTTGTGGGTCAGTTGGCTGG + Intronic
1179737310 21:43398842-43398864 CTGGCTGAGGGTCACCTGCAGGG - Intergenic
1179835956 21:44033615-44033637 CTGTAGGAGGGTCAGGTGGGAGG + Intronic
1180184854 21:46134449-46134471 CAGGGTCAGGGTCAGGGTGAGGG + Intergenic
1180184859 21:46134467-46134489 GAGGGTGAGGGTCAGGTTTAGGG + Intergenic
1180184867 21:46134491-46134513 CAGGGTGAGGGTGAGGGTGAGGG + Intergenic
1180184874 21:46134515-46134537 GAGGGTGAGGGTCAGGTTTAGGG + Intergenic
1180184885 21:46134551-46134573 GAGGGTGAGGGTCAGGTTTAGGG + Intergenic
1180184890 21:46134569-46134591 TAGGGTGAGGGTCAGGTTTAGGG + Intergenic
1180184899 21:46134599-46134621 CAGGGTCAGGGTCAGGTTTAGGG + Intergenic
1180184907 21:46134623-46134645 CAGGGTGAGGGTGAGGGTGAGGG + Intergenic
1180184914 21:46134647-46134669 GAGGGTGAGGGTCAGGTTTAGGG + Intergenic
1180184923 21:46134677-46134699 CAGGGTGAGGGTCAGGTTTAGGG + Intergenic
1180864490 22:19108464-19108486 CTCGGTGAGGGTGAGGTGGCAGG + Intronic
1180895902 22:19331877-19331899 AAGGCTGAGGGTCAGGTGGCTGG + Intronic
1181127513 22:20710670-20710692 CTGGGTGAGGGCCAGGGTGGAGG - Intronic
1181240845 22:21475973-21475995 CTGGGTGAGGGCCAGGGTGGAGG - Intergenic
1181318253 22:21985148-21985170 CTGGCAGAGGGTCAGCTGCAGGG - Intergenic
1181609744 22:24004510-24004532 CTGAGTGAGGGTCAGAGGGGTGG - Intergenic
1182104399 22:27679063-27679085 CTGGGTGGGGGACAGAGGGAGGG - Intergenic
1182304030 22:29355650-29355672 CTGGGTGAGGCTGAGATGGGTGG + Intronic
1182800735 22:33029896-33029918 CTGTGTGAGGGTCAGGGCGTGGG - Intronic
1183233127 22:36595600-36595622 GTGGGTGAGGGTGAGGGTGAGGG + Intronic
1183430228 22:37761560-37761582 TTGGGAGAGGGCCAGGTGTAAGG + Intronic
1183715500 22:39530956-39530978 CGGGGGGAGGGGCATGTGGAAGG + Intronic
1183982664 22:41551133-41551155 CGGGGTGAGGGGCAGTGGGAGGG + Intergenic
1184415985 22:44352157-44352179 GGGGGTGAGGGTGAGGTTGAGGG - Intergenic
1184520783 22:44992752-44992774 CGGGGTGGGGGACAGGAGGACGG + Intronic
1184678272 22:46054950-46054972 CTGGGTGAGACTCAGGGGCATGG + Intronic
1184729766 22:46365945-46365967 CTGGGTGGGGGAAAGGTGGTGGG + Intronic
1184777084 22:46628635-46628657 GTGTCTGAGGGGCAGGTGGAGGG + Intronic
1185035349 22:48473343-48473365 CCGGGTCAGGATCACGTGGAGGG - Intergenic
1185149046 22:49153917-49153939 CAGGGTGTGGGTAAGGTGGGAGG + Intergenic
1185276407 22:49951825-49951847 CTGGGGCAGGGCCAGTTGGAAGG + Intergenic
949089445 3:10896-10918 CGGGGTGAGGGTGAGGGTGAGGG - Intergenic
949384874 3:3489814-3489836 CTGGGGGAGGGTGAGCTGGACGG - Intergenic
950253091 3:11483182-11483204 CTGGGTTAGGGGCAGGGGGACGG - Intronic
950789684 3:15462271-15462293 CTTGGGGAGGCTGAGGTGGACGG - Intronic
950841893 3:15975812-15975834 CTGTGTGAGGCTGAGGTGGGTGG + Intergenic
952348449 3:32510748-32510770 GTGGGTGGGAATCAGGTGGAAGG - Intergenic
952848869 3:37711645-37711667 CTGTGAGAGGCTCAGGTGGGAGG - Intronic
953773184 3:45794393-45794415 GAGGGTGTGGGTCTGGTGGATGG - Intronic
954061863 3:48074609-48074631 CAGGGTGAGGATAAGGTGGGAGG - Intronic
954996851 3:54889573-54889595 CTGGGGGAGGATCAGGTTTAGGG + Intronic
955280369 3:57589157-57589179 CTGGGTGAGGCTGAGATGGGAGG + Intronic
955422990 3:58758679-58758701 GTGGGTGAGGGGAAGGGGGAGGG - Intronic
955576406 3:60369213-60369235 CTGTGTGAGGCTGAGGTGGGAGG - Intronic
956126410 3:66015026-66015048 CTGGGTGAGGGGATGGTGGTGGG - Intronic
956145058 3:66183824-66183846 CAGGGTGAGGGTGAGGATGAAGG - Intronic
956145721 3:66188902-66188924 TAGGGTGAGGGTCAGGTTCAAGG - Intronic
956146765 3:66198580-66198602 CTGGGTGAGAGTAATGTAGAGGG - Intronic
956570666 3:70690888-70690910 GTGGGTGAGGGGCAAGGGGAGGG - Intergenic
959187093 3:103058075-103058097 ATGGGTGAGGGCCAAGGGGAGGG - Intergenic
959817502 3:110692009-110692031 CTGTGGGAGAGTCAGGTGGAAGG + Intergenic
960788500 3:121400214-121400236 CTGGGTGAGAGGTAGGTGGGAGG - Intronic
960991092 3:123311835-123311857 GTGGGGGAGGGGCCGGTGGATGG - Intronic
961012762 3:123447448-123447470 CAGGGCGATGGCCAGGTGGAGGG + Exonic
961093782 3:124137800-124137822 CTGGGTGTGGGTCGGATGCAGGG + Intronic
961336974 3:126186487-126186509 CAGGGTCAGGGTCAGGTTCAGGG - Intronic
961460160 3:127045119-127045141 CTGGCTCAGGTGCAGGTGGAGGG + Intergenic
961819895 3:129570707-129570729 CTGGGTGAGGGGCAGATGCTTGG + Intronic
962771771 3:138618087-138618109 CTGGGGGAGGCTAAGGTGGGAGG - Intronic
963138026 3:141925221-141925243 CTTTGGGAGGGTGAGGTGGAAGG + Intronic
963942412 3:151108234-151108256 TGGGGTGAGGGGCAGGTGGTGGG + Intronic
964612877 3:158632439-158632461 TTGAGTGAGGGGCAGGGGGAGGG + Intergenic
965450526 3:168832875-168832897 CTGGGCCAGGGTGGGGTGGATGG - Intergenic
965651836 3:170942428-170942450 CTGGGTGAGGGGGTGGTGTATGG + Intergenic
965698954 3:171439838-171439860 TTGAGTGAGGGCCAGGTGGGTGG - Intronic
966786361 3:183626296-183626318 CTTTGGGAGGGTCAGGTGGGTGG - Intergenic
966880116 3:184345316-184345338 CTGTGTGAGGGTGGGGTGGGAGG + Intronic
966935909 3:184709349-184709371 GTGGGTGAGGGTCGGGGGCAGGG - Intergenic
966995562 3:185276674-185276696 CAGGGTGAGGGTCAAGTAGATGG + Intronic
967143290 3:186582712-186582734 CTAGGTGAGCCTCACGTGGATGG + Exonic
967919058 3:194601013-194601035 GTGGGTGAGGGTTATGCGGAGGG + Intronic
967983327 3:195078325-195078347 CAGTGTGAGGGACAGGTGGCCGG - Intronic
968042298 3:195598914-195598936 ATGGGTGGGGGTCAGGTGTGGGG - Intergenic
968132422 3:196199288-196199310 TTGGGAGGGGGTGAGGTGGATGG - Intronic
968177679 3:196565541-196565563 CTGGGTGAGAGTCGGGGTGAGGG + Intronic
968364223 3:198172982-198173004 GTGGGTGAGGGTGAGGATGAAGG + Intergenic
968364408 3:198173597-198173619 GTGGGTGAGGGTGAGGATGAAGG + Intergenic
968364491 3:198173866-198173888 GTGGGTGAGGGTGAGGATGAAGG + Intergenic
968364518 3:198173951-198173973 GTGGGTGAGGGTGAGGATGAAGG + Intergenic
968364564 3:198174096-198174118 GTGGGTGAGGGTGAGGATGAAGG + Intergenic
968641559 4:1717484-1717506 CTGGGCCAGGGCCGGGTGGATGG - Intronic
968919650 4:3515840-3515862 CTTGGTGCGGGTCCTGTGGATGG - Intronic
968930254 4:3575207-3575229 GTGGGTGTTGGGCAGGTGGAGGG + Intergenic
969158714 4:5236244-5236266 CTGAGTGAGTGCCAGGTGGAAGG - Intronic
969564716 4:7971006-7971028 CTGGGTGAGGGTCACATGAGGGG + Intronic
971134113 4:23848393-23848415 CTGGGAGAGGGTTAGCTCGAGGG - Intronic
971653891 4:29316959-29316981 TGGGGTGAGGGGCAGGGGGAGGG - Intergenic
973237101 4:47917184-47917206 CAGGGTGGGGGGCTGGTGGAGGG - Intronic
973804615 4:54513796-54513818 CTGGCTGGGGGTCAGGCAGAGGG - Intergenic
974256117 4:59457736-59457758 ATGGGAGAGGGTCAGCGGGAAGG - Intergenic
975653500 4:76618194-76618216 CTTGGGGAGGCTGAGGTGGAAGG + Intronic
976497753 4:85750026-85750048 GTACGTGAGGGGCAGGTGGATGG - Intronic
977127254 4:93185887-93185909 TGGGGTGGGGGTCAGGGGGAGGG - Intronic
977748059 4:100575353-100575375 TTGGGGGAGGCTAAGGTGGAAGG - Intronic
978124827 4:105123182-105123204 CTTGGGGAGGCTGAGGTGGAAGG + Intergenic
978603248 4:110450331-110450353 CTGGTTGGGGGTCGGGAGGAGGG + Intronic
978973064 4:114834268-114834290 CTGTGTGAGGCTGAGGTGGGTGG + Intronic
980507491 4:133741436-133741458 CAGGGTGAAGGTTAGGAGGAGGG - Intergenic
980985693 4:139692300-139692322 CTGGGTGAGCAGCAGGTGGCTGG - Intronic
982234327 4:153238142-153238164 CTGGGTAAGGGTGAGCTTGAAGG + Intronic
982252431 4:153420708-153420730 CTTTGTGAGGGCCAGGTGGGAGG + Intergenic
983103851 4:163660403-163660425 GTGGGTGGGGGTCAAGGGGAGGG + Intronic
985462855 4:190122545-190122567 CAGGGTCAGGGTCAGGGGTAGGG + Intergenic
985464539 4:190182208-190182230 TAGGGTGAGGGTCAGGGTGAGGG + Intronic
985470082 5:35879-35901 CAGGGTGAGGGTCTAGGGGAGGG + Intergenic
985471470 5:49730-49752 CTGGGTCAGGGTCAGGGTCAGGG + Intergenic
985511834 5:317899-317921 CAGGGTGAGGGGCAGGTGCAAGG - Intronic
985522960 5:387557-387579 CAGGGTGAAAGGCAGGTGGAGGG - Intronic
985790874 5:1926351-1926373 CTGGGGCAGGGGCAGGTGCAGGG - Intergenic
985809006 5:2069446-2069468 CAGAGTGAGTGTCAGCTGGAAGG - Intergenic
986181220 5:5394699-5394721 GTGGGTGAGGGACACGTGGTAGG - Intergenic
986602069 5:9482460-9482482 CTGGGTGAGTGGAAGGTGGGAGG + Intronic
987706904 5:21469809-21469831 GTGGGTGAGGGACACGTGGTAGG + Intergenic
988297023 5:29378512-29378534 CTGTGTGGGGGTCAGGCGAAGGG + Intergenic
990210603 5:53479206-53479228 CTGGGGGAGGGTCTGGCGGGGGG + Intergenic
990957656 5:61359605-61359627 CTGGGTGAGGGAAAGGATGATGG + Intronic
991516553 5:67442676-67442698 CTGAGGGTGGGTCAGGTGGTGGG - Intergenic
992436747 5:76761922-76761944 CTTTGGGAGGCTCAGGTGGAAGG + Intergenic
992896879 5:81253259-81253281 TTGGGTGGGGGTCGGGAGGAGGG + Intronic
993925453 5:93860049-93860071 CTTGGGGAGGCTGAGGTGGATGG + Intronic
994546174 5:101168835-101168857 TTGGGTGGGGGACAGGGGGAGGG + Intergenic
995058902 5:107792964-107792986 CTGGATGAGGGTCATTAGGAAGG + Intergenic
995477354 5:112561751-112561773 CTGGGTTAGGGTCAGGGGTGTGG - Intergenic
995495175 5:112734200-112734222 ATGGGAGATGGTTAGGTGGATGG + Intronic
995946012 5:117646812-117646834 CTGGGGAAGGGTTGGGTGGAGGG - Intergenic
997096448 5:130918631-130918653 GTGGGTGAGGGGCTGGGGGAGGG + Intergenic
997702158 5:135910204-135910226 CTGGGTCAGGGTCAGGGTCAGGG + Intergenic
998369595 5:141652208-141652230 CGGGGGGAGGATCAGGTTGAAGG - Intergenic
998417316 5:141955386-141955408 CAGGGTCGGGGTGAGGTGGAAGG + Exonic
999126128 5:149247561-149247583 CTGGGTGGGGGTCTGGTGGTGGG - Intronic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
1000486392 5:161849056-161849078 CTGGGGGAGGGGGAGGTTGAAGG + Intronic
1000553746 5:162697663-162697685 CTTGGTGTGGGTCTGGGGGATGG - Intergenic
1000759815 5:165208139-165208161 CTGGGGAGGGGTCAGGGGGAAGG + Intergenic
1000900608 5:166907523-166907545 CTATGTCAGGGTAAGGTGGAGGG + Intergenic
1001042384 5:168346124-168346146 CTCGGTGGGCTTCAGGTGGAGGG - Intronic
1001645270 5:173276697-173276719 CAGGGTGAGGGGCAAGGGGAGGG + Intergenic
1001663463 5:173413474-173413496 CTGGGTGAGGGGATGGTGGGGGG + Intergenic
1001701739 5:173711753-173711775 ATGGATGATGGTCAGATGGATGG + Intergenic
1001729409 5:173939042-173939064 CTTGGGGAGGCCCAGGTGGATGG + Intronic
1001873719 5:175181152-175181174 CTGGTTTAGGGTTAGGTGAATGG - Intergenic
1001976477 5:176003996-176004018 CTGTGGGAGGCTGAGGTGGATGG + Intronic
1002106222 5:176880603-176880625 CTGGGGGAGGGGCAGGGGCAGGG - Exonic
1002576523 5:180177145-180177167 CTGGATGAGGGGCAGTGGGATGG + Intronic
1003320625 6:5047895-5047917 CTGGGTGGGGGTTATGAGGAAGG + Intergenic
1003507481 6:6751700-6751722 CTGGGGGAGGGGGAGGGGGAGGG - Intergenic
1003538694 6:6999476-6999498 CCTTGTGAGGCTCAGGTGGAAGG + Intergenic
1004147350 6:13080182-13080204 CTGGGTGGGGGTCAGGGGTCAGG - Intronic
1004458403 6:15813106-15813128 ATGGATGATGGGCAGGTGGACGG + Intergenic
1005695184 6:28345216-28345238 CTGGGAAAGAGTCATGTGGATGG + Intronic
1005859076 6:29887798-29887820 CTGGGTCAGGGTCAGGGCCAGGG - Intergenic
1005891055 6:30138701-30138723 CTGGATTAGGGTCAGGGGAAAGG - Intronic
1005892662 6:30153076-30153098 CTGGGTGAGATTAAGGTGCAGGG - Exonic
1005963140 6:30707600-30707622 CTGGGAGCCAGTCAGGTGGAAGG - Exonic
1006364880 6:33609560-33609582 CTGGATGAGGGTCAGAAGGGAGG + Intergenic
1006712773 6:36089381-36089403 TGGGGTGGGGGTCAGGCGGAGGG + Intronic
1007315340 6:40983780-40983802 CTGGGATGGGGGCAGGTGGAAGG - Intergenic
1007343246 6:41207349-41207371 ATAGGTGATGGTCATGTGGAAGG + Intergenic
1007578487 6:42940993-42941015 ATGGCTGGGGGTGAGGTGGAGGG + Intergenic
1007590871 6:43020303-43020325 CCTGGTGAGGGTAAGGTGGAGGG + Intronic
1007769838 6:44183812-44183834 CTGGGTGGGGGTGGGGTTGAGGG - Intronic
1008149458 6:47932731-47932753 CAGTGTGAGGGTCAGGAGCACGG + Intronic
1008287651 6:49673322-49673344 GAGGGTGCGGGTCTGGTGGAGGG + Intergenic
1009021318 6:57950690-57950712 GTGGGTGAGGGACACGTGGTAGG - Intergenic
1012366544 6:98447551-98447573 CTGGGTGAGGAGGAGGTAGAAGG - Intergenic
1012993739 6:105952023-105952045 CTTTGGGAGGCTCAGGTGGACGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013412874 6:109897426-109897448 CTGAGTGAGGCTAAGCTGGAGGG - Intergenic
1013575953 6:111483457-111483479 CTGGGTGAGGGGCAGCGGAAGGG + Intronic
1014237036 6:118969788-118969810 CGGGGTGGGGGGCAGGGGGAGGG - Intronic
1014645056 6:123962911-123962933 GTGGGTGAGTGGCAGGTGGCTGG - Intronic
1014697831 6:124645927-124645949 CTGGGTGAGGGTGAGGCAGTGGG - Intronic
1015319245 6:131853668-131853690 GTGTGTGAGGGTAAGGTGGGAGG + Intronic
1016039005 6:139412487-139412509 TGGGGTGAGGGGCAGGGGGAGGG + Intergenic
1016198662 6:141379119-141379141 GCGGGTGGGGGTCAAGTGGAAGG + Intergenic
1016827777 6:148404581-148404603 CTGGGGGTGGGGCAGGTGGTGGG - Intronic
1018476060 6:164142930-164142952 CTGAGGGAGGGTCTGGAGGAAGG + Intergenic
1018749231 6:166788685-166788707 CGGGGTGAGGGGCAAGGGGAGGG + Intronic
1020641070 7:10754246-10754268 GTGGATGAGGGTCTGGGGGAGGG + Intergenic
1020643311 7:10782565-10782587 CTGTGTGAGGCTGAGGTGGGTGG + Intergenic
1022489150 7:30803465-30803487 CTGTTTCAGGGTCAGATGGATGG + Intronic
1023015774 7:35967953-35967975 CTTGGTGCGGGCCAGGTGGGAGG - Intergenic
1023383301 7:39629970-39629992 CTTGGGGAGGCTGAGGTGGACGG - Intronic
1023440037 7:40175986-40176008 CTGTGGGAGGCTGAGGTGGATGG + Intronic
1023479680 7:40620644-40620666 CTTTGGGAGGCTCAGGTGGATGG - Intronic
1023608020 7:41947191-41947213 TGGGGTGAGGGTCAGGGTGAGGG + Intergenic
1023861455 7:44219793-44219815 CTGGGTGGGTTGCAGGTGGATGG - Intronic
1024220317 7:47281918-47281940 CAGGGTCAGGGTCAGGGGCATGG - Intronic
1024283621 7:47738902-47738924 GTGGGGGAGGGTCTGGTGGAGGG - Intronic
1024838193 7:53549587-53549609 CTTAGTGAGGGTCTGGAGGAAGG - Intergenic
1025008208 7:55371917-55371939 GTGTGTGTGTGTCAGGTGGAAGG + Intronic
1025187129 7:56870155-56870177 CTTTGTGAGGCTCAGGTGGGTGG + Intergenic
1025227111 7:57175376-57175398 CTTGGGGAGGCTGAGGTGGAAGG + Intergenic
1025230339 7:57199960-57199982 CTTTGTGAGGCTGAGGTGGATGG + Intergenic
1025656599 7:63525379-63525401 TTTGGGGAGGCTCAGGTGGAAGG + Intergenic
1025684793 7:63706762-63706784 CTTTGTGAGGCTCAGGTGGGTGG - Intergenic
1025949255 7:66130622-66130644 CTGGGTGATGGGCGGGTGAAAGG + Intronic
1026298266 7:69075097-69075119 CTGGGTGAGGGTAAGTTGTTGGG - Intergenic
1026878640 7:73894215-73894237 CAGGGTGAGGTTGGGGTGGAGGG + Intergenic
1027033891 7:74911001-74911023 GTGGCTGCGGGTGAGGTGGATGG + Intergenic
1027046083 7:74992134-74992156 CTGGGTGGGGCTCAGGGGGATGG + Intronic
1027162777 7:75814455-75814477 CTTGGGGAGGCTGAGGTGGAAGG + Intronic
1027233438 7:76284662-76284684 CTGAGTGGGTGCCAGGTGGAAGG - Intronic
1027323284 7:77028306-77028328 GTGGCTGCGGGTGAGGTGGATGG + Intergenic
1027327005 7:77056714-77056736 GTGGCTGCGGGTGAGGTGGATGG + Intergenic
1028280522 7:88921127-88921149 AAGGGTGAGTGTGAGGTGGAAGG + Intronic
1028815110 7:95134318-95134340 GTGGGTGGGGGTCAAGGGGAGGG + Intronic
1029159833 7:98543787-98543809 ATGGCTGAGGGTCAGGTGGGTGG - Intergenic
1029386746 7:100248460-100248482 CTGGGTGGGGGTCAGGGGGATGG - Intronic
1029745127 7:102512338-102512360 CTGGGAGAGGGACAGAGGGAGGG + Intronic
1029763119 7:102611499-102611521 CTGGGAGAGGGACAGAGGGAGGG + Intronic
1030667009 7:112289831-112289853 CTTGGGGAGGCTGAGGTGGAAGG - Intronic
1031468574 7:122143706-122143728 CTGGCTGAGGGGGCGGTGGATGG - Intronic
1031941762 7:127797134-127797156 CTGTGGGAGGGTGAGGTGGGTGG - Intronic
1032115873 7:129116618-129116640 GTGGGTGGGGGACAGGGGGAGGG + Intergenic
1032197606 7:129798586-129798608 CTGGGGGTGGGTCAGGTGGGTGG - Intergenic
1032197890 7:129799730-129799752 CTGGATGGGGGGCAGGTGGTAGG + Intergenic
1032377562 7:131437215-131437237 AGGGGTGGGGGTCAGGGGGAGGG - Intronic
1032724480 7:134577835-134577857 CTGGTAGAGGGTTAGTTGGAAGG + Intronic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033637808 7:143228245-143228267 CGGGGTGGGGGGCTGGTGGAGGG - Intergenic
1033912964 7:146286860-146286882 CTTTGTGAGGCTGAGGTGGAAGG + Intronic
1034221086 7:149446792-149446814 GTGGGTGAGGAGCAGGTGGGAGG - Intronic
1034244838 7:149636405-149636427 GAGGGTGAGGGTGGGGTGGATGG - Intergenic
1034438247 7:151073958-151073980 CTCAGTGAGTGTCGGGTGGAAGG - Intronic
1035160063 7:156943723-156943745 CTGGGGCGGGGACAGGTGGATGG + Intergenic
1035532061 8:360887-360909 CTTTGTGAGGCTGAGGTGGATGG - Intergenic
1035570982 8:671988-672010 TTGGGTGAGGGTCTGGGGAAAGG - Intronic
1036124102 8:6047312-6047334 TTGGGTATGGGTCAGGTGGGCGG - Intergenic
1036619065 8:10411078-10411100 CTGAGTGGAGGTCAGATGGAGGG - Intronic
1036954416 8:13171848-13171870 CCAGGTGAGGGTCAATTGGAGGG + Intronic
1037743505 8:21625702-21625724 CTGGGGGAGGATCAGGTTGTAGG + Intergenic
1038526512 8:28278769-28278791 CTGGGTGAGGGGTAGACGGAGGG + Intergenic
1038621821 8:29151174-29151196 CTGGGTTAGGGTTTGGTTGAGGG - Intronic
1040014249 8:42688364-42688386 CGGGGTGGGGGGCAGGGGGAGGG + Intergenic
1040737796 8:50531728-50531750 TTGTGTGAGGGACACGTGGAGGG - Intronic
1041192996 8:55372335-55372357 CTGGCTAAAGGTCAGGTGAATGG - Intronic
1041484726 8:58362447-58362469 CTTTGTGAGGGTGAGGTGGGTGG - Intergenic
1041500170 8:58531684-58531706 GTGGGTGAGGGGCAAGGGGAGGG + Intergenic
1043054599 8:75421945-75421967 GTGTGTGCGCGTCAGGTGGAGGG + Intronic
1043108717 8:76150380-76150402 CTGTGGGAGGCTGAGGTGGATGG - Intergenic
1043352024 8:79372979-79373001 CGGGGTGGGGGGCAGGGGGAGGG + Intergenic
1043422322 8:80110960-80110982 CTTTGGGAGGGTGAGGTGGAAGG + Intronic
1043516170 8:80996792-80996814 TTGAGTGAGGGGAAGGTGGAGGG + Intronic
1043791589 8:84475051-84475073 CTGGGTGGGGGGCTGGGGGAGGG - Intronic
1044689100 8:94859170-94859192 CTTGGGGAGGTTGAGGTGGAAGG + Intronic
1045161047 8:99544313-99544335 TGGGGTGGGGGTCAGGGGGAGGG + Intronic
1045170679 8:99664458-99664480 TGGGGTGGGGGTCAGGGGGAGGG - Intronic
1045305866 8:100956180-100956202 CTGTGGGAGGGTGAGGTGGATGG + Intergenic
1045397297 8:101773553-101773575 CTAGGTGATGCTCAGGTGCAGGG - Intronic
1045482274 8:102601691-102601713 CAAAGTGAAGGTCAGGTGGAAGG + Intergenic
1046097501 8:109578720-109578742 GTGGGTGAGGGTCAGGGGATGGG + Intronic
1046507446 8:115154361-115154383 CTGGGTGATGGTGGGGTGGGAGG - Intergenic
1047523590 8:125614514-125614536 GTGTGTGAGGGTCAGGTGTGAGG + Intergenic
1048265738 8:132984031-132984053 CTAGATGGGGGTGAGGTGGAGGG + Intronic
1048875463 8:138833794-138833816 TTGGGTGAGGGTCAAGGGTAAGG + Intronic
1048898333 8:139015081-139015103 CTGGGAGTGGGTGATGTGGAAGG - Intergenic
1048929239 8:139297925-139297947 CTGGGTGGGGGGCAAGGGGAGGG + Intergenic
1049142121 8:140964333-140964355 CTGAGGGAGGCTCAGGTGGGAGG - Intronic
1049300702 8:141867935-141867957 CTGGGTGACGGACAGGTGTCAGG - Intergenic
1049534025 8:143169752-143169774 CTGGCTCATGGTCAGGTGGCAGG - Intergenic
1049612608 8:143562425-143562447 CTGGGAGAGAGTCAGGTAAAAGG - Intronic
1049680514 8:143915924-143915946 CTGTGTGAGTGGCAGGTAGAAGG + Exonic
1049718819 8:144106238-144106260 CTGGGTGAGGGTCAGGTGGAGGG + Exonic
1049807107 8:144546070-144546092 CTGGCTGAGGGTGAGGCGGGAGG + Intronic
1050281071 9:4050447-4050469 GTGGGTGGGGGTCTGGGGGAGGG + Intronic
1052618741 9:30877628-30877650 CTGGGTCAGGGTCTGAGGGACGG + Intergenic
1052677344 9:31644404-31644426 CGGGGTGGGGGTCTGGGGGAGGG - Intergenic
1052854909 9:33401187-33401209 CTGGGTGAAGGACAGGGGGCTGG + Intronic
1053123987 9:35564794-35564816 CTGGGTCAGGGCCAGGCTGAGGG + Intergenic
1054787336 9:69221793-69221815 CTGTGAGAGATTCAGGTGGACGG - Intronic
1055482937 9:76727820-76727842 CTCGGGGAGGCTGAGGTGGAAGG - Intronic
1055533346 9:77210338-77210360 GTGGGTGGGGGTGAGGTGGGAGG - Intronic
1056571491 9:87820655-87820677 GTAGGTGAGGGTCAGGTGCTGGG - Intergenic
1056640702 9:88368073-88368095 CAGGGGGAGGCTGAGGTGGAAGG + Intergenic
1056803837 9:89712910-89712932 CAGGGTGAGGGGCAGGGGCAGGG + Intergenic
1057275782 9:93675408-93675430 GCGGGTGAGGGTAATGTGGAAGG - Intronic
1057364875 9:94410344-94410366 CTTTGTGAGGCTCAGGTGGCAGG - Intronic
1058267307 9:102918696-102918718 CTGGGTGAGTGACAGCTGAATGG - Intergenic
1059427821 9:114232031-114232053 CTGGGTGGGGCTCAGGCAGATGG + Intronic
1059801953 9:117759042-117759064 GTGGGTGGGGGGCAGGGGGAGGG - Intergenic
1060276111 9:122184101-122184123 TTGGTTGAGGGTCTGGTGCATGG - Intronic
1060479351 9:124008934-124008956 CTGGGGGAGGGGGAGGTCGAGGG + Intronic
1060789847 9:126478598-126478620 CGGGAAGAGGGTCAGGTGCAAGG + Intronic
1060829354 9:126704051-126704073 ATGGGGGACGGTCAGGAGGAGGG + Intergenic
1062159300 9:135070882-135070904 TTGGCTGAGGTTCAGGTAGAGGG - Intergenic
1062346271 9:136116790-136116812 CTTGGTGCGGGCCAGGTGGGAGG + Exonic
1062642735 9:137529236-137529258 CTGTGGGAGGCTCAGGTGGGAGG - Intronic
1062708729 9:137960190-137960212 CTGAGTGAGGGGGAGGGGGAGGG + Intronic
1062748971 9:138237105-138237127 TTGGGTGAGGGTGAGGTGTGAGG + Intergenic
1185689207 X:2139442-2139464 ATGGGTGAATGGCAGGTGGATGG - Intergenic
1186214086 X:7280620-7280642 ATGGTTGGGGGTCAGGTGGAAGG + Intronic
1187273253 X:17797766-17797788 CTGGATGAGGGGCAGGCAGAGGG + Intergenic
1188518258 X:31010733-31010755 CGGGGTGGGGGTCTGGGGGAGGG - Intergenic
1189668363 X:43381296-43381318 ATAGGTGAGGATCAGGTGGTAGG - Intergenic
1189816509 X:44829643-44829665 ATGGGGGAGGGTGAGGTGGGAGG + Intergenic
1190103425 X:47540924-47540946 CTGTGTGAGGCTGAGGTGGGTGG - Intergenic
1190740337 X:53284365-53284387 CTGGGTGGGGTGCAGGTTGAAGG - Intronic
1190777236 X:53562674-53562696 CTGGCTGAGGATAAAGTGGATGG + Intronic
1192165164 X:68823496-68823518 TTGGCTGAGGGGCAGCTGGAGGG + Intergenic
1192222503 X:69207043-69207065 CTGAGTGAGGGCCAGGGTGAGGG + Intergenic
1192752519 X:74008774-74008796 CTGGGGGAGGCTGAGGTGGGCGG + Intergenic
1193280946 X:79650364-79650386 TGGGGTGGGGGGCAGGTGGAGGG - Intergenic
1193765342 X:85521895-85521917 CTGGGGAAGGGTCTGGTGGGAGG + Intergenic
1193824472 X:86205808-86205830 CTTTGGGAGGCTCAGGTGGAAGG - Intronic
1194931363 X:99891573-99891595 TGGGGTAAGGGTCAGGTAGATGG + Intergenic
1196387367 X:115173189-115173211 TTGGGTCAGGGTCAGCGGGATGG - Intronic
1197186400 X:123592198-123592220 CTTGGGGAGGCTGAGGTGGAAGG - Intergenic
1197761370 X:130030695-130030717 CTGGGGGAGGAACAGGGGGAAGG - Intronic
1199451343 X:147981712-147981734 CTGGGGGAGGGGGAGGGGGAGGG + Intronic
1200074930 X:153546170-153546192 CTGGGGGTGGGGCTGGTGGAGGG + Intronic
1200400857 X:156019911-156019933 CAGGGTGAGGGTCAGGGTCAGGG + Intergenic
1200400861 X:156019923-156019945 CAGGGTCAGGGTCAGGGTGAGGG + Intergenic
1200400873 X:156019965-156019987 CAGGGTGAGGGTCAGGGTCAGGG + Intergenic
1200400877 X:156019977-156019999 CAGGGTCAGGGTCAGGGTGAGGG + Intergenic
1200400887 X:156020006-156020028 TAGGGTGAGGGTCAGGGTGAGGG + Intergenic
1200400893 X:156020024-156020046 GAGGGTGAGGGTCAGGGTGAGGG + Intergenic
1200400951 X:156020193-156020215 CAGGGTGAGGGTCAGGGTCAGGG + Intergenic
1201073155 Y:10168535-10168557 CTGGCTGAGGGTGGGGAGGAGGG + Intergenic
1201413999 Y:13729636-13729658 CTGGGGGATGGGCAGGGGGAAGG - Intergenic
1201601268 Y:15730801-15730823 CTGGGTGGGGGGTAGGTGGCAGG + Intergenic