ID: 1049719154

View in Genome Browser
Species Human (GRCh38)
Location 8:144107641-144107663
Sequence GCCTGCGGTGTGGGAGTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 366}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049719139_1049719154 29 Left 1049719139 8:144107589-144107611 CCAATAAAAGTTTCTGTGACTTA 0: 2
1: 0
2: 0
3: 29
4: 291
Right 1049719154 8:144107641-144107663 GCCTGCGGTGTGGGAGTGGCCGG 0: 1
1: 0
2: 4
3: 41
4: 366
1049719148_1049719154 -1 Left 1049719148 8:144107619-144107641 CCTGATGCGGTGTGGGGGTGGGG 0: 1
1: 1
2: 6
3: 65
4: 785
Right 1049719154 8:144107641-144107663 GCCTGCGGTGTGGGAGTGGCCGG 0: 1
1: 0
2: 4
3: 41
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049719154 Original CRISPR GCCTGCGGTGTGGGAGTGGC CGG Intronic
900312971 1:2043363-2043385 GTCTGCAGTGCAGGAGTGGCAGG + Intergenic
900545555 1:3227220-3227242 GGCTGCGGTGTGTGAGCTGCAGG - Intronic
900827616 1:4939241-4939263 GGCTGCAGTTTGGCAGTGGCTGG - Intergenic
901181255 1:7343237-7343259 GCTTGGGGTGTGGGAGGGGAAGG + Intronic
901436536 1:9250375-9250397 GCCTGCGGTGTGTGTGGGGTGGG - Intronic
901436549 1:9250413-9250435 GCCTGCGGTGTGTGTGGGGTAGG - Intronic
901510452 1:9715828-9715850 GCCTGCGGGGTGGGGAGGGCTGG - Exonic
901565286 1:10109177-10109199 GCCTGCTGTGAGGAAGTGGCAGG + Intronic
901757341 1:11449345-11449367 GCCTGCGGTGTTGGGGTGGCTGG + Intergenic
903754653 1:25652449-25652471 GCCTGTGGGGTGGGAAGGGCTGG - Intronic
904009843 1:27383242-27383264 GCTCGCGGGGTGGGGGTGGCCGG + Exonic
904477610 1:30775113-30775135 GCCTGGGGTGAGGGAATGGGGGG + Intergenic
905172040 1:36115202-36115224 GCCTGAGGCCTGGGGGTGGCTGG - Intronic
905475766 1:38226722-38226744 GCCCTCACTGTGGGAGTGGCAGG + Intergenic
905562767 1:38940598-38940620 GCCTAAGGTGAGGGAGTTGCTGG + Intronic
906312947 1:44766941-44766963 CCCTGCGAGGTGGGTGTGGCTGG + Exonic
906416232 1:45622898-45622920 GGCTCCGGGGTGGGAGGGGCGGG - Intronic
906543196 1:46603974-46603996 GCCTGGGGTCGGGGCGTGGCCGG - Intronic
906870922 1:49479820-49479842 GCCTCCCAAGTGGGAGTGGCTGG + Intronic
907516598 1:54997058-54997080 GCCTGCGGAGTGGCAGGGGCTGG - Intergenic
908806331 1:67936941-67936963 GCCTGGGGTGGGGGGGTGGGAGG + Intergenic
915079298 1:153340627-153340649 GCCTACGGTGGAGAAGTGGCTGG - Intronic
915145797 1:153795182-153795204 GGGTGCGGTGTGGGCCTGGCGGG - Intergenic
915932296 1:160068268-160068290 GGGTGGGGAGTGGGAGTGGCAGG - Intronic
917521194 1:175749654-175749676 GCCTGGGGTGGGGGATGGGCAGG - Intergenic
917538163 1:175889404-175889426 GCCTGCGGAGTGTGATTGGAGGG - Intergenic
918154644 1:181832796-181832818 GCACGTGGTGTGGGACTGGCAGG + Intergenic
918790040 1:188813404-188813426 GCGGGCGCTGTGGGACTGGCAGG + Intergenic
919155319 1:193757218-193757240 GCCTGAGCTTTGGGAGGGGCAGG + Intergenic
920171390 1:204074326-204074348 GCCTGCGGTGGGGGTGGGGGTGG - Intronic
920618990 1:207525399-207525421 GCCTGCTCAGTGGGAGGGGCTGG - Intronic
920620771 1:207543955-207543977 GCCTGCTCAGTGGGAGGGGCTGG - Intronic
920622553 1:207562512-207562534 GCCTGCTCAGTGGGAGGGGCTGG - Intronic
920635278 1:207696152-207696174 GCCTGCTCAGTGGGAGGGGCTGG - Intronic
921068940 1:211643043-211643065 GCCTGGAGGGTGGCAGTGGCTGG + Intergenic
921767546 1:218990192-218990214 GACTGAGGTGTGGCACTGGCAGG + Intergenic
922412909 1:225392971-225392993 GACAGTGGCGTGGGAGTGGCAGG - Intronic
923373976 1:233341495-233341517 GCCTGCAGTGTGGAGGTGCCTGG + Intronic
923850687 1:237790908-237790930 GACTGATGTGTGGGGGTGGCAGG - Intronic
924172331 1:241356217-241356239 GGATGCGGTGGGGGAGTGGGGGG + Intronic
924313704 1:242774344-242774366 GCAAGCCGTGTGGGACTGGCGGG - Intergenic
924564094 1:245181606-245181628 ACCTGCGGTGTGTGTGTGGCTGG + Intronic
1063241538 10:4174666-4174688 GGCTGAGGTGGGAGAGTGGCTGG + Intergenic
1063379401 10:5574994-5575016 CCCTGCAGTGTGGGTGGGGCAGG - Intergenic
1065101539 10:22336319-22336341 GCCTGCGGGGCGGGGGTGGCGGG - Intergenic
1065981037 10:30897549-30897571 GCCTGGGGAGTGGAGGTGGCTGG - Intronic
1067278356 10:44853511-44853533 GCATGGAGTGTGGGAATGGCTGG - Intergenic
1067467293 10:46510661-46510683 CCCTGCAGTGTGGGAGTGCAGGG - Intergenic
1067619893 10:47873944-47873966 CCCTGCAGTGTGGGAGTGCAGGG + Intergenic
1068216752 10:53991197-53991219 GCGCGCGGTGCGGGACTGGCAGG + Intronic
1069794946 10:71046103-71046125 CCCTGGGGTCTGTGAGTGGCAGG + Intergenic
1069909942 10:71752788-71752810 GCCTGCTGAGTCGGGGTGGCAGG + Intronic
1070160830 10:73865857-73865879 GGCTGGGCTGTGGGAGGGGCGGG - Intronic
1073322091 10:102621575-102621597 GCCTGTGGAGTGGGGGTGGGAGG + Intronic
1075065706 10:119287702-119287724 GACAGCAGTGTGGGAGTGGGTGG - Intronic
1076007635 10:126960487-126960509 GACTGTCGTGGGGGAGTGGCAGG + Intronic
1076151373 10:128164274-128164296 GCCTGGGCTGTGGGAGTCTCAGG + Intergenic
1076201922 10:128566017-128566039 GCCACAGGTGTGGGAGAGGCAGG - Intergenic
1076697748 10:132255338-132255360 ACCTGAGGAGTGGGAGTGGGGGG - Intronic
1076767119 10:132642209-132642231 GCCTGGGGCGTGGGAGTGGGTGG + Intronic
1077026408 11:441858-441880 GCCCCAGGTGTGGGCGTGGCTGG + Intronic
1077063471 11:627423-627445 GCCTGCGGGGGCGGAGGGGCCGG + Intergenic
1077074047 11:692029-692051 CCCTGCGGTGGAGGAGAGGCAGG - Intronic
1077080787 11:723890-723912 TCCTGGGGTGTGGGAGGGTCAGG - Intronic
1077184434 11:1229929-1229951 GCCTGCGGTGGGGGTGTGGAGGG + Intronic
1077648107 11:3944451-3944473 GCCTGTGTAGTGGGAGTGGAGGG + Intronic
1078103873 11:8346302-8346324 CCCTGCGGGGTGGGAGAGGTGGG + Intergenic
1079034897 11:17013429-17013451 GCCTGCGGGGAGGGAGGGGGTGG - Intronic
1081136087 11:39442060-39442082 GCACACGGTGTGGGACTGGCAGG - Intergenic
1081315265 11:41623222-41623244 GCCCACGGCGTGGGACTGGCAGG + Intergenic
1081670381 11:44939061-44939083 GCTGGCGGTGGGGGAGTGGGGGG - Intronic
1081967191 11:47177135-47177157 GGTTGCGGCGTGGGAGGGGCGGG - Intergenic
1082807465 11:57460104-57460126 GCTTGAGGTCTGGGAGTGGAAGG + Intergenic
1083445841 11:62707556-62707578 GCCTGCAATGGGGGAGGGGCAGG + Intronic
1083630838 11:64094574-64094596 GCCTGCGGTTAGGCAGGGGCAGG - Intronic
1085521843 11:77143716-77143738 CCCTGCGGTGTGCCAGGGGCTGG + Intronic
1088220652 11:107566683-107566705 GCCTGCAGAGTGGGAGTTGCAGG + Intergenic
1088893126 11:114059876-114059898 GGCTGCGGTGAGTGAGGGGCCGG + Exonic
1089769802 11:120794780-120794802 GTCTGTGGTGTGGGAGGAGCTGG + Intronic
1090293880 11:125569524-125569546 GCCTGCGGTGGGCTAGGGGCAGG + Exonic
1090836201 11:130455871-130455893 GCCTGGGGAGAGGGAGAGGCAGG - Intronic
1091770538 12:3148495-3148517 GCCAGCGGTGGGGCTGTGGCTGG + Intronic
1092000679 12:5029458-5029480 GCCTGTTGTGGGGGAGTGGGGGG + Intergenic
1094191731 12:27705414-27705436 TCCTGCGGTGGCGAAGTGGCAGG - Intergenic
1095582658 12:43818360-43818382 GGGTGGGGTGTGGGAGTGGGGGG - Intergenic
1096101480 12:48972711-48972733 GGCTGCGGTCTGGCAGGGGCGGG - Intergenic
1096629430 12:52916301-52916323 GCCTGCAGTGTGGTAGGAGCAGG + Intronic
1099243438 12:80165658-80165680 GCCTGAGGTTTGGCAGTGGCTGG + Intergenic
1101072511 12:101090594-101090616 GCCGGGGGTGTGGGTGAGGCGGG + Intronic
1103201840 12:119094204-119094226 GCCTGTGGAGAGGGAGTGGTGGG + Intronic
1103238862 12:119397690-119397712 GGCAGCGGGGTGGGACTGGCCGG - Intronic
1103334346 12:120178021-120178043 GCGAGCGGGGTTGGAGTGGCAGG - Intronic
1104127557 12:125861958-125861980 GGCTGCGGTGCTGGAGTGGCGGG + Intergenic
1104423435 12:128655730-128655752 GCTTGCAGTTTGGGAATGGCAGG - Intronic
1104463050 12:128970463-128970485 GGCTGCGGGGAGGGAGTGGGCGG - Intronic
1104827732 12:131725667-131725689 GCCTGTGTTGTGGGGGCGGCAGG + Intronic
1104841758 12:131829035-131829057 GCGTTCCGGGTGGGAGTGGCGGG + Intronic
1104844665 12:131840788-131840810 CCCGGCGGTGTGGTGGTGGCCGG - Exonic
1104874539 12:132024801-132024823 GGCTGCTGTGGGGGGGTGGCGGG - Intronic
1105292580 13:19062200-19062222 GCCCCCAGTGTGGCAGTGGCTGG + Intergenic
1105578548 13:21674137-21674159 GTTTGCGGTGTGGGAACGGCTGG + Intronic
1105762069 13:23524470-23524492 GCGTGTGGCGTGGGACTGGCAGG + Intergenic
1106401671 13:29437024-29437046 GCCTGTGGGGAAGGAGTGGCTGG - Intronic
1106533520 13:30617700-30617722 GCCCGCCATGTGTGAGTGGCTGG - Intronic
1106848678 13:33764892-33764914 GCCTCAGGTGTGGGAGAGGGAGG + Intergenic
1108206453 13:48095014-48095036 GGAGGCGGTTTGGGAGTGGCGGG - Exonic
1108322891 13:49304289-49304311 ACCCGAGGTGTGGGGGTGGCTGG - Intergenic
1108340163 13:49491442-49491464 GCCTGCAGTGTGGAAGTAGCTGG - Intronic
1108498293 13:51045867-51045889 GCCTGAGGGGAGGGAGGGGCAGG - Intergenic
1108686803 13:52826641-52826663 GCGGGAGGTGCGGGAGTGGCAGG + Intergenic
1108750186 13:53440033-53440055 GCCTGCAGTGTGGGACTGGTAGG + Intergenic
1111430659 13:88145128-88145150 GTGTGCGATGTGGGCGTGGCTGG - Intergenic
1112094415 13:96116372-96116394 AACTGTGGGGTGGGAGTGGCAGG + Intronic
1113550155 13:111186459-111186481 CCCTGGGGTGTAGGAGTGGGTGG + Intronic
1113714894 13:112496644-112496666 GCTGGCCGTGTGGGAGTGGAAGG - Intronic
1114554783 14:23555793-23555815 GCCTGCGTTGGGGGTGCGGCGGG + Intronic
1114587440 14:23827202-23827224 GGCTGAGGACTGGGAGTGGCTGG - Intergenic
1114633018 14:24171785-24171807 GCTTGCGGCGGGGGAGCGGCGGG + Intergenic
1115951254 14:38724751-38724773 GAATGTGGTGTGGGAGGGGCTGG - Intergenic
1119208488 14:72812248-72812270 GCCTGTGGGATGGGAGAGGCTGG - Intronic
1121145466 14:91578359-91578381 GCCAGCGGTGCGGGACTGGCGGG + Intergenic
1122020363 14:98833252-98833274 GGCTGGAGTGTGGGAGTGGAAGG - Intergenic
1122625904 14:103085259-103085281 GGGTGGGGTGTGGCAGTGGCTGG - Intergenic
1122771162 14:104098591-104098613 GCCTGGGGCGTGCAAGTGGCTGG - Intronic
1122784167 14:104156276-104156298 ACTTGAGGTGAGGGAGTGGCTGG + Intronic
1122834218 14:104423253-104423275 GCCTTCGCTGTAGGAATGGCCGG - Intergenic
1123043968 14:105502534-105502556 GCCTTGGGTGTGGTTGTGGCTGG + Intergenic
1123997590 15:25729663-25729685 ACATGCTGTGTGGGGGTGGCTGG - Intronic
1124150119 15:27169656-27169678 GCCTGCCGAGATGGAGTGGCCGG - Intronic
1124413155 15:29453134-29453156 GACTGTGGTGTGGCATTGGCAGG - Intronic
1125415777 15:39450717-39450739 AGCTGAGGTGGGGGAGTGGCTGG + Intergenic
1125748382 15:42012599-42012621 GCCTGGGGTCTGAGAGGGGCAGG - Intronic
1125929497 15:43590136-43590158 GGGGGCGGTGGGGGAGTGGCTGG - Intronic
1125942664 15:43689968-43689990 GGGGGCGGTGGGGGAGTGGCTGG - Intergenic
1126827828 15:52569085-52569107 GGGTGCGGTGCGGGAGGGGCAGG - Intronic
1128527714 15:68423771-68423793 GCCTGCGGGGTGGGACAAGCAGG - Intronic
1131166129 15:90143447-90143469 GCCTGCGGGGAGGGCCTGGCGGG - Intergenic
1131180243 15:90234154-90234176 GCCTCCGGGGTGGGAGGGGGGGG + Intronic
1132758872 16:1499435-1499457 GCCTGTGATTTGGCAGTGGCTGG + Intronic
1132895759 16:2228652-2228674 GGCTGCGGTGTGGGAGGGTCCGG + Intronic
1132898069 16:2238247-2238269 GCCTGCGGTGGGGCAGGGGCAGG - Intronic
1133020566 16:2965046-2965068 GCCTGCGCTGGGGGCGAGGCTGG + Intronic
1134638699 16:15811937-15811959 CCCTGGGGTGTAGGAGGGGCAGG - Intronic
1135755253 16:25091932-25091954 GCAGGTGGTGTGGGAGTGGCTGG - Intergenic
1135859608 16:26043886-26043908 GCCTGGGCTGAGGTAGTGGCAGG - Intronic
1136070019 16:27782127-27782149 GGCTGAGGAGTGGGAGTGACAGG - Intergenic
1136559810 16:31032707-31032729 GGCTGGGGGGTGTGAGTGGCAGG + Intergenic
1138511779 16:57512869-57512891 GCCTGTGGGGTGGGGGTGACAGG + Exonic
1138563444 16:57815834-57815856 GCCTGAGGTGGGGGAGTGGCAGG - Intronic
1139754525 16:69132231-69132253 GCCTCCGGGGTGGGAGGGCCAGG - Intronic
1139974848 16:70801208-70801230 GCCTGCGGTGGGGGCGTGGCTGG - Intergenic
1141529091 16:84633832-84633854 GCCTGCGGAGCTGGAGTCGCGGG + Intergenic
1141604366 16:85144533-85144555 GCCTGGGGTCTGGGTGTGGGTGG + Intergenic
1141803090 16:86324142-86324164 GCCTGAGGGGTGGGAAGGGCAGG - Intergenic
1141860500 16:86713139-86713161 GGCTGCGGTGCTGGCGTGGCTGG + Intergenic
1142240313 16:88941735-88941757 GCCTGCGGAGGGGGAGAGGGTGG - Intronic
1142482615 17:228115-228137 GCCTGGGGTGGGGGAGTCACCGG + Intronic
1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG + Exonic
1143184622 17:5002857-5002879 GCATCCGGTGGGGGAGTGGGGGG - Intronic
1143253885 17:5541747-5541769 ACCTGCTTTGTGGGAGTGGGAGG - Intronic
1143565555 17:7718186-7718208 GCCTGCGGTGTGGGATCGCGTGG + Exonic
1144624201 17:16836509-16836531 TCCTGTGGTGTGGGCGTGGCAGG - Intergenic
1144624741 17:16838934-16838956 GCCTGAGGTGGGGGAGGAGCTGG + Intergenic
1144834333 17:18149004-18149026 GCCTTCTGCCTGGGAGTGGCCGG - Intronic
1144881689 17:18433787-18433809 GCCTGAGGTGGGGGAGGAGCTGG - Intergenic
1144882227 17:18436210-18436232 TCCGGTGGTGTGGGCGTGGCAGG + Intergenic
1145150544 17:20510599-20510621 GCCTGAGGTGGGGGAGGAGCTGG + Intergenic
1145884194 17:28371483-28371505 GCCAGGGGCGTGGGCGTGGCTGG + Intronic
1145889654 17:28405793-28405815 GCCTGCGTAATGGTAGTGGCGGG - Intronic
1145911643 17:28546780-28546802 GCCTAAGGTGTGGGAGGGACTGG - Exonic
1146161936 17:30564814-30564836 TCCTGTGATGTGGGCGTGGCAGG - Intergenic
1147578338 17:41615228-41615250 TCCTGTGGTGTGGGCATGGCAGG - Intronic
1147591768 17:41688628-41688650 GCCTGCGCAGTGCGAGTGGACGG - Intergenic
1148038849 17:44690133-44690155 GACAGCTGTGTGGGAGTGGGCGG - Intronic
1148066671 17:44876049-44876071 GCATGCGGTGCAGGAGAGGCTGG - Exonic
1148496145 17:48054591-48054613 ACCTGCGGGGTGGGAGGGGGTGG + Intronic
1148502383 17:48101467-48101489 GCCTGCGCGGTGCGAGCGGCGGG - Intronic
1149874659 17:60219690-60219712 GACTGCTGTGTCCGAGTGGCAGG + Exonic
1149993543 17:61395826-61395848 GGCGGCGGTGGGGGAGTGGGGGG - Intergenic
1150088447 17:62296929-62296951 GACTGCTGTGTCCGAGTGGCAGG + Intergenic
1150230191 17:63545496-63545518 CCCTGAGGTGTGGGAAGGGCAGG + Intronic
1151843433 17:76634156-76634178 GCCTGGTATGTGGGAATGGCTGG + Intronic
1152167940 17:78723125-78723147 GGCTGCTGGGTGGGAGAGGCAGG + Intronic
1152233072 17:79124693-79124715 GCCAGGGCTCTGGGAGTGGCTGG + Intronic
1152524434 17:80879433-80879455 GCCCGGGATGTGGGAGTGGGAGG - Intronic
1152713640 17:81887678-81887700 GCATGGGTTGTGGGGGTGGCGGG - Intergenic
1152793354 17:82293494-82293516 GGCTGCGGGGAGGGAGGGGCGGG + Intergenic
1152965741 18:112133-112155 GCCTGGGCTGTGGGAGCAGCCGG - Intergenic
1154168902 18:12036621-12036643 GCCTGATGCATGGGAGTGGCTGG - Intergenic
1155537574 18:26832987-26833009 GGCTGCAGTGTGGGAGGGGCAGG - Intergenic
1156463874 18:37336574-37336596 GCCTGCTATGAGGGAGTGGCTGG + Intronic
1157534419 18:48448031-48448053 GCGTGGGGGGTGGGAGTGGTGGG - Intergenic
1157963937 18:52187241-52187263 GGCTGTGGGGTGGGAGTGGGTGG - Intergenic
1160070575 18:75624591-75624613 ACCTGGGGGGTGGGAGAGGCAGG - Intergenic
1160534655 18:79585620-79585642 GCATGGGGTGTGGGAGTGTGCGG - Intergenic
1160534689 18:79585737-79585759 GCGTGGGGTGTGGGAGTGTGTGG - Intergenic
1160680105 19:408494-408516 GCCGGCGGGGTGGGGGTGGAGGG + Intronic
1160710142 19:547639-547661 GGCTGCGGTGTGGAAGGAGCTGG - Intronic
1160804516 19:986215-986237 TGCTGCGGTGTGTGAGTGCCGGG - Intronic
1161244444 19:3241562-3241584 GTGTGTGGGGTGGGAGTGGCTGG + Intronic
1161265300 19:3360907-3360929 GCTTGCTGTGTGCGAGTGACTGG + Intronic
1162021396 19:7870017-7870039 GCCTGCAGGGTGGGTGAGGCAGG + Exonic
1162568597 19:11457894-11457916 GCCTGCTGTATATGAGTGGCTGG + Intronic
1162890857 19:13732096-13732118 GACTTCGGGGTGGGAGTGGTGGG + Intronic
1163116062 19:15189189-15189211 GCGATCGGTGTGGGCGTGGCTGG + Intronic
1163672308 19:18636507-18636529 GAATGCGGTGGGGGAGTGGTCGG - Intergenic
1163708897 19:18833546-18833568 GCCTGGGGTGGGAGAGGGGCTGG + Intronic
1166100108 19:40566586-40566608 GCCTGGGATGGGGGAGTGGGAGG + Intronic
1166292497 19:41872043-41872065 GCCCGCTGAGTGGCAGTGGCAGG + Exonic
1166299211 19:41904693-41904715 GGCTGGAGGGTGGGAGTGGCTGG + Intronic
1166559085 19:43720053-43720075 GCCTGGGGGGTGGGTGTGGAGGG + Intergenic
1166730226 19:45055125-45055147 ACCTGCGGTGTGGCAATGGTAGG + Intronic
1166893072 19:46006502-46006524 GCCCTCCGTGTGGCAGTGGCGGG + Intronic
1167087751 19:47321884-47321906 GGCTGGGGTGTGGGGGTGGAGGG - Exonic
1167698201 19:51027145-51027167 GGCTGTGGAGAGGGAGTGGCTGG - Intronic
925697358 2:6595069-6595091 GCCTGCGGTGGGGGTGTTGGAGG + Intergenic
926295216 2:11564154-11564176 GCCTGAGGTGTGGCAGAGCCAGG + Intronic
926922181 2:17949916-17949938 GCCTGCAGTATGGGTGTGGGTGG + Intronic
928171814 2:29009277-29009299 GCCTGCGGGGTGGGGGTGAAGGG + Intronic
928313738 2:30231114-30231136 GGCTGGGGTGGAGGAGTGGCGGG + Intergenic
930606340 2:53497148-53497170 GTCTTAGGTGTGGGAGTGGCTGG - Intergenic
931775076 2:65533262-65533284 CCCTGCAGGGTGGGACTGGCTGG + Intergenic
932080662 2:68711667-68711689 GCCTGCGGGGGGTGGGTGGCTGG - Intronic
933180225 2:79218164-79218186 GCCTGCTCTGTGGGAGAGGTGGG - Intronic
934162985 2:89269998-89270020 GCTTGGGGTGTGGGGGTTGCAGG + Intergenic
934204288 2:89912526-89912548 GCTTGGGGTGTGGGGGTTGCAGG - Intergenic
936172642 2:110190207-110190229 GCGCACGGTGTGGGACTGGCAGG - Intronic
936865337 2:117071566-117071588 GCCCGTGGTGTGGGACTGGCAGG - Intergenic
937413410 2:121696150-121696172 GTCTGTGGTGGGGGAGTGGCAGG + Intergenic
937527965 2:122794323-122794345 GCTGAGGGTGTGGGAGTGGCAGG + Intergenic
941183388 2:162288669-162288691 GGCTGTGGTGCGGGATTGGCAGG + Intronic
941492691 2:166162573-166162595 GCCTGCAGTGGGGTAGTGACAGG - Intergenic
942637229 2:178020675-178020697 GCCTGCCGAGTAGGAGTAGCTGG - Intronic
942707998 2:178799226-178799248 GCATAGGGTGTGGGCGTGGCAGG - Intronic
943134510 2:183892921-183892943 GCATGCGGCGTGGGACTGGCGGG + Intergenic
943958081 2:194219049-194219071 GCCTGCTGTTTGGGGGTGGGGGG - Intergenic
944729707 2:202503756-202503778 GCGCACGGTGTGGGACTGGCAGG + Intronic
946185625 2:217978978-217979000 GCCTGCGGGGCGGGAGTGCCCGG + Intronic
947524840 2:230871666-230871688 GCCTGCTGGGTGGGTGTGGGAGG - Intronic
947835546 2:233172272-233172294 GCCTGAGATGGGAGAGTGGCCGG + Intronic
949006679 2:241653413-241653435 GCCTGTGGTGTGGGACTGACCGG + Intronic
949044882 2:241867860-241867882 GCCTGAGAGGTGGGACTGGCAGG + Intergenic
1168878341 20:1185817-1185839 GCGTGCGGGGTGGGGGTGGGGGG - Intronic
1169863013 20:10172153-10172175 GCCCGAGGGGTGGGGGTGGCCGG - Intergenic
1170863763 20:20134369-20134391 GCATCAGGTGAGGGAGTGGCAGG + Intronic
1171310791 20:24143191-24143213 GTCTGCCGTGGGGGAGTGCCAGG - Intergenic
1171367389 20:24634984-24635006 GGCTGCCGTGTGGGAGCTGCAGG - Intronic
1172428619 20:34872857-34872879 GGCTGCGGCGGGGGAGTGGGAGG + Exonic
1173190999 20:40875485-40875507 GGCTGGGGGGTGGGGGTGGCTGG - Intergenic
1173554101 20:43953451-43953473 GCATGCGGGTTGGGAGTGGAAGG - Intronic
1173819909 20:46013284-46013306 GGCTGCGGTGTGGTGGTGGTTGG - Exonic
1174587042 20:51617494-51617516 GACTGCGGCGTGGGAGTGGAAGG - Exonic
1175914647 20:62419966-62419988 GGCTGCCGTGCGGGAGGGGCTGG + Intronic
1176422234 21:6525470-6525492 GGCTGAGGTGGGGGTGTGGCAGG + Intergenic
1178277472 21:31252067-31252089 GCCTGTGGTGGGTGAGTAGCTGG + Exonic
1178687001 21:34719923-34719945 GCATGCGGGGTGGGGGTGGAGGG - Intergenic
1179603856 21:42499402-42499424 TCCTGGGGCGTGGGAGTGGTGGG + Intronic
1179633072 21:42690691-42690713 GGCAGCCGTGTGGGAGAGGCAGG - Intronic
1179697725 21:43133786-43133808 GGCTGAGGTGGGGGTGTGGCAGG + Intergenic
1180134545 21:45853834-45853856 TCCTGCGTGGTGGCAGTGGCAGG + Intronic
1180921230 22:19522673-19522695 TCCTGCGGTGTGGGAAGTGCTGG - Intergenic
1180960600 22:19760726-19760748 GCCTGCGGTGTGGGGCTGCACGG + Intronic
1181087339 22:20447291-20447313 GCCTGCTGGGTGTGAGTGGGTGG - Intronic
1181169223 22:20998864-20998886 GGCTGCCCTGTGGGTGTGGCAGG - Exonic
1181636689 22:24177907-24177929 GCCTGGGGTGTGGGTGAGGATGG + Intronic
1181639368 22:24188720-24188742 GGCTCAGGTGTGGGAGTGTCAGG - Exonic
1183429412 22:37756690-37756712 GGCTGCCGAGTGGGTGTGGCAGG - Intronic
1183864688 22:40694869-40694891 GACTGTGCTGTGGAAGTGGCTGG - Intergenic
1183983744 22:41557889-41557911 GCCAGCAGAGGGGGAGTGGCTGG - Intergenic
1184114297 22:42413271-42413293 GCCTGTGGTGTGGGGCTGGAGGG + Intronic
1184488507 22:44795846-44795868 ACCTGGGGTGGGGGAGGGGCTGG - Intronic
1184658646 22:45955220-45955242 GCCTGGGGTGTGGCAGGGCCAGG - Intronic
1184714682 22:46274107-46274129 GGCTGAGCTGGGGGAGTGGCAGG + Intronic
1184784809 22:46666560-46666582 GCCAGCGGTGTGGGAGAGGGCGG - Intronic
1185320606 22:50198731-50198753 CCCTGCAGTGTGGGAGGGGAGGG - Exonic
949539446 3:5020652-5020674 GACTGAGGTGGGGCAGTGGCAGG - Intergenic
950100752 3:10355274-10355296 GCCATCTGTGAGGGAGTGGCAGG + Intronic
950486220 3:13275502-13275524 GCCCGGGGTGTGTGAGGGGCTGG - Intergenic
950724294 3:14906451-14906473 GCCTGGGCTGTGGGGGTGGGAGG + Intronic
952076370 3:29701925-29701947 GCCCTCGGTGTGGGACTGGTGGG + Intronic
952210642 3:31226095-31226117 GCCTGGGTTGTTGGAGTAGCTGG + Intergenic
952743591 3:36757848-36757870 GACTGCGATGTGGGAGGGGATGG - Intergenic
953769957 3:45772210-45772232 GCTTGAGGTGAGGCAGTGGCAGG + Intronic
954134375 3:48575355-48575377 GCTGGGGGTGTGGGAGAGGCAGG - Exonic
955140244 3:56261479-56261501 GGCTGGGGTGTAGGAGAGGCAGG - Intronic
955219738 3:57013252-57013274 GCATGCGGTGTGGGACTGGTAGG + Intronic
955961236 3:64343249-64343271 GCCTGGGGTGGTGGAGGGGCAGG - Intronic
956640902 3:71414445-71414467 CCCTGCTGTGTGGGTGTGGATGG - Intronic
958422270 3:93942206-93942228 GCTTGCGGAGAGGGAGTGGAGGG - Intronic
958548522 3:95588512-95588534 GCGTGCTGTCTGGGAATGGCAGG - Intergenic
958549584 3:95595492-95595514 GCATGCTGCGTGGGACTGGCAGG - Intergenic
961692566 3:128680697-128680719 GCCTGGCGTGGGGGCGTGGCCGG - Intronic
962383481 3:134914865-134914887 GCCTGCTGACTGGGAGAGGCTGG - Intronic
965036821 3:163450824-163450846 AGCTGCAGTGTGAGAGTGGCAGG + Intergenic
965559436 3:170047235-170047257 GGATGCGGTGAGGGTGTGGCAGG - Intronic
966601758 3:181782355-181782377 GACAGGGGTGTGGGAGAGGCAGG - Intergenic
966923121 3:184627356-184627378 GTCTGCAGTGTGGGGGTGGGGGG + Intronic
968545263 4:1194893-1194915 GGCTGCGGGGTTGGAGTCGCCGG - Intronic
968545281 4:1194956-1194978 GGCTGCGGGGTTGGAGTCGCCGG - Intronic
968662391 4:1804104-1804126 GGTGGCGGTGTGGGACTGGCTGG + Intronic
968898823 4:3421104-3421126 TCCTGCAGTGTGGGAGTGGGTGG - Intronic
968904549 4:3445344-3445366 GCCTGCGGTGCGCGGCTGGCGGG + Exonic
968944714 4:3657574-3657596 GCCTGGGGTGGGGGAAAGGCAGG + Intergenic
971649808 4:29257291-29257313 ACCTGCGATTTGGGAGGGGCTGG + Intergenic
973854170 4:54993856-54993878 GCCCACGGCGTGGGACTGGCAGG + Intergenic
974023507 4:56711987-56712009 GCCTGCAATGTGGGCGAGGCAGG - Intergenic
974147777 4:57967577-57967599 GCGCGTGGTGTGGGACTGGCAGG + Intergenic
974665382 4:64954310-64954332 TCCTGTGGTGTGGGTATGGCTGG + Intergenic
976269064 4:83212422-83212444 GGCTGAGGTGTGGGTGTGGGTGG + Intergenic
978809162 4:112831192-112831214 GCACGCGGCGTGGGACTGGCAGG + Intronic
979609087 4:122670601-122670623 CCCTGCGGTGAGGGACTGGCAGG + Intergenic
979865284 4:125745374-125745396 GCACGCGGTGAGGGACTGGCAGG + Intergenic
982769006 4:159378478-159378500 GCGCGTGGTGTGGGACTGGCGGG + Intergenic
983369704 4:166842813-166842835 GCCGGCAGTGCGGGACTGGCAGG - Intronic
985693377 5:1325940-1325962 GCCTGAGCTGTGGGAGGGACAGG - Intronic
986608960 5:9547725-9547747 GCCTGCTGTGTGGCAGCTGCAGG + Intergenic
986803997 5:11291109-11291131 GTCAGGAGTGTGGGAGTGGCAGG - Intronic
988035507 5:25823291-25823313 GCATGCGGTGTGGGACTGGTGGG - Intergenic
988934031 5:36065227-36065249 GCCTGCGGGGTGGGGGTGGAAGG + Intronic
991294129 5:65062836-65062858 GCCTGAGCTGTAGGCGTGGCAGG + Intergenic
991388304 5:66114577-66114599 GCCTGGGGGGTGGGGGTGGAAGG + Intergenic
997858018 5:137390815-137390837 GCCTGCAGTTAGGGAGTAGCTGG + Intronic
998507830 5:142686295-142686317 GCGGGTGGTGTGGGAGTGGGCGG - Intronic
999079124 5:148826703-148826725 GGCTGTGGTGTGGGTGTGGTGGG - Exonic
999229342 5:150052498-150052520 GCCTGCGGTGTGGGTCAGGGTGG + Exonic
999657170 5:153822030-153822052 GCCAGAGGTGTGGGTGGGGCAGG - Intergenic
999855212 5:155586726-155586748 GCACACGGTGTGGGACTGGCAGG - Intergenic
1001755516 5:174165505-174165527 GCCTGCGGTGTGACCTTGGCTGG - Intronic
1001919201 5:175587305-175587327 GCCTGTGATGTGGGGGTGGGGGG + Intergenic
1002475393 5:179462192-179462214 GCCTGCAGTGTGGGCGTGGTGGG - Intergenic
1002758090 6:179993-180015 GTGTGCAGTGTGGGACTGGCGGG + Intergenic
1002774217 6:315014-315036 GCCTCTGGTCAGGGAGTGGCTGG + Intronic
1002782558 6:378836-378858 ACCTGAGGTGTGGGAGTGCCTGG + Intergenic
1003065604 6:2901930-2901952 GGCTGTGGCGTGGGGGTGGCTGG - Intronic
1003174916 6:3747186-3747208 GCCTGAGGTGCAGGACTGGCAGG - Intronic
1003489161 6:6606446-6606468 GTGCGCGGTGTGGGACTGGCAGG - Intronic
1004166277 6:13259617-13259639 GCCTGCTGTGTAGGACTGTCAGG - Intronic
1004425284 6:15502813-15502835 GGATGCGGTGTGGGGGTTGCTGG + Intronic
1005987596 6:30884301-30884323 GCGCGCGGGGTGGGCGTGGCGGG + Intronic
1006057399 6:31395701-31395723 GCCAGCGCTGAGGGAGAGGCTGG + Intergenic
1006415897 6:33903733-33903755 CCTTGAGGTGTGGGTGTGGCAGG + Intergenic
1006572491 6:35017459-35017481 GCCTGTGGTCTTGGAGTGGACGG - Exonic
1007115633 6:39341205-39341227 GCCAGGGGACTGGGAGTGGCTGG - Intronic
1007708997 6:43809715-43809737 GCCTTCTGTATGGCAGTGGCAGG - Intergenic
1007947229 6:45837444-45837466 GCCTGTGGAGTGGGACTGGCTGG + Intergenic
1008270116 6:49481800-49481822 GCACACGGTGTGGGACTGGCAGG - Intronic
1008534992 6:52500797-52500819 GCCTGCGTTGTGCCAGTTGCTGG - Exonic
1010363173 6:75018297-75018319 GCCTGTTGTGGGGGAGTGGGAGG + Intergenic
1011022055 6:82825391-82825413 GCCTGTGGTGTTGGATTGGAAGG + Intergenic
1014586373 6:123202344-123202366 GCATGTGGTGTGGGACTGGTGGG + Intergenic
1015161842 6:130161096-130161118 GCCTGTGGTGTTGGAAAGGCAGG + Intronic
1017906237 6:158759072-158759094 GACAGAGGTGTGGGAGAGGCAGG - Intronic
1019060539 6:169254680-169254702 GCCTGAGGTGTGGGAGGGGCGGG - Intergenic
1019088053 6:169500561-169500583 GCCTGCGGAGCAGAAGTGGCAGG + Intronic
1019277711 7:184626-184648 GCCAGCGCTGTGGGAGGGGCTGG - Intergenic
1020132911 7:5569732-5569754 GCATGGGATGTGGGTGTGGCAGG + Intergenic
1021359337 7:19692224-19692246 GTGTGCGGTGCGGGACTGGCAGG - Intergenic
1022099356 7:27160230-27160252 GCCTAGGGTCTGGGAGAGGCTGG + Intergenic
1024211397 7:47208842-47208864 GCCTGGAGTGTTGGAGAGGCTGG - Intergenic
1025114904 7:56249252-56249274 GCCTGCTGCGTGGGAGAGGCAGG - Intergenic
1026968755 7:74455265-74455287 GCCTGGCGGGTGGGAGTGGAGGG + Intronic
1027250045 7:76393341-76393363 CACTGCGGCGTGGGAGGGGCGGG - Intronic
1029647798 7:101869144-101869166 ACCTGGGATGTGGGAATGGCTGG + Intronic
1031035004 7:116779361-116779383 TCCTGAGGTGTGAGAGTGGATGG - Intronic
1032696939 7:134345212-134345234 GCATGAGGTGTGGGATTTGCGGG + Intergenic
1032846773 7:135758081-135758103 GCCTGTAGTGAGGGAGTGGTTGG + Intergenic
1033220714 7:139524770-139524792 GCGTGTGGTGTGGGAGATGCAGG + Intronic
1033644197 7:143288314-143288336 GCCTGGTGTGTGGGCGCGGCAGG + Exonic
1034338812 7:150339753-150339775 GCCGGCTGTGTGGGTGTGTCTGG - Intronic
1034427896 7:151024122-151024144 GCCTGTGTTGGGGGGGTGGCTGG + Exonic
1034494432 7:151411155-151411177 GCCTGCGAGGCGGGAGAGGCCGG + Intergenic
1034968833 7:155407198-155407220 GTGTGCGGTGTGGGAGTGTGGGG + Intergenic
1034969201 7:155408716-155408738 GTGTGGGGTGTGGGAGTGTCCGG + Intergenic
1034994473 7:155569584-155569606 GGCTGAGGTGTGAGAGTGGAGGG - Intergenic
1035357552 7:158285623-158285645 CTCTGTGGTGTGGGAATGGCAGG - Intronic
1035991578 8:4496670-4496692 GCCTGCTTTGTCAGAGTGGCAGG - Intronic
1036593889 8:10194800-10194822 GGCTGGGATGTAGGAGTGGCTGG - Intronic
1037527472 8:19740759-19740781 CCCTGGGGTGAGGGAGTGGGAGG + Intronic
1037772368 8:21810151-21810173 GGCTCAGGTGTGGGAGGGGCTGG - Intronic
1038725967 8:30082918-30082940 GCCTGCGGGCCGGGAGCGGCCGG - Exonic
1041938419 8:63360179-63360201 GCCTATGGGGAGGGAGTGGCAGG - Intergenic
1042227520 8:66525539-66525561 GCCTGTGCAGTGGGAGGGGCAGG + Intergenic
1043798843 8:84580457-84580479 GAATGGGGTGTGGGAGTGCCAGG + Intronic
1045933802 8:107655985-107656007 GCACGCGGTGCGGGACTGGCAGG + Intergenic
1049006024 8:139856208-139856230 GCCTGTGGAGTGGGGGTGGAGGG + Intronic
1049465980 8:142751510-142751532 GCCTTGGGTGGGGGCGTGGCTGG + Intronic
1049598145 8:143494079-143494101 GCCTGGGGAGTGGGAGGGGAAGG + Intronic
1049719154 8:144107641-144107663 GCCTGCGGTGTGGGAGTGGCCGG + Intronic
1049728610 8:144163855-144163877 GCATGGGGATTGGGAGTGGCCGG + Intronic
1049758971 8:144323345-144323367 GCCTGAGGTGAGGCTGTGGCTGG - Intronic
1051356375 9:16243249-16243271 GCCTTTGCTGTGGGAGTGGCAGG - Intronic
1052434884 9:28413691-28413713 GGCTGAGATGTGGGAGTGGTAGG + Intronic
1052816695 9:33107428-33107450 GCCAGCTGTGTGGGGGTGGGGGG - Intronic
1053289880 9:36872882-36872904 GGCTGAGGTGTGGGTGTGACTGG + Intronic
1055673486 9:78631268-78631290 GACTGCTGAGTGGGAGGGGCAGG + Intergenic
1058309560 9:103484062-103484084 GCATGCAGTGTGGGACTGGCAGG + Intergenic
1060972251 9:127744936-127744958 GCCAAGGGTGTGGGAGGGGCTGG + Exonic
1061406191 9:130394181-130394203 GCCTGCGGGGAGTGGGTGGCCGG + Intronic
1061856218 9:133443306-133443328 GCCTGGGGTGATGGGGTGGCAGG - Intronic
1061876068 9:133544701-133544723 GCCAGCTGTGTGGGTGTGGCTGG + Intronic
1062289910 9:135789822-135789844 GCCTGGGGTGGGGCAGGGGCTGG - Intronic
1062333538 9:136055048-136055070 GGCTGTGGTGTCGGAGTGGGGGG + Intronic
1062534131 9:137014154-137014176 GCCTGCAAGGTGGGGGTGGCAGG - Exonic
1189322304 X:40094404-40094426 GCCTGCGGGGTGGGGGTAGGGGG + Intronic
1190249091 X:48708656-48708678 GGCTGGGGTCTGGGAATGGCAGG - Exonic
1190265454 X:48825220-48825242 GCCTAGGGTGTGGGTGTGGCTGG - Intergenic
1190330057 X:49230371-49230393 GCCTGCGGGGAGGGAGGGGGAGG + Exonic
1191885136 X:65880595-65880617 TCTTGGAGTGTGGGAGTGGCAGG - Intergenic
1192451612 X:71248437-71248459 GCCTGAGGTCTTGGACTGGCAGG - Exonic
1192467475 X:71367437-71367459 TCCTGTGGTGTGGGAGTCGTAGG + Intronic
1193720047 X:84975238-84975260 GCCCGTGGAGTGGGACTGGCGGG + Intergenic
1199203743 X:145123839-145123861 GCATGAGATTTGGGAGTGGCCGG - Intergenic