ID: 1049719265

View in Genome Browser
Species Human (GRCh38)
Location 8:144108128-144108150
Sequence CCCCGCGCGCCCGCGCCCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 571
Summary {0: 1, 1: 1, 2: 12, 3: 78, 4: 479}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049719258_1049719265 14 Left 1049719258 8:144108091-144108113 CCCTTTTTGACCAGCAGCCAACA 0: 1
1: 0
2: 2
3: 15
4: 121
Right 1049719265 8:144108128-144108150 CCCCGCGCGCCCGCGCCCGCCGG 0: 1
1: 1
2: 12
3: 78
4: 479
1049719257_1049719265 18 Left 1049719257 8:144108087-144108109 CCTGCCCTTTTTGACCAGCAGCC 0: 1
1: 0
2: 1
3: 12
4: 202
Right 1049719265 8:144108128-144108150 CCCCGCGCGCCCGCGCCCGCCGG 0: 1
1: 1
2: 12
3: 78
4: 479
1049719259_1049719265 13 Left 1049719259 8:144108092-144108114 CCTTTTTGACCAGCAGCCAACAG 0: 1
1: 0
2: 1
3: 13
4: 131
Right 1049719265 8:144108128-144108150 CCCCGCGCGCCCGCGCCCGCCGG 0: 1
1: 1
2: 12
3: 78
4: 479
1049719262_1049719265 -3 Left 1049719262 8:144108108-144108130 CCAACAGTGGCAAAGCCTGACCC 0: 1
1: 0
2: 2
3: 8
4: 125
Right 1049719265 8:144108128-144108150 CCCCGCGCGCCCGCGCCCGCCGG 0: 1
1: 1
2: 12
3: 78
4: 479
1049719256_1049719265 29 Left 1049719256 8:144108076-144108098 CCGTCGCAGGTCCTGCCCTTTTT 0: 1
1: 0
2: 0
3: 14
4: 154
Right 1049719265 8:144108128-144108150 CCCCGCGCGCCCGCGCCCGCCGG 0: 1
1: 1
2: 12
3: 78
4: 479
1049719261_1049719265 4 Left 1049719261 8:144108101-144108123 CCAGCAGCCAACAGTGGCAAAGC 0: 1
1: 0
2: 4
3: 17
4: 210
Right 1049719265 8:144108128-144108150 CCCCGCGCGCCCGCGCCCGCCGG 0: 1
1: 1
2: 12
3: 78
4: 479

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049719265 Original CRISPR CCCCGCGCGCCCGCGCCCGC CGG Exonic
900134128 1:1107035-1107057 CCCCCCGCACCCCCGCCCGTGGG + Intronic
900227567 1:1540232-1540254 CCCCGCCCGCGCGCGCCGCCTGG - Intronic
900457798 1:2785882-2785904 CCCCGCCTGGCCGTGCCCGCAGG + Exonic
901055979 1:6448809-6448831 GCCCGCCAGCCCGCGCGCGCCGG + Exonic
901086619 1:6614889-6614911 CCCCACCCGCCCGCGGTCGCCGG - Intronic
901242863 1:7704951-7704973 CGCCCCGCGCGCGCCCCCGCCGG - Intronic
901577252 1:10210812-10210834 CCCCGCGCCCCCGCGCGCCGCGG + Exonic
901676599 1:10889101-10889123 CCCGGCACGCCCGCCCCGGCTGG + Intergenic
901762503 1:11479896-11479918 CCCCACGCGCCCTCCCCGGCCGG - Intronic
901791335 1:11654957-11654979 CCCCCCGCGCCCCCTCCTGCCGG - Intronic
901796067 1:11680525-11680547 GCCCCCGCCCCCGGGCCCGCAGG + Intronic
902214303 1:14924626-14924648 CCTCGCGCGCCCGGCCCCGGCGG - Intronic
902478416 1:16699830-16699852 GCCCGCCAGCCCGCGCCCGCCGG - Intergenic
902585834 1:17438305-17438327 CGCCGCGCGCTTGCCCCCGCCGG + Exonic
902870739 1:19312277-19312299 CCGCGCGCCACCGCCCCCGCGGG - Intergenic
903485696 1:23688318-23688340 CGGCGCGCGCCCGCAACCGCAGG - Intergenic
904500194 1:30908754-30908776 CCCACAGCGGCCGCGCCCGCAGG + Exonic
905173973 1:36125056-36125078 CGCCCGGCGGCCGCGCCCGCAGG - Exonic
905734565 1:40316649-40316671 ACCCGCGCGCCCGCAGCCCCCGG + Intronic
906262901 1:44406912-44406934 TCCTGCGCGCCCTCGCCAGCTGG - Intronic
907010660 1:50959955-50959977 TCCCGCGCTGCCCCGCCCGCTGG - Exonic
907906117 1:58784582-58784604 CCCCGCGCGGTGGCGGCCGCCGG - Intergenic
908544414 1:65148939-65148961 AGCCGCGCGCCCCCTCCCGCGGG + Intronic
909475220 1:76074634-76074656 GCCCGCGCGGCCCCGCCCCCGGG - Intergenic
909548043 1:76868691-76868713 CCCCGCGGGACCGCGGCCACTGG + Exonic
910182970 1:84505926-84505948 TCCCGCCCGCCCCCGCCAGCTGG + Intronic
910183183 1:84506768-84506790 CCCCGCCCGCCCGGCTCCGCTGG - Intergenic
912416233 1:109509759-109509781 CGCCGCGCGCACGCGCCCCGAGG - Intergenic
914702905 1:150150233-150150255 CGCCCCGCGCCCGCGCCCGCTGG + Exonic
914928530 1:151909422-151909444 CGCCGCGCGCCTCCGCACGCTGG - Exonic
915519904 1:156436122-156436144 CCCGCCGCGCCCGCGGCCGGAGG - Intergenic
916694597 1:167221894-167221916 GCCCGCGCGCCCCCGGCCGGCGG + Intronic
918601977 1:186375145-186375167 GCTCGCGCGCGCCCGCCCGCCGG + Exonic
920002320 1:202808236-202808258 CCTCGGGGGCCCGGGCCCGCTGG - Exonic
921604426 1:217137755-217137777 CCCCGCGCGCCTCCGCTCTCTGG + Intronic
922602841 1:226870484-226870506 CCCCGCGCGCCCGGGACTCCAGG + Intronic
922739419 1:228007004-228007026 ACCCGCGCACCCGCGGCCGCAGG + Intergenic
922783319 1:228269979-228270001 CCCGGCGCGGCCGCGGCCGGGGG - Intronic
922832395 1:228610422-228610444 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922832955 1:228612663-228612685 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922833516 1:228614904-228614926 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922834076 1:228617145-228617167 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922834633 1:228619386-228619408 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922835185 1:228621601-228621623 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922835744 1:228623821-228623843 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922836302 1:228626063-228626085 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922836860 1:228628302-228628324 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922837419 1:228630544-228630566 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922837980 1:228632785-228632807 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922838538 1:228635025-228635047 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922839096 1:228637250-228637272 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922839656 1:228639491-228639513 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922840217 1:228641722-228641744 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922840777 1:228643963-228643985 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922841340 1:228646194-228646216 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
924090105 1:240492923-240492945 CCCCGCGCGCGCCCGGCCGCTGG - Exonic
924172416 1:241356678-241356700 CCCCGCGCCGCGGCGGCCGCCGG + Intronic
924289740 1:242524768-242524790 CCCAGCCAGCCCGCGCCTGCAGG + Intergenic
1063115440 10:3068599-3068621 CCCGGCGCGCCCGCGTCCGTGGG - Intronic
1063200890 10:3784867-3784889 GCCCGCGCCCCGGCGCCCGCAGG + Intronic
1063458508 10:6201563-6201585 CCCCGCGCGCCCGCCCCACCCGG - Intronic
1063459093 10:6204059-6204081 CCCCGGGCGCACGCACCCCCCGG + Intronic
1065140165 10:22713352-22713374 CCCCCTCCGCCCGCGCCCGCCGG + Intronic
1067028704 10:42866121-42866143 CCCCGCGAGCTCGCGGCGGCCGG - Intergenic
1067769813 10:49115311-49115333 CGCCCCCCGCCCGCGCCCGGAGG + Intronic
1069024045 10:63521334-63521356 CCCCGCCCGCCCCCGCCCGCCGG - Intergenic
1069372640 10:67763985-67764007 CCCCCCCCGCCCGCCCCCTCGGG - Intergenic
1069623607 10:69852999-69853021 CCCCGCTCCCCCGCCCCAGCTGG - Intronic
1069695511 10:70382628-70382650 CCCCGCGCGCCCCGCCCCGCCGG - Intronic
1069695550 10:70382789-70382811 GCCCGCGCGCTCCCGGCCGCAGG + Intergenic
1070198009 10:74176721-74176743 CCCCGCGCGCGGGCGGCCCCTGG - Intronic
1070800833 10:79243558-79243580 CCCCGCGCCGCCGCCGCCGCCGG + Intronic
1071690873 10:87818290-87818312 CCCTCCGCGCCGGCGACCGCGGG - Intronic
1072089639 10:92115043-92115065 TCCCCCGCGCCCGCGGCCGCCGG - Intronic
1072562181 10:96586701-96586723 CCCGGGGCGGCCGCGCCGGCCGG + Intronic
1072650628 10:97292417-97292439 CCCCGCGCCTCAGCCCCCGCAGG + Intronic
1072903579 10:99430663-99430685 GGCCGCGGGCCCGCCCCCGCCGG - Intergenic
1072970140 10:100010059-100010081 CGCCCCGCGCTCGCGCCCCCTGG + Intergenic
1073812433 10:107164952-107164974 CTCTGCGCCCCCGCGGCCGCGGG + Intergenic
1074182918 10:111078870-111078892 CCTGGCGAGCCCGCGCCGGCCGG + Exonic
1074829888 10:117241040-117241062 CCCCCCGCCCCCGCTCCCTCCGG + Intergenic
1074864648 10:117537683-117537705 CCCAGCGCTCCCCCGCCCTCGGG + Intergenic
1074864659 10:117537698-117537720 CACCGCGCCCCCGAGCCCGAGGG - Intergenic
1075501692 10:122980580-122980602 TCGCGCGCGCCCTCGCCCACCGG + Exonic
1076035696 10:127196765-127196787 CCCCGCGCGCAGGCGGCAGCCGG - Intronic
1076792923 10:132786253-132786275 CCCCGCCCGCGCGCCCCCGCCGG + Intergenic
1076992099 11:280708-280730 CCACGCGCGCCGCCGCCCCCGGG + Exonic
1077047955 11:554540-554562 CCCCCCACCCCCGTGCCCGCGGG - Exonic
1077098480 11:810144-810166 CCACGCGCGGCCTCGCCCGGCGG + Intronic
1077919180 11:6630538-6630560 AGCCGCGCGCCCGCGCCTCCCGG + Exonic
1078771759 11:14358621-14358643 CCCCGCGCCCTCCCGCCCCCTGG + Intronic
1080386569 11:31814174-31814196 CCCCGCGGGAACGCACCCGCCGG - Intronic
1081575568 11:44316854-44316876 ACCCCGCCGCCCGCGCCCGCTGG + Intergenic
1083747690 11:64744789-64744811 CTCCGTGCGCTCCCGCCCGCCGG + Intronic
1083758426 11:64803265-64803287 CCCGGCGCGGCCCCGCCCCCGGG - Intergenic
1084028489 11:66467168-66467190 CCACCCGCACCCGCGACCGCAGG - Intronic
1084174369 11:67415839-67415861 CCCCGGGCGCCCGCTCCCCGCGG + Intronic
1084516330 11:69639598-69639620 TCCCGCGCCCCCTCCCCCGCCGG - Intergenic
1084588762 11:70078470-70078492 CTCCCCGCGCCCAGGCCCGCCGG - Exonic
1084650281 11:70485534-70485556 GCCCGCTCCCCCGCCCCCGCCGG - Intronic
1088314925 11:108498101-108498123 CCCCGCGCGTCCCCGCCGCCCGG - Intronic
1089499819 11:118925506-118925528 CCCCGCGCCCCGGCCCCGGCGGG - Intronic
1089527637 11:119107626-119107648 CCCCGCGCGCCCAGCCCCGGGGG + Exonic
1092743258 12:11649932-11649954 CCCCGCGCGCCCAACTCCGCCGG + Exonic
1095687234 12:45050478-45050500 CCAGCCGCGCCCGCGCCCCCAGG - Intronic
1096024743 12:48350911-48350933 CCCGCCCCGCCCGCGCCTGCCGG - Intronic
1096073569 12:48788937-48788959 CCCCGCCCCGCCGCCCCCGCGGG + Intronic
1096101235 12:48971608-48971630 CCCAGCGCCGCCGCGGCCGCCGG + Exonic
1096101298 12:48971836-48971858 GCGCGCGCGCGCGCGCGCGCTGG - Intergenic
1096204182 12:49707331-49707353 CGCCGCGCGCCCCCGCCAGCGGG - Exonic
1096255049 12:50057715-50057737 GTCCGCCCGCCCGCGCGCGCTGG - Exonic
1096259286 12:50081080-50081102 CCCCTGGCGCCTGCCCCCGCAGG + Exonic
1096788411 12:54030884-54030906 CCAAGCGCTCCCGCGCCTGCCGG + Intronic
1096983627 12:55743152-55743174 GCCCGCGCGCCCGCCGCCCCCGG + Intergenic
1097166497 12:57089049-57089071 CTCCGCGCCTCCGCCCCCGCAGG - Exonic
1097281234 12:57846444-57846466 CCCAGCCAGCCCGGGCCCGCGGG - Exonic
1097981766 12:65742600-65742622 CCCAGCGAGCACGCGCCGGCGGG + Intergenic
1098897814 12:76083970-76083992 CCCCGCGCGGCCGCCCCCAATGG + Intronic
1099989559 12:89708561-89708583 CGCCGCCCGCCCGCGGCCGGGGG - Intronic
1100260661 12:92929343-92929365 CCCCGCCCCCCGGCGGCCGCGGG - Intergenic
1100315473 12:93441485-93441507 TCCCGCGCGCCCGCGGCCTCCGG + Intronic
1101494001 12:105236295-105236317 CCCCGCGAGCCGGCGAGCGCAGG - Intronic
1101504173 12:105330961-105330983 CCTCTCCCGCCCGCCCCCGCCGG - Intronic
1101910575 12:108857670-108857692 CCTCCCGCGCCGGCGCGCGCAGG + Intergenic
1102933560 12:116879767-116879789 GCCCGAGCGTCTGCGCCCGCGGG - Intronic
1102933818 12:116881118-116881140 CGCCGGGCGCCGGCGCCCTCCGG + Exonic
1103363972 12:120369220-120369242 CCCCGCCCGCCCGCCCGAGCGGG - Intergenic
1103364007 12:120369324-120369346 CCGCGGGCGCCCGGGCTCGCGGG - Intergenic
1103856009 12:123972227-123972249 ACCCCCGCGCCCGCCCCCGCGGG - Intronic
1103954090 12:124567108-124567130 CCCGGCGCCCCCGAGCACGCGGG + Intronic
1104049446 12:125186154-125186176 CCGCGAGCGCCCGCGACCCCCGG + Intergenic
1104568417 12:129904354-129904376 CACCGCGCGTCCGCGCTCGCAGG - Intergenic
1104857241 12:131907988-131908010 CCACCCACCCCCGCGCCCGCCGG - Intronic
1105459102 13:20567117-20567139 CCCCGCCCGCCCCCGCGCGGAGG + Exonic
1105474999 13:20721502-20721524 CCTCGCACGCACGCGCCCGCAGG + Intronic
1106247160 13:27960424-27960446 CCCAGAGCGCGCGCGCCCTCTGG + Intergenic
1106665390 13:31846510-31846532 CCGAGCGCGCCGGTGCCCGCAGG + Intergenic
1106735871 13:32587022-32587044 CCCCCCGCGCCCCGGCCGGCCGG + Intronic
1107603865 13:42040352-42040374 CTCCGCGCGCCCGGCCCCGGGGG + Intronic
1107604049 13:42040861-42040883 TCGCGCCAGCCCGCGCCCGCCGG - Intronic
1107851746 13:44577728-44577750 TGCCGCGTGCCCGCGCGCGCCGG - Intergenic
1108542069 13:51453634-51453656 CCGCCCGCGCCCGCTCGCGCCGG - Intronic
1110860367 13:80340356-80340378 CCCCGCGCGCCCGCGCTCTAGGG - Intronic
1112088218 13:96053582-96053604 TCCCGCGGGTCCGCTCCCGCGGG + Intergenic
1112344123 13:98576604-98576626 CCCCGCGCGCCCGGCTCGGCCGG - Intronic
1112752555 13:102597215-102597237 GCCCCCGCGCCCGGGCCCTCGGG - Intronic
1113494132 13:110714328-110714350 CGCGGCGCGCCCGGACCCGCCGG - Intronic
1113820386 13:113209096-113209118 CCGCGCGCTCCCGAGCCTGCAGG + Intronic
1113985732 13:114314428-114314450 CGCCGCGCGCCCTCCCGCGCGGG - Intergenic
1115852607 14:37599621-37599643 CCCCACCCGGCCTCGCCCGCGGG + Intronic
1117368219 14:55051866-55051888 TCCCGCTTGGCCGCGCCCGCGGG - Intronic
1118808913 14:69260009-69260031 CCCCGCGCTCCAGCCGCCGCCGG - Exonic
1118808928 14:69260060-69260082 CCCCGAGCGCGCGCGTCCCCCGG - Exonic
1121253012 14:92513637-92513659 GCCCGGGCGGCCGCGCCCCCGGG - Intergenic
1121711015 14:96039311-96039333 CCCCGCCCGCCCCCGCGCTCGGG + Exonic
1122066041 14:99175094-99175116 CCCCCCGCGCCCGGGACCCCGGG + Exonic
1122081356 14:99269980-99270002 CCCCGCCCGCCGCAGCCCGCGGG - Intronic
1122231125 14:100306697-100306719 CCCCGCGCGTCCCCTCCCGCCGG - Intergenic
1122779125 14:104136274-104136296 CGCCGCGCGCCCCCGCGCTCCGG - Intergenic
1123004606 14:105315150-105315172 CCCCCCGCGCCCCCGCCCGCCGG + Exonic
1123021066 14:105398255-105398277 CTCCGCGCGCGCGGGGCCGCAGG - Intergenic
1123040326 14:105487710-105487732 CCCCGCGCCCGCGCGCCCCGAGG + Intronic
1123630713 15:22258136-22258158 CCCCGCGCGCGCCCGCCCGCCGG + Intergenic
1123709930 15:22980073-22980095 CCCCGGGCTCCCGCGCCTCCCGG - Intronic
1123774189 15:23562104-23562126 CTCCGCGCGCCCAGCCCCGCTGG + Intergenic
1123787462 15:23687395-23687417 CCCCGCCCGCCCCCAGCCGCTGG - Intergenic
1124251143 15:28107078-28107100 CCGCTCGCTCGCGCGCCCGCCGG + Intergenic
1124286376 15:28403216-28403238 CGCCGCCCGCCCGCGCCGCCAGG - Intergenic
1124296327 15:28508420-28508442 CGCCGCCCGCCCGCGCCGCCAGG + Intergenic
1126102883 15:45130125-45130147 CCCGGAGCGCCCAGGCCCGCGGG - Intronic
1126766923 15:52019121-52019143 CCCAGCGCACCCGCACGCGCCGG - Intronic
1126767051 15:52019603-52019625 CGCCGCCCGCCCGCCCGCGCGGG - Intronic
1126849747 15:52789725-52789747 CCCCGCGCACCCGCGCTCCATGG - Exonic
1128067970 15:64775935-64775957 CGCTGCGCGCCCCAGCCCGCGGG + Intergenic
1128580994 15:68809680-68809702 ACCCGCACCCCCACGCCCGCTGG - Intronic
1128995088 15:72289590-72289612 ACCTGCGCGCCCTCGCACGCAGG + Intronic
1130335291 15:82952710-82952732 CCCCGCCCGCCCGCGCCTGGCGG - Exonic
1130531175 15:84748675-84748697 CCCCGCTCGGCCCGGCCCGCGGG - Intronic
1130908434 15:88255643-88255665 CCCCGCGTGCCCTCGGCGGCCGG + Intronic
1131048652 15:89332595-89332617 CCCCGCCCCCCTGCCCCCGCCGG - Intronic
1131144342 15:90001675-90001697 CCCCCCGCGCCCCCGCCGGCCGG - Intronic
1131174402 15:90201163-90201185 CCCAGCGCTCCGGCGGCCGCCGG + Intronic
1131495270 15:92904291-92904313 CACCCCGCGCCGGCGCCGGCCGG - Intronic
1132778868 16:1612314-1612336 CCCCGCGCGCCCGCGCACCCCGG + Exonic
1132851516 16:2026961-2026983 TCCCCCGCGCCCCTGCCCGCGGG + Exonic
1132889447 16:2196642-2196664 CGCCGCGCGCCCCCGCCCCCGGG - Intergenic
1133188364 16:4116063-4116085 CCCCCAGCGCCCGCCGCCGCGGG - Exonic
1133273851 16:4625101-4625123 GTCCCCGCCCCCGCGCCCGCCGG - Intronic
1133286594 16:4693630-4693652 CCGCGGGCGGCCGCGCCCCCGGG - Intergenic
1134438864 16:14285742-14285764 CCCCGAGCCCCCGAGCCCGCCGG + Intergenic
1134529890 16:14975087-14975109 TCCCCCGCGCCCGCGGCCGGCGG - Exonic
1135517558 16:23148726-23148748 CCCTGCGCGCCGCGGCCCGCAGG + Exonic
1136414783 16:30096358-30096380 CCCCCGCCGCCCGCTCCCGCCGG + Intronic
1136627800 16:31472458-31472480 CCCCGCGCCCGGGCGCCCGCGGG - Intronic
1136636843 16:31529573-31529595 CCCCGCGCACCCTCCCCCGGAGG - Intergenic
1136719751 16:32310538-32310560 AACCGCGCGCGCGCCCCCGCGGG + Intergenic
1136778992 16:32885593-32885615 CCCGGCCGGCCCGCGCCCTCGGG - Intergenic
1136891626 16:33975925-33975947 CCCGGCCGGCCCGCGCCCTCGGG + Intergenic
1137531738 16:49282330-49282352 GCCCTCGCGCCCGCGCCCGCTGG - Intergenic
1138619144 16:58197890-58197912 CCCAGCCCGCCCGCCCCCGCGGG - Exonic
1138651460 16:58463684-58463706 CTCCGCGTGCCCGCGGCTGCAGG - Intronic
1140462247 16:75148960-75148982 CCCGGCGGGCGCGCGCGCGCGGG + Intronic
1140462248 16:75148961-75148983 TCCCGCGCGCGCGCGCCCGCCGG - Intronic
1141054506 16:80803673-80803695 CCCCGCGCCCCCGGCCCAGCCGG + Intronic
1141054681 16:80804224-80804246 CCCCGCGCGCACACGCACGGAGG - Exonic
1141280673 16:82627632-82627654 CCCAGGGCGCCCGGGCCCCCTGG + Intronic
1141527003 16:84618118-84618140 CCCCGCCCCCCCGCGCCCATTGG + Intergenic
1141972338 16:87492443-87492465 CCCCGCGCGCGCCCGCCCGCCGG - Intergenic
1142209777 16:88803587-88803609 CCACGCACGACGGCGCCCGCCGG + Exonic
1142377314 16:89712561-89712583 CCCCGCGCCCACGCACCCCCAGG + Intronic
1203006680 16_KI270728v1_random:207231-207253 AACCGCGCGCGCGCCCCCGCGGG - Intergenic
1203081403 16_KI270728v1_random:1147682-1147704 CCCGGCCGGCCCGCGCCCTCGGG - Intergenic
1203148297 16_KI270728v1_random:1817098-1817120 AACCGCGCGCGCGCCCCCGCGGG + Intergenic
1142762517 17:2050525-2050547 CCCCGCCCCCACGCCCCCGCCGG - Intergenic
1143598402 17:7929239-7929261 CCCCGACCCCCAGCGCCCGCTGG - Exonic
1143749949 17:9021148-9021170 CCCCGCCCGCGCGCTCCCCCGGG + Intergenic
1144778397 17:17796144-17796166 CCCCGCACGCCCGGACCCCCAGG + Exonic
1145243594 17:21253290-21253312 CCGCGCGCCCCGGCCCCCGCCGG - Exonic
1145867511 17:28250479-28250501 CCCCGCACGCCCACCCCCGAGGG + Intergenic
1146271438 17:31488188-31488210 CGCCGCCGACCCGCGCCCGCTGG + Intronic
1146492667 17:33293285-33293307 CCCCGCCCGCCCGGAGCCGCGGG - Intronic
1146922379 17:36722400-36722422 ACCCGCGCACCCCCGCCCGGAGG + Intergenic
1147123800 17:38352202-38352224 CCTCGCGCGGCCCGGCCCGCGGG + Intergenic
1147168598 17:38605702-38605724 CCCCCCGCGCCCCCGCCCGATGG - Exonic
1147179173 17:38674054-38674076 CCCTGCGCCCCCGCACCCTCGGG - Exonic
1147285301 17:39398032-39398054 CCCCCCCCCCCCCCGCCCGCCGG - Intronic
1147608309 17:41786447-41786469 CCCAGCGCGCCCCCTGCCGCCGG + Intronic
1147743756 17:42682996-42683018 CCCGGCCGGCGCGCGCCCGCTGG + Intronic
1147967000 17:44199252-44199274 CCCCGCGCCCCCTCCCCGGCCGG + Intronic
1147994858 17:44354894-44354916 CCCGGCGCTCTCGCCCCCGCGGG + Exonic
1148664165 17:49362137-49362159 CCCCGCTCGCCCTCGCGCGCTGG - Intronic
1148744417 17:49910435-49910457 CCCCCCGGGGCAGCGCCCGCTGG + Intergenic
1150268788 17:63849271-63849293 CCTCGCGCGCCCCCGCCTGGCGG + Intergenic
1150747173 17:67825612-67825634 CCCCTCCCGCCCGGCCCCGCGGG + Intronic
1151210465 17:72540474-72540496 CCGCCCGCGCCCGCGCCCGGTGG + Intergenic
1151296957 17:73192936-73192958 CCCCTCGCGCCCGCCCCCTCGGG + Intronic
1151707694 17:75779381-75779403 CCCCGCGCTCCCCCTCCCGGGGG - Intronic
1151875960 17:76868496-76868518 CCGCGCGCTCTCTCGCCCGCTGG - Intronic
1152249517 17:79204294-79204316 ACCCGCTCCCCGGCGCCCGCTGG - Intronic
1152541919 17:80981142-80981164 CCCCGCCCCCGCGCCCCCGCGGG + Intergenic
1152643466 17:81458526-81458548 CCCCGCCCTCCCCCGCACGCTGG + Intronic
1152708933 17:81860587-81860609 GCCCCCCCGCCCGCGCGCGCTGG + Exonic
1152748295 17:82051262-82051284 CCCCACTCCCCGGCGCCCGCGGG - Intronic
1152809544 17:82375071-82375093 GCGCGCGCGCCCCCGGCCGCCGG - Exonic
1153457222 18:5295269-5295291 CCCCGCCCTCCCGCGGCCGGGGG + Intronic
1153565609 18:6414727-6414749 CCCCGCGCGGCGGCGGCCGTGGG + Intronic
1155053260 18:22165800-22165822 CCCCCAGCGCCGGCTCCCGCCGG - Intergenic
1155392483 18:25351097-25351119 CCCCGCGCGCGAGCGCGAGCCGG - Intronic
1155654699 18:28178482-28178504 CTCCGCCCTCCCCCGCCCGCAGG - Intergenic
1157794109 18:50559633-50559655 CCCCGCGCGGCTGCAGCCGCCGG - Intergenic
1158427426 18:57352607-57352629 CCCCGCGCGCCCCTGCCTACGGG + Exonic
1160163276 18:76491413-76491435 CCCCGCCCGCCCCCGCCCCCCGG + Intronic
1160500578 18:79399683-79399705 CCCTGCGCGCCCCCGCCCCGCGG - Intronic
1160500706 18:79400118-79400140 CCTCGCGCGCGCGCGACCGCAGG - Intronic
1160500866 18:79400584-79400606 CCCGGCGCGCCCGGGACCGAGGG + Intronic
1160680345 19:409226-409248 GCCCGCGCCCCCGCCCCCGCGGG + Intergenic
1160719369 19:590614-590636 CCCCGCGCGCCCGGCTCCCCGGG - Intronic
1160725556 19:616489-616511 CCCGGCCCGCCTGGGCCCGCGGG - Exonic
1160739006 19:677372-677394 CTCCGCGTGCCCTCGCCCTCGGG + Intronic
1160868494 19:1266578-1266600 CCCCACGGGGCCCCGCCCGCCGG - Intronic
1160873259 19:1286399-1286421 CCCCACGCGCGCGCCGCCGCCGG + Intronic
1160919495 19:1513126-1513148 CCCCGGGCGCCCTCGCGCGGCGG + Exonic
1160930742 19:1568418-1568440 CCCCGCGCGCCTGCGCCCTGGGG - Intergenic
1160967552 19:1753313-1753335 CTGCGCCCGCCCGCGCCCGCTGG - Exonic
1160967770 19:1754085-1754107 CCACGCGCACCCGCACCCGGCGG + Exonic
1160968604 19:1757571-1757593 CCGCGCGGCCCCGCGGCCGCGGG + Intronic
1161006834 19:1941311-1941333 CCCCGCGCCCCCTCGCGCTCCGG - Exonic
1161063597 19:2227152-2227174 CCCCCCGCCCCGGCCCCCGCCGG + Intronic
1161080607 19:2308201-2308223 CGCCGCGCGCAACCGCCCGCCGG + Intronic
1161153608 19:2721466-2721488 CCCCGGGGACCCGCGCCCACGGG + Intronic
1161203698 19:3029371-3029393 CCCCGCGCCCGCGCCCCCCCCGG + Intronic
1161358189 19:3831433-3831455 CCCCCGCCGCCCGCGCCTGCAGG - Exonic
1161399632 19:4061554-4061576 GCCCGCCTGCCCTCGCCCGCAGG + Intronic
1162095657 19:8308342-8308364 CCCCGCGCGTGCGCGTGCGCAGG - Exonic
1162321024 19:9970629-9970651 CCCGGCGCCCCCGGGCCCCCCGG - Exonic
1162745088 19:12793585-12793607 CCCCGCCCAGCCGCGCGCGCCGG + Intronic
1162951315 19:14073456-14073478 CCCCGCGCTCCCGCGCGCCCTGG + Exonic
1163008453 19:14410508-14410530 CCTCCCGCGCCTGCGCTCGCTGG - Intronic
1163138637 19:15331944-15331966 CCCCGCCCGCCCCCGACCGCCGG + Intronic
1163154523 19:15432606-15432628 CCCCGCGGGCGCGCGCTCCCGGG + Intronic
1163154524 19:15432607-15432629 GCCCGGGAGCGCGCGCCCGCGGG - Intronic
1163167591 19:15508577-15508599 CCACGCGCGCACTCACCCGCGGG - Exonic
1163666384 19:18605979-18606001 CCCCGTGCGCCGGGTCCCGCAGG + Intronic
1163708543 19:18832061-18832083 CCGCGCGCCCCGGCGCCAGCCGG - Exonic
1163715504 19:18870207-18870229 ACCCGCGCCCCCGTGCCCCCAGG - Exonic
1163807260 19:19406501-19406523 CCCCGCGCGCCCACGCCTGGAGG + Intronic
1164990103 19:32676701-32676723 CCTCGCGCTCCAGCTCCCGCAGG - Exonic
1165157346 19:33796503-33796525 CCGCGCGCGCCCGTTCGCGCTGG + Intronic
1165477393 19:36039337-36039359 CCCGGCGTGCCCGTGCCAGCAGG + Exonic
1166042803 19:40213614-40213636 CCCACGGCGCCCGCGCCCCCGGG - Exonic
1166367387 19:42284432-42284454 CCCCGCCCCCCGGCGCGCGCGGG - Intronic
1166792548 19:45406576-45406598 CCCCGCGCTCCCGCACCAGTTGG + Exonic
1167002857 19:46756173-46756195 CGCGGCGCGCCAGCCCCCGCTGG + Exonic
1167375331 19:49108026-49108048 CCTTGCGCTCCCGCTCCCGCCGG - Exonic
1167643782 19:50695248-50695270 CCCCGCGCCCCCGCGCCCCCCGG - Intronic
1167797487 19:51719372-51719394 CCCACCGCGCCCGCCGCCGCGGG + Exonic
1168056986 19:53869499-53869521 GCCCGCACCCCCGCCCCCGCGGG + Exonic
1168059262 19:53882282-53882304 CCCCACTCGCCCGCTCCCCCTGG + Exonic
1168076177 19:53981989-53982011 CCCTGCCCGCCTGCGCCAGCGGG - Intronic
1168315318 19:55482432-55482454 GGCCGGGCGCCCGCCCCCGCAGG + Exonic
1168714690 19:58519840-58519862 CCCTGCGCCGCCGCGACCGCAGG - Exonic
1202712435 1_KI270714v1_random:25661-25683 GCCCGCCAGCCCGCGCCCGCCGG - Intergenic
925928171 2:8685359-8685381 CCTCCAGCGCCAGCGCCCGCGGG - Intergenic
929665673 2:43832028-43832050 CCCCGCGCGCCCCAGCCTCCCGG + Exonic
930730708 2:54725020-54725042 CCCCCCGCCCCCCCGCGCGCCGG - Exonic
931711000 2:64989165-64989187 GCCCGCGCCCCCGCGGCCTCGGG + Intronic
932812221 2:74834820-74834842 CCCCGCCCGCGCGCACTCGCCGG - Intronic
934566986 2:95346618-95346640 CCCCGCGCCCCGGCGCCCGCGGG + Intronic
935059302 2:99593817-99593839 CCCAGCGCGTCCGCGGCCGCGGG + Exonic
935396947 2:102619500-102619522 CCCGCCCCGCCCCCGCCCGCGGG + Intergenic
935622900 2:105144307-105144329 CTCCTCGCGCCCCCGCGCGCCGG - Intergenic
935820459 2:106887532-106887554 CTCCCCGCGGCCCCGCCCGCAGG - Intergenic
936433230 2:112482130-112482152 GCTCGCACGCCCGCCCCCGCCGG - Intergenic
936433242 2:112482173-112482195 CGCCGCGCCCGGGCGCCCGCCGG - Exonic
936433291 2:112482315-112482337 CGCCGCGCGCCCGGGCCGCCGGG - Exonic
936512202 2:113157459-113157481 CCCCGCGCCCAGGCGCCGGCTGG - Intronic
936713612 2:115161428-115161450 ACCCGCGCGCCCACGGCCGCCGG - Intronic
937044129 2:118842089-118842111 CCCAGCGCCCCTGCGCACGCCGG - Intergenic
938073923 2:128322219-128322241 CCCCGCGGGTCCGCGCGAGCCGG - Intergenic
939003987 2:136765387-136765409 CCCCGCGGCCCCGCGCCCCGCGG + Intergenic
940918899 2:159286582-159286604 CCGCGCGCCCCCGCTCCTGCAGG - Exonic
941095906 2:161239051-161239073 CCCCGCGCGGGCTCGCCCGAGGG + Intergenic
941096686 2:161245164-161245186 CCCGGCGCGGCCGCGGCCGGGGG - Intergenic
942459115 2:176157426-176157448 GGCCGCGCTCCCGCGCCCGCCGG - Intronic
944495859 2:200306855-200306877 CCCCTGGCGACCGCGCCCCCGGG + Intronic
944495956 2:200307147-200307169 TCCCGCTTGCCCGCGCCGGCTGG - Intronic
945833121 2:214809698-214809720 CCCCGCGCGCCCCGCCCCTCTGG - Exonic
947669141 2:231925784-231925806 CCCCACGCGCCCGCCGGCGCGGG + Intronic
947754317 2:232550789-232550811 TCCCCCGCGCCCGCCCCCGCTGG + Intronic
947800912 2:232928153-232928175 CCAGGCGCGCGCCCGCCCGCGGG - Intronic
948116025 2:235494619-235494641 CCCCGCGCCCCGGGGCCCGCGGG - Exonic
948645225 2:239400435-239400457 CCCCGCGCCCCCGCCCCGGCGGG + Exonic
948801583 2:240435737-240435759 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
1168753061 20:297514-297536 CATCGCGCGCGCCCGCCCGCCGG - Exonic
1168878032 20:1184904-1184926 CCCACCGCGCCCGCTCCCGCCGG + Intronic
1169120444 20:3092809-3092831 CCCCGAGCTTCCGCGCCCTCGGG - Intergenic
1169143678 20:3239332-3239354 CGCCCCGCGCCCTCACCCGCGGG + Intergenic
1169164123 20:3407693-3407715 GCCCCCGCCCCCGCCCCCGCCGG - Intergenic
1169278434 20:4248722-4248744 CCGCCCGCGCCCGCGCTCCCCGG + Exonic
1169367173 20:5001220-5001242 TCCCGGGACCCCGCGCCCGCCGG - Intronic
1170968932 20:21101280-21101302 CCCCGCGCTCCCTCCCTCGCCGG - Intergenic
1170999285 20:21396880-21396902 TCCCGCGCCCCCGCGCCCCTCGG + Intronic
1171223263 20:23420683-23420705 CCCCGAGCTACCGCGCCCGCGGG + Intronic
1172015609 20:31870736-31870758 CCCCATCCGCCCGCGCCTGCCGG - Exonic
1172028950 20:31968255-31968277 CGCCGCCTCCCCGCGCCCGCCGG - Exonic
1172421875 20:34825233-34825255 CCTCCAGCGCCCCCGCCCGCAGG + Intronic
1173516235 20:43667244-43667266 CGCCGCGCTCGCCCGCCCGCCGG - Exonic
1173807461 20:45935084-45935106 CGCCGCGCGCTCCCGCCCCCGGG - Intronic
1174258802 20:49278276-49278298 CCGCGCCCGCCTGAGCCCGCCGG - Intronic
1174287687 20:49483991-49484013 GCCCGGGCGCCCCCGCCCGTGGG + Intergenic
1174357865 20:50010217-50010239 CACCGCGCGCCCCGGCCGGCAGG + Intergenic
1174406150 20:50304640-50304662 CCCCGCCCGCCAGCTCCAGCAGG - Intergenic
1174804446 20:53593721-53593743 CGCCCCCCGCCCGCGCCAGCCGG - Intronic
1175338099 20:58209656-58209678 CCCCCCGCCCCCGCCCCCACCGG + Intergenic
1175907239 20:62386924-62386946 CCCCGCGCCCCAGGGCCAGCAGG + Intergenic
1176005598 20:62860993-62861015 CCCCGCCAGCCCCCGGCCGCCGG + Intronic
1176029594 20:63005568-63005590 CCTCGCGCTCCCGCTCCAGCCGG - Intergenic
1176061578 20:63175067-63175089 CCTCCCGCTCCCGCCCCCGCCGG + Intergenic
1176547817 21:8209069-8209091 ACCCCTGCGCCCGCGCCCGCCGG + Intergenic
1176547884 21:8209256-8209278 CCTCGCGCGCCCGCGGGCGCCGG + Intergenic
1176547887 21:8209265-8209287 GCGCGCGCCCCGGCGCCCGCGGG - Intergenic
1176566816 21:8392284-8392306 CCCCGCCTGCGCGCGCCCGCGGG + Intergenic
1176574644 21:8436304-8436326 ACCCCTGCGCCCGCGCCCGCCGG + Intergenic
1176611257 21:8987596-8987618 ACCCCTGCGCCCGCGCCCGCCGG + Intergenic
1176733533 21:10522057-10522079 CGCCCCCCGCCCGCGCCAGCCGG + Intronic
1178498877 21:33109763-33109785 CCCTGCGCTCCGGCGCCCGCAGG + Intergenic
1178707605 21:34888661-34888683 CCCGTCCCGCCCGCGCCCGCTGG + Intronic
1178992196 21:37366194-37366216 CCCCGCGCGCCCGGGCCTGGAGG - Intronic
1179213735 21:39349118-39349140 CCCCCCGCGTCCCCGGCCGCGGG + Exonic
1179783811 21:43718819-43718841 CCCCGCGCCCCGCCGCACGCAGG - Intergenic
1179912142 21:44456040-44456062 CCTGGCGCGCGAGCGCCCGCTGG + Intronic
1180650213 22:17370303-17370325 CCCCCCGCGCCCGGCCCCGCCGG - Intronic
1181514382 22:23402714-23402736 CCTCGCGCCCGCGCTCCCGCCGG - Intergenic
1182211354 22:28679848-28679870 AACCGCGCGCGCGCCCCCGCGGG + Exonic
1182445532 22:30387347-30387369 CCCCCCGCGCCCGGGACCCCTGG - Exonic
1183476440 22:38038564-38038586 CCCCTTGCGCCCGCGCCCATGGG + Intronic
1183504695 22:38202510-38202532 CACAGCGCCCCCGCCCCCGCCGG - Intronic
1183535469 22:38398404-38398426 CGCCCCCCGCCCGCGCCAGCCGG - Intronic
1183607117 22:38872279-38872301 CCCGCCGCGCTCCCGCCCGCCGG - Exonic
1183650913 22:39152771-39152793 CCCCCGGGGCCCGCCCCCGCGGG + Intergenic
1183939527 22:41285579-41285601 CCCAGCAGGCCCACGCCCGCGGG - Intronic
1184523225 22:45007780-45007802 GGCCGCGCGCCCCCGCCCCCTGG - Intronic
1184645253 22:45891721-45891743 CCACACGCGCCCGCGCCCCGCGG + Intergenic
1184676262 22:46045018-46045040 CCCCTCCCGCCCTCGCCCGGCGG + Intergenic
1184680765 22:46071259-46071281 CCCCGCGTGCGCGTCCCCGCGGG - Intronic
1185229543 22:49672277-49672299 CCCCCCGCCCCCACCCCCGCTGG - Intergenic
1185255202 22:49827757-49827779 GCGCCCGCGCCCGCGCCCGCCGG - Intergenic
1185291572 22:50030263-50030285 CCCCGCTCCCCGGCTCCCGCCGG + Intronic
1185336005 22:50271118-50271140 CCCCGCGCCTGCCCGCCCGCGGG - Intergenic
1203252691 22_KI270733v1_random:125354-125376 ACCCCTGCGCCCGCGCCCGCCGG + Intergenic
1203260748 22_KI270733v1_random:170441-170463 ACCCCTGCGCCCGCGCCCGCCGG + Intergenic
950584019 3:13880180-13880202 CCCAGCGCCCCTGCGCCCGCGGG + Intergenic
950710576 3:14810633-14810655 CGCCCCGCGCCCCCGCCCGGCGG + Intergenic
950729827 3:14947765-14947787 CCCCGCGAGCCCGCGGCCCCCGG + Intronic
953705218 3:45225832-45225854 CCCCGAGCGCCCGGGCCCGGAGG - Exonic
954200586 3:49021213-49021235 TCCCGCTCGCCCGGCCCCGCGGG + Exonic
954864687 3:53718576-53718598 CCCCCCGCCCCCCCGCCCCCCGG + Intronic
955368708 3:58332859-58332881 CCACGCGCCGCCGGGCCCGCGGG - Exonic
956605006 3:71065077-71065099 CGCCCCGCGCCCGCGCGCCCCGG + Intronic
959085644 3:101849150-101849172 CCCCGGGCGCCCAGGCCCGGCGG + Intronic
961202432 3:125055655-125055677 CGCCGCGGGCCCGCGACCCCCGG - Exonic
961365166 3:126394996-126395018 CCCCGCGCGCCCCCTCTCCCCGG - Intronic
961446525 3:126983872-126983894 CCCCGCGCCCCAGGGCCGGCCGG - Intergenic
961666794 3:128497769-128497791 CCCCGCCCGCGCGCGCGCGATGG + Intergenic
961827329 3:129606029-129606051 CCCCCCGCGCCCGCGGCGGGAGG + Exonic
962520752 3:136195858-136195880 CCCCGCCCCCTCCCGCCCGCCGG - Intronic
964087553 3:152835637-152835659 CCCTGCGCGCCCCCTCCCGCGGG + Exonic
964518859 3:157542597-157542619 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
965590591 3:170357506-170357528 CGCCGCGCGCGCGGGCCCGCCGG - Intergenic
966378835 3:179323335-179323357 GCCCGCACGCCCGCGTCCCCTGG - Intronic
967858525 3:194135133-194135155 CCAGGCGCGCCCACGCCGGCCGG + Intergenic
968046155 3:195624830-195624852 CGCCCCGCGCCCGCGTCCTCGGG - Intergenic
968093015 3:195909694-195909716 CGCCCCGCGCCGGCCCCCGCAGG + Intronic
968308499 3:197665257-197665279 CGCCCCGCGCCCGCGTCCTCGGG + Intergenic
968651361 4:1761479-1761501 CCCCGCGCGCCCCACCCAGCCGG + Intergenic
968653117 4:1767724-1767746 CCCGCCACGCCCGCGCCGGCCGG + Intergenic
968673037 4:1862610-1862632 CCCCGCGACCCCGCCCCAGCCGG - Intergenic
968674825 4:1871649-1871671 CCCGGCGCTCCCGCCCCCTCAGG - Intronic
968803253 4:2756456-2756478 CCCCGCGCAGCCCCGCCCGACGG + Intergenic
968914096 4:3489616-3489638 CACCGCCCACCCTCGCCCGCAGG - Intronic
969344806 4:6563852-6563874 CCCCGCCCGCCCGCCCGCGCAGG - Intergenic
972311982 4:37890778-37890800 CCCCCCGCCCCCAAGCCCGCGGG - Intergenic
972321541 4:37977312-37977334 CCCCGAGAGGTCGCGCCCGCGGG - Intronic
972418805 4:38867871-38867893 CCCCGCGCTCGCCCGCCCCCCGG - Intronic
973954449 4:56049229-56049251 CGCCGCCCGCCCGGGACCGCCGG + Intergenic
975673162 4:76801999-76802021 CCCACCGCGCCCGCCCACGCTGG + Intergenic
976068292 4:81214883-81214905 CCCCGCGCGCCCTCACACCCCGG + Intronic
977694341 4:99949927-99949949 GGCCGCGCGCCTCCGCCCGCCGG + Intronic
978443882 4:108762686-108762708 CCCCGCGCGCCTCCACCTGCAGG - Intronic
981128324 4:141132293-141132315 CTCCCCTCCCCCGCGCCCGCTGG + Intronic
981429844 4:144646008-144646030 CCCCGCGCGAGCGCGTCCCCCGG - Exonic
985550151 5:528683-528705 CCCCGCTCCCCCGCGCCCCTGGG + Intergenic
985747156 5:1654045-1654067 CGCCCCGCGCCCGCGTCCTCGGG + Intergenic
986184508 5:5423011-5423033 CCCCCCGCGCCCGGGGCCCCGGG - Intronic
986330724 5:6714263-6714285 CGCCGCGCGCCCTCGGCCGCGGG - Intergenic
986330774 5:6714488-6714510 CCGCGCGGCCCCGCGCCCGCCGG + Intergenic
987340549 5:16935907-16935929 CCCCGCGGGCGCGCGTCCTCGGG - Exonic
989178910 5:38556772-38556794 GGCCGCGCGCCCGCGCGCGCGGG + Intronic
989983095 5:50666612-50666634 CCGCGCACACTCGCGCCCGCGGG - Intronic
992487591 5:77210878-77210900 CCGCCCGCGCCCGCGGCCGCCGG - Exonic
992837409 5:80654607-80654629 CCCCCCGCCCCGGCGCACGCAGG + Exonic
994072791 5:95620706-95620728 CACCGCGCGCCGGCGCTCGAGGG - Exonic
995106375 5:108381468-108381490 CCCGGCGCGCCCGCCCCCGCCGG - Exonic
996329361 5:122312086-122312108 CCCCGCCCGCGCGCGCCCGTTGG + Exonic
997692248 5:135834760-135834782 TGCGGCGCGCTCGCGCCCGCGGG + Exonic
998130283 5:139648327-139648349 CGCCGCGCGCCCGCCCGGGCAGG - Exonic
998131267 5:139652145-139652167 GCGCGCGCGCGCGCGCGCGCCGG - Intronic
999462910 5:151772166-151772188 CCGCGCGCGCCTGCGGCCGTTGG - Intronic
1001773413 5:174312020-174312042 CCCCGCGCCCCCGCGCGCCCGGG - Intergenic
1002487616 5:179550528-179550550 CCCCGCGCCCGCCCGCCCGCTGG + Intergenic
1003035004 6:2634349-2634371 CCCCGCCACGCCGCGCCCGCAGG + Intronic
1003212357 6:4079159-4079181 CCCCGGGCGCCCCCGCTCTCTGG - Exonic
1003212416 6:4079340-4079362 CCCCGCCCGGCCTCCCCCGCGGG + Exonic
1004767717 6:18749550-18749572 GCGCGCGCGCACGCGCGCGCAGG - Intergenic
1005605517 6:27473150-27473172 CCCCGCACGCCGGCGCCGGGCGG + Intergenic
1006599026 6:35213744-35213766 CCCTGCGCGCCCGGGCGCGGTGG - Intergenic
1007775706 6:44223420-44223442 CCCCGAGCCCCTGCGCCCCCAGG - Intronic
1007800505 6:44388145-44388167 CCCCGCCCCCCCGCCCCCCCCGG + Intronic
1008013341 6:46491275-46491297 CCCCACGCGCTCGCACCGGCGGG - Exonic
1008629285 6:53348410-53348432 CGCCGCGCGCTCCGGCCCGCAGG + Intronic
1009808771 6:68635250-68635272 CCCCCCGCGCGCGCGCCCAAGGG + Intergenic
1010083100 6:71886717-71886739 CTCCGCCTGCCCGCCCCCGCCGG + Intronic
1013048896 6:106512697-106512719 CCCCGCCCGCCAGCGGCCCCCGG + Exonic
1013459005 6:110357958-110357980 CCCCGCGCGGGCGCCCCCGCCGG - Exonic
1014233853 6:118934489-118934511 CCCCGCCCGCCTGCACCTGCCGG + Intronic
1015880509 6:137866788-137866810 ACCCTGGCGCCCGGGCCCGCAGG - Intergenic
1017206250 6:151807446-151807468 CCTCGTGCGCCCCCGCCCCCTGG + Intronic
1017324579 6:153130965-153130987 CGCCGCGCAGCCGCCCCCGCCGG + Intronic
1017497637 6:154995561-154995583 CCGCGCGCCGCCCCGCCCGCAGG - Intronic
1017672004 6:156777797-156777819 CGCCGCGCGCCCCCGCCTCCAGG - Intergenic
1018091198 6:160348164-160348186 CACCGCGCGCCCACCCCGGCCGG + Intergenic
1018956407 6:168413217-168413239 CCCCGCGTACACGCTCCCGCAGG - Intergenic
1019474539 7:1237581-1237603 CCGCGCGCCCCCGCGCGCACTGG + Intergenic
1019743719 7:2688275-2688297 CCTCGCAGTCCCGCGCCCGCCGG - Intronic
1020006391 7:4785608-4785630 CCCCGCGCACCCGCCCGTGCAGG - Exonic
1020099863 7:5388760-5388782 CCCCCCGCGGCCACCCCCGCCGG - Exonic
1020278227 7:6637282-6637304 CCCGCCCCGCCCGCGCCCGCGGG - Intergenic
1022375211 7:29806394-29806416 CCCAGAGCGACCCCGCCCGCCGG + Intergenic
1023810326 7:43906520-43906542 CCCTGCGCCCCCGCGGCTGCCGG - Intronic
1026665179 7:72335857-72335879 CCCCGCTCGCCCTCGCCCCAAGG + Intronic
1026665311 7:72336324-72336346 GGCTGCGCGCCCCCGCCCGCAGG - Intronic
1026994470 7:74606564-74606586 TCCCGCCCGCCACCGCCCGCTGG + Intergenic
1027138252 7:75639345-75639367 ACCGGCGCGCCCGAGCCCCCGGG + Intronic
1027190803 7:75994543-75994565 GCCCCCGCCCCCGGGCCCGCTGG - Exonic
1029640664 7:101817121-101817143 CCTCCCGCGCCCGCACCCGGCGG - Intronic
1029701420 7:102248911-102248933 TCCCGGGCGCCCGCGGCCTCGGG - Exonic
1030262454 7:107580168-107580190 CCCCGCAGGCTCCCGCCCGCGGG - Intronic
1031531923 7:122886386-122886408 CCCCCGGCGGCTGCGCCCGCGGG + Intronic
1032074566 7:128830335-128830357 CCCGCCGCGCCCGCGGCCCCCGG - Intergenic
1033306725 7:140230782-140230804 CCCCGACAGCCCCCGCCCGCGGG - Intergenic
1034228044 7:149497876-149497898 CCCCGCCCAGCCCCGCCCGCGGG + Intergenic
1034228109 7:149498049-149498071 ACCCGCCTGGCCGCGCCCGCGGG + Intergenic
1034243219 7:149625017-149625039 ACCCGCCTGGCCGCGCCCGCGGG + Intergenic
1034446113 7:151115096-151115118 CCCGGCGCAGCCGCACCCGCGGG + Intronic
1034467317 7:151237736-151237758 CCCTGCGAGCCAGGGCCCGCCGG - Exonic
1034500688 7:151448653-151448675 CCCCGCCAGCCCGGGCCCCCTGG + Intergenic
1034617931 7:152435522-152435544 CTCCGCGCCCCGGCGCCCCCCGG - Intronic
1034618090 7:152436065-152436087 CCCCGCCCGCCCGCACCCGCCGG - Intergenic
1035167344 7:156999791-156999813 CCCGGCCCGCCCCGGCCCGCGGG + Intronic
1035751895 8:2002222-2002244 CCCCGCGCCGGCGCGCCCTCGGG - Exonic
1037900476 8:22685425-22685447 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
1038540376 8:28385917-28385939 CCCCGCGCGCCCGCGGCTGTCGG - Intronic
1039521646 8:38176800-38176822 CCCATCGCGCAGGCGCCCGCGGG - Exonic
1039903129 8:41767187-41767209 GCGCGCGCACCCGCACCCGCCGG + Intronic
1039903168 8:41767293-41767315 CCCCGCGCCCCGGCCCCGGCCGG + Intronic
1039936512 8:42051422-42051444 ACCCGAGCGCCCGCGAGCGCGGG + Intronic
1039936583 8:42051601-42051623 CCCCGCGCCCCCGATCCCGCCGG - Intronic
1040587326 8:48756246-48756268 CCCGGCGCTCCCGCGCTCTCCGG - Intergenic
1041059393 8:54021921-54021943 CCCGCCGCGCCCGCGTCCCCGGG - Intronic
1041068172 8:54101966-54101988 CCGCGCGCGCCCGCGCGTCCAGG + Exonic
1041690086 8:60679360-60679382 CCGCGCGCCCCCGCCGCCGCCGG - Intronic
1044242444 8:89902691-89902713 CCCCGCGACCCCGAGCCAGCGGG + Exonic
1045432086 8:102123895-102123917 CCCAGCGCGCCCCATCCCGCCGG + Intronic
1045459407 8:102412779-102412801 GCCGCCGCGCCCCCGCCCGCCGG - Exonic
1046055223 8:109071100-109071122 CCCACCGAGCCCGCGCCCACCGG + Intergenic
1047961683 8:130016147-130016169 CCCGGGACCCCCGCGCCCGCCGG + Intronic
1048307986 8:133296970-133296992 CCCCTCGCGCCCGCGCCCCGGGG + Exonic
1049090717 8:140511682-140511704 CCCCTCGCGCCCCGCCCCGCCGG + Intronic
1049145699 8:141000407-141000429 GCCCGCGAGGCCGCGCCCGGGGG + Intronic
1049409035 8:142464274-142464296 CGCCGCGCGCGGGCGGCCGCCGG + Exonic
1049585301 8:143430161-143430183 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
1049592368 8:143468488-143468510 CCCTGCGCTGCCGCGCCTGCCGG + Exonic
1049719265 8:144108128-144108150 CCCCGCGCGCCCGCGCCCGCCGG + Exonic
1049724315 8:144138435-144138457 CCCAGGGCGCCCGCGCGGGCGGG + Intronic
1049752224 8:144290733-144290755 CCCAGCGCGGCCGCGGCCGAGGG + Intronic
1049769856 8:144374717-144374739 CCCCGCCCGCCCGCCGCCTCAGG - Intronic
1049801151 8:144518039-144518061 CCCCGGCCGCCCGCGCTCACCGG - Exonic
1049802497 8:144524575-144524597 CCGCGCGCAGCCGCGCCTGCTGG - Exonic
1049843200 8:144787244-144787266 CCCCGCGCGCCCGCCCCCGCCGG + Intronic
1051170641 9:14315550-14315572 AGCGGCGCGCGCGCGCCCGCCGG - Intronic
1053001224 9:34578154-34578176 CCCCTCGCCCACCCGCCCGCCGG - Intronic
1053034093 9:34809922-34809944 CCCCGCGCCCCCGCGCCCCGAGG - Intergenic
1053114528 9:35489822-35489844 CGGCCCGCGCCCGCCCCCGCGGG - Intergenic
1053306155 9:36986139-36986161 GCCGCCGCGCCCGCGCCCCCCGG + Intronic
1053306215 9:36986352-36986374 CCCGCCGCGGCCGCGCCGGCGGG + Intronic
1055030639 9:71768976-71768998 CCCCGCCCGGCCCCTCCCGCCGG + Intronic
1055757556 9:79572420-79572442 CTCCGCGCCCCACCGCCCGCCGG - Intronic
1056773760 9:89497573-89497595 CCCCGCTCCCCCGCGCCCAGAGG + Intronic
1059800454 9:117745070-117745092 CCGCGCGCTCGCTCGCCCGCAGG + Intergenic
1060140116 9:121202052-121202074 CCACGGGCGCTCGCGCCCGGAGG + Intronic
1060208949 9:121699000-121699022 CCCCTCGCCCCGGCGCCCGGGGG + Intronic
1061128182 9:128689698-128689720 CGCCGCCCGCCCCGGCCCGCAGG + Intronic
1061129777 9:128702521-128702543 CGCCGCGCGCCCGCGGGAGCCGG - Exonic
1061366148 9:130173096-130173118 CCCCGCGCGCTCGTGCCAGTCGG - Intronic
1061382379 9:130266143-130266165 GCCCCCGCACCCCCGCCCGCCGG + Intergenic
1061559708 9:131394429-131394451 CCCCGCAGCCCCGCGCCCGGCGG - Intronic
1061749864 9:132770260-132770282 CCCCGCCAGCCCGGGCCCGGAGG + Intronic
1061976004 9:134068225-134068247 CCCCGCCCCCGCGCGCCCCCCGG - Intronic
1062272235 9:135714808-135714830 CCGCGCGCCCCCGCAGCCGCCGG + Intronic
1062362291 9:136193692-136193714 CCGCCCGCGCCCGCTCCAGCTGG - Intergenic
1062425110 9:136502488-136502510 CCCCTGGCCCCCGTGCCCGCAGG - Exonic
1062584176 9:137241580-137241602 CCCCGCGCGCCCTGGCCGCCGGG - Intronic
1203469095 Un_GL000220v1:108506-108528 ACCCCTGCGCCCGCGCCCGCCGG + Intergenic
1203476916 Un_GL000220v1:152478-152500 ACCCCTGCGCCCGCGCCCGCCGG + Intergenic
1185508314 X:644651-644673 CCCCGCGCGCCCGGACTCCCGGG + Exonic
1186466108 X:9785945-9785967 CTCTGGGCGCCCCCGCCCGCCGG - Intronic
1189335579 X:40168918-40168940 CCCCGCCCGCCCGCCCTGGCCGG + Intronic
1190024904 X:46913318-46913340 GCCCGCGCTCCCGCTCCCGCCGG - Intronic
1190050306 X:47144593-47144615 TCCCGGCCGCCCGCGTCCGCTGG - Exonic
1192274748 X:69616927-69616949 TCGCGCGCGCCCGCGGCCCCTGG + Intronic
1195625221 X:106999926-106999948 CCCGGCGCGCCAGGGCCGGCGGG + Exonic
1196842542 X:119871809-119871831 CCCCGCTCGCGGGCGGCCGCGGG + Exonic
1197241444 X:124127145-124127167 CCCCCCGCCCCGACGCCCGCTGG + Intronic
1197754512 X:129984325-129984347 CCCCGCCTGCCCCCGCCCCCAGG - Intronic
1198530703 X:137548096-137548118 CCCCTCGCGCCGGCATCCGCTGG + Intergenic
1198767163 X:140091576-140091598 CCGCGCGCCCGCCCGCCCGCAGG + Intergenic
1200092948 X:153644279-153644301 GCCCCCGCACCCGCCCCCGCCGG - Intronic
1200098151 X:153673744-153673766 CCCCGCGCGTCCCCGCGCCCCGG + Intronic
1200100813 X:153688461-153688483 CCCGGCCGGCCCGCGCCCTCGGG + Exonic
1200128909 X:153830643-153830665 CCGCGCGCCTCCCCGCCCGCGGG + Intergenic
1200418259 Y:2935454-2935476 CCGCGTGCCCCCGCGGCCGCGGG + Intronic