ID: 1049724174

View in Genome Browser
Species Human (GRCh38)
Location 8:144137856-144137878
Sequence CGCTGGCGCCTCGGGAGGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049724158_1049724174 28 Left 1049724158 8:144137805-144137827 CCGGTCGGGTGGCAGCAGAGTGT 0: 1
1: 0
2: 2
3: 4
4: 71
Right 1049724174 8:144137856-144137878 CGCTGGCGCCTCGGGAGGGCCGG 0: 1
1: 0
2: 2
3: 10
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049724174 Original CRISPR CGCTGGCGCCTCGGGAGGGC CGG Exonic
900488142 1:2933191-2933213 CTCTGGGGCCTCGGGGGTGCAGG + Intergenic
900609757 1:3539544-3539566 TGCGGATGCCTCGGGAGGGCAGG - Intronic
900627842 1:3617464-3617486 CGCTGGGGCCTGTGGAGGGGTGG + Intergenic
901443540 1:9293319-9293341 CGCTGCCGCCGCTGCAGGGCAGG + Intronic
902289643 1:15427767-15427789 AGCTGGGGCCCCGGGTGGGCAGG - Intronic
903474030 1:23607234-23607256 AGGGGGCGCCACGGGAGGGCAGG - Intronic
904672890 1:32179598-32179620 GGCGGGCGCCCCGGCAGGGCGGG - Intergenic
904941010 1:34164882-34164904 CGCTGGCTCCTCGGCGCGGCTGG + Intronic
907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG + Intronic
909392925 1:75136437-75136459 CCCGGGCGCCGCGGGCGGGCTGG - Intronic
915024294 1:152812737-152812759 AGCTGGAGCCCCCGGAGGGCTGG - Exonic
915025727 1:152827739-152827761 AGCTGGAGCCTCCCGAGGGCTGG - Exonic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
921330571 1:214031490-214031512 TGCAGGCGGCTGGGGAGGGCGGG - Intronic
922758351 1:228109127-228109149 GGTTGGCGCCTCGTGTGGGCCGG - Exonic
923147716 1:231209707-231209729 GGCTTGAGCCTCGGCAGGGCCGG + Intronic
923163410 1:231337382-231337404 CGCCGCCGCCTCTGGAGGGGAGG - Exonic
1062946459 10:1465451-1465473 CCCTGGTGCCTCGGAGGGGCAGG - Intronic
1066370489 10:34815086-34815108 CGCTGGGGACTCGGGCGCGCGGG + Exonic
1067037022 10:42928192-42928214 CGCCGGGGACTCAGGAGGGCCGG + Intergenic
1067404587 10:46010082-46010104 GGCTGGAGCCTCGGAAGGGGAGG + Intronic
1067767215 10:49095827-49095849 GGCTGGGGCCCCAGGAGGGCAGG + Intronic
1069019171 10:63466092-63466114 CGCTGCCGCCTCCGCAGGGCCGG - Intergenic
1069873615 10:71548127-71548149 CACTGGGGCAGCGGGAGGGCTGG + Intronic
1070803639 10:79257665-79257687 GGATGGGGCCTGGGGAGGGCAGG - Intronic
1072257067 10:93630710-93630732 CGCTGCAGCCTGGGGAAGGCTGG - Intronic
1072267662 10:93745917-93745939 CACTGGGGCCTGTGGAGGGCAGG - Intergenic
1073216569 10:101839923-101839945 CGTGGGCGGCGCGGGAGGGCCGG + Intronic
1073812331 10:107164588-107164610 CGCTGGCGGCTGTGGGGGGCCGG + Intergenic
1073921650 10:108466319-108466341 CGCTGGCGGCTGTGGGGGGCAGG + Intergenic
1075279648 10:121128708-121128730 TGCAGGGGTCTCGGGAGGGCTGG - Intergenic
1075645416 10:124093157-124093179 CGCTGAAGCCTCGGGGAGGCCGG + Intronic
1076328561 10:129647171-129647193 CGCAGGCGCCTCCGCAGAGCAGG - Intronic
1076612801 10:131737001-131737023 CCCCCGAGCCTCGGGAGGGCAGG - Intergenic
1076692311 10:132230131-132230153 CGAGGCCGCCTTGGGAGGGCGGG + Intronic
1077204646 11:1336673-1336695 CGCGGGCGCCCGGCGAGGGCGGG + Intergenic
1081810148 11:45909891-45909913 CGCTGGCCCCTGGTGAGGACAGG - Exonic
1084214799 11:67641470-67641492 AGCAGGCGCCTCGGGCAGGCAGG - Intergenic
1089616830 11:119699521-119699543 CTCTGGCCCCTCTGGCGGGCAGG + Intronic
1090636809 11:128694640-128694662 CGCTGGGGCCACGGGAGCCCCGG - Intronic
1096154242 12:49332972-49332994 GGGTGGCGCCTCGGGTGGGGCGG + Exonic
1096260172 12:50085414-50085436 CGCCGGAGCCTCAGGAGGGGCGG + Exonic
1099682165 12:85843686-85843708 CCCTGCCACCTCGGTAGGGCGGG - Intergenic
1099995464 12:89773338-89773360 AGCTGGAGACTCGGGAGAGCTGG + Intergenic
1103325312 12:120116527-120116549 CGCGGGGGCCTCGGGGCGGCAGG - Intronic
1103509992 12:121467450-121467472 GGCTGGCCCCCCGGGCGGGCGGG + Intronic
1103940105 12:124496730-124496752 CCCTGGCACCTGGGGAGGGAGGG - Intronic
1110707720 13:78613808-78613830 CACTGCAGCCTCGGGTGGGCTGG - Intergenic
1113479617 13:110610880-110610902 CGCTGGAGCCTGGGAAGGGGAGG + Intergenic
1113550016 13:111185448-111185470 CGGTGGCACCTTGGGAGGGATGG + Intronic
1117072459 14:52069089-52069111 CGCGGGCGCCTGGGCGGGGCGGG + Intronic
1120851530 14:89176483-89176505 AGCTGGGGCCCAGGGAGGGCGGG - Intronic
1120996120 14:90419926-90419948 GGCTGGGGCATCGGGAGGCCGGG - Intergenic
1122402729 14:101476774-101476796 AGGTGGAGGCTCGGGAGGGCTGG - Intergenic
1125602962 15:40925632-40925654 CGCTGGCGCCCCTCGAGGGGAGG + Intergenic
1127606469 15:60592333-60592355 GGCTGGCGGCTCCGGGGGGCGGG - Intronic
1128343949 15:66842284-66842306 CGCGGGAGGCTGGGGAGGGCAGG + Intergenic
1128745787 15:70113399-70113421 AGCTGGGGCCTCAGGAGGGTTGG - Intergenic
1129540233 15:76342496-76342518 TGTTGGCGCGGCGGGAGGGCCGG + Intergenic
1129853762 15:78810586-78810608 CCCTGGCGGCTCGGGGGGCCGGG - Intronic
1132556878 16:576420-576442 CGCTGGGGCCTGGGCAGGGCAGG + Intronic
1132590683 16:725101-725123 CGCTGGAGCATCAGGAGGCCCGG - Exonic
1132850002 16:2020628-2020650 CGGAGGCGCCACGGGCGGGCGGG - Exonic
1133102511 16:3487878-3487900 CGCTGGTGCCCTGGGAGGCCAGG + Intergenic
1133173618 16:3997613-3997635 CGCTCGGGCCTCCTGAGGGCCGG + Intronic
1134914827 16:18060779-18060801 AGCTGGAGCCTCAGCAGGGCTGG + Intergenic
1137447850 16:48543073-48543095 TGCTGGAGACTGGGGAGGGCTGG + Exonic
1139468139 16:67164923-67164945 CGCTGGAGCCCGGTGAGGGCCGG + Exonic
1140531592 16:75671274-75671296 CGCTTGAGCCTGGGGAAGGCAGG + Intronic
1140627986 16:76817846-76817868 CACTGGCGACTAGGCAGGGCGGG - Intergenic
1142063735 16:88047979-88048001 GGCTGTCCCCTGGGGAGGGCAGG + Intronic
1142142869 16:88480307-88480329 CTCTGGCACCTCGTGAGGGTGGG + Intronic
1142350364 16:89576715-89576737 CGCTGGCGCCCCGCGCGGACTGG - Intronic
1142474383 17:180783-180805 CGCCGGAGCTCCGGGAGGGCGGG + Intronic
1144214229 17:13040768-13040790 TGCTGGTGCTTCAGGAGGGCTGG - Intergenic
1145270886 17:21404396-21404418 CGCTGGGCCCTCGGGAGCCCAGG - Intronic
1145279165 17:21455743-21455765 AGTTGGTGCCTGGGGAGGGCAGG + Intergenic
1145398692 17:22514704-22514726 AGTTGGTGCCTGGGGAGGGCAGG - Intergenic
1146790916 17:35750105-35750127 GGCTGGCGCCTGGGGGGCGCTGG + Exonic
1150344086 17:64390907-64390929 CGGTGGCCCCTCAGGAAGGCCGG - Intronic
1151833749 17:76570223-76570245 CGCTGGCGGCTGGGCTGGGCAGG + Intronic
1152574985 17:81136082-81136104 CGCTGGCTGCTTTGGAGGGCGGG - Intronic
1153331482 18:3879544-3879566 CGCCTGCGCCTCGTCAGGGCTGG + Exonic
1154047131 18:10916469-10916491 CGCTGGCGGCCCAGGAGTGCTGG + Intronic
1158401052 18:57121924-57121946 CGATCCCGCCTCGGGAGGCCAGG - Intergenic
1158424263 18:57324868-57324890 GGCTGGCCCCTGTGGAGGGCAGG + Intergenic
1158836104 18:61333535-61333557 CGCGGTGGCCGCGGGAGGGCAGG + Intergenic
1158963912 18:62607431-62607453 GGCTGGCTCCTCCTGAGGGCGGG + Intergenic
1160458997 18:79023266-79023288 TGCTGGCTCCTCTGCAGGGCTGG - Intergenic
1160655578 19:267096-267118 CGCTGGCGACTCCGCAGCGCCGG + Intergenic
1160999959 19:1905578-1905600 CGCGCGCGTCTCGGGCGGGCCGG + Intronic
1161212419 19:3074316-3074338 CAATGGGGCCTCTGGAGGGCAGG - Intergenic
1161314683 19:3612402-3612424 CGCTGGCGTCTCCTGCGGGCGGG + Exonic
1161791837 19:6364618-6364640 CCCGGGCGCCTCCTGAGGGCTGG - Exonic
1162581865 19:11536217-11536239 CCCTGGCGGCCCGGGAGGGGCGG - Intergenic
1162968969 19:14168841-14168863 TGCTGGCCCCTCGTGAGTGCTGG - Intronic
1163032447 19:14553433-14553455 CTGTGGCGCCTCGGGGAGGCTGG + Intronic
1163051834 19:14690156-14690178 GCCCGGCCCCTCGGGAGGGCGGG + Intronic
1163138648 19:15331963-15331985 CGCGGGCGCCGCGGCGGGGCCGG - Intronic
1163233937 19:16020403-16020425 AGCTGGCGCCTGGGAGGGGCTGG - Intergenic
1163708624 19:18832374-18832396 CGGTGGCGGCGCGGGAGGCCCGG + Exonic
1163815452 19:19462273-19462295 CACTTGCTCCTGGGGAGGGCAGG - Intronic
1163862996 19:19752072-19752094 GGCTGAGGCCGCGGGAGGGCTGG - Intergenic
1166994730 19:46714632-46714654 CGGTGGGGCCTCGGGAAGGAAGG + Intronic
1168471725 19:56645726-56645748 CTCTGCTGCCTCGGGAGAGCCGG + Exonic
925928177 2:8685367-8685389 CGCTGGCGCTGGAGGAGGGCGGG + Intergenic
933772598 2:85753813-85753835 CGCTCGCGGCTCGGGCGGCCCGG + Intronic
934636185 2:95991973-95991995 CGGAGGTGCCGCGGGAGGGCGGG + Intergenic
934765807 2:96879424-96879446 GCCTGGCGCCCTGGGAGGGCCGG - Intronic
934797464 2:97113453-97113475 CGGAGGTGCCGCGGGAGGGCGGG - Intergenic
934835947 2:97589986-97590008 CGGAGGTGCCGCGGGAGGGCGGG + Intergenic
935075993 2:99744541-99744563 GGCTGGGGCATTGGGAGGGCAGG - Intronic
935360919 2:102245660-102245682 CGCTGGCCCGTGGGGAGGGGTGG + Intergenic
942565824 2:177264365-177264387 CGCTTGCGCCGGGGCAGGGCGGG - Intronic
944123492 2:196267119-196267141 CACTGGTGCCTGGGGAGAGCTGG + Intronic
946415568 2:219538243-219538265 GGCTGGTGCCCCGGGAGGGCTGG + Exonic
1169065684 20:2693164-2693186 CGCTGGCGCCGCGGGCGGGCGGG + Intronic
1169317984 20:4609102-4609124 TGCTGGCCCCTTGGGAGGACAGG + Intergenic
1171238238 20:23545258-23545280 GGGTGGAGCCTGGGGAGGGCAGG - Intergenic
1171437174 20:25132855-25132877 GGCAGGCGCCGCTGGAGGGCTGG + Intergenic
1171452815 20:25247986-25248008 GGGCGGGGCCTCGGGAGGGCGGG - Intergenic
1171484860 20:25479317-25479339 CCCTGGCACCTCGGCAGGCCAGG - Intronic
1172042033 20:32052552-32052574 CCCAGGAGCCTGGGGAGGGCTGG + Intronic
1174296638 20:49550035-49550057 CTCTTGTGCCTCGGGAGGGATGG - Intronic
1175134886 20:56815765-56815787 GGCTGGGACCTCGGGAGGGTTGG + Intergenic
1175187571 20:57189331-57189353 TGCTGGCGCCTGGGGATGGATGG - Intronic
1175429062 20:58890008-58890030 CGCTCGCGCCGCGGAAGAGCGGG + Intronic
1175485329 20:59342101-59342123 CACAGGCGCTGCGGGAGGGCCGG - Intergenic
1175921565 20:62452766-62452788 CTCTGGGGCCTCGGGCGGGCGGG + Intergenic
1176045219 20:63089169-63089191 CGCTGGGGTTTCGGCAGGGCTGG + Intergenic
1176375670 21:6085880-6085902 CGCTGGGGCCACGGGAGGCTCGG + Intergenic
1179054177 21:37916210-37916232 CGCTGGGGCCAAGGGAGGGGCGG + Exonic
1179640362 21:42743871-42743893 CGCTGGGGCCACGGGCGGCCGGG + Intronic
1179747804 21:43452364-43452386 CGCTGGGGCCACGGGAGGCTCGG - Intergenic
1179805440 21:43834363-43834385 CGCAGGCTCCTCTGCAGGGCGGG - Intergenic
1179842440 21:44086134-44086156 CGCTGGGCCATGGGGAGGGCAGG - Intronic
1180081118 21:45488058-45488080 TGCTGGCGCCACGAGAGCGCTGG - Intronic
1180222844 21:46370257-46370279 TGTTGGGGCCTCCGGAGGGCAGG + Intronic
1181064503 22:20299204-20299226 CGCCCGCTCCTCGGGAGGACCGG - Intergenic
1181457967 22:23070371-23070393 GGCGGGCGGCGCGGGAGGGCGGG + Exonic
1181527579 22:23499058-23499080 CTCTGGGGCCTCCGGATGGCAGG - Intergenic
1182137471 22:27919279-27919301 CGATGGTGGCTCGGGGGGGCAGG - Intronic
1182951647 22:34381749-34381771 TGCTGGTGCCTCGGGAGCTCAGG + Intergenic
1183309046 22:37099345-37099367 AGCTGGGGCCTCCGCAGGGCAGG + Intronic
1183605867 22:38866479-38866501 GGCTGCCGACTCGGGAGGGAGGG + Exonic
1183858380 22:40652048-40652070 CGCTGGCTGCTTGGCAGGGCTGG + Intergenic
1184152399 22:42646574-42646596 AGCTGGCACCTGGGGAGGACCGG - Intronic
1184164749 22:42720706-42720728 AGGAGGCGCCTCGGGAAGGCAGG - Intronic
1184722779 22:46324923-46324945 CCATGGCCCCTCGGGAGGCCAGG - Intronic
1185333533 22:50261832-50261854 GGCCGGAGCCTGGGGAGGGCCGG + Intergenic
953163665 3:40445199-40445221 CAGTGGCACCTGGGGAGGGCAGG - Intergenic
954795780 3:53160908-53160930 CGCTGGGGCCTGGGAGGGGCCGG - Intronic
965460739 3:168959301-168959323 AGCTGGGGGCTGGGGAGGGCGGG - Intergenic
967316280 3:188154311-188154333 CGCTCGCGCCGGGGGAGGGCTGG - Intronic
967888927 3:194351364-194351386 CGCTGGGGCCACGTGAGGGGAGG - Intergenic
968186925 3:196639503-196639525 CGTTGGTGCCTTGGCAGGGCTGG - Intergenic
968750546 4:2386859-2386881 GGCTGGCACCTCAGGCGGGCGGG - Intronic
969299828 4:6291390-6291412 GGCTGGCGCCCAGGGAAGGCTGG - Intronic
969592438 4:8129756-8129778 CTCTGGGGCCCTGGGAGGGCTGG + Intronic
985620569 5:952710-952732 CGCTGGGGCCTCTTTAGGGCAGG + Intergenic
985767499 5:1787626-1787648 CACTGGGTCCCCGGGAGGGCAGG + Intergenic
987132459 5:14871994-14872016 GGCTGGCGCCTCCGGGGCGCTGG + Intergenic
987362521 5:17120143-17120165 CGCTGGCTCTTCTGGAGGGGAGG - Intronic
988474317 5:31569890-31569912 CTCTGGCGCTTCGGGAGGGAAGG - Intergenic
988865497 5:35330303-35330325 CGCTGGGGCCTGTGGAGGGATGG + Intergenic
989448253 5:41556272-41556294 GGCTGGCGGATCAGGAGGGCAGG - Intergenic
997372314 5:133369927-133369949 CACTGGCACCTGGGGAGGGAGGG - Intronic
998132530 5:139658625-139658647 CGCTGGTGCCTCGGGAAGCGTGG - Intronic
998286161 5:140862904-140862926 TGCTGGCGCCTTGGGTGGGCTGG + Intronic
999671718 5:153964529-153964551 TGCTGGTGCCTGGGGAGGGTGGG + Intergenic
1001825979 5:174745377-174745399 CGCTGCAGCCTCTGGAGGGGAGG + Intergenic
1002101670 5:176860942-176860964 GGCAGGCGCCCAGGGAGGGCCGG + Intronic
1002424527 5:179167352-179167374 CGCTGGGGCCCCGGGAGCCCGGG - Intronic
1003290470 6:4775674-4775696 CGCTGGCTCCGCGGCAGGCCGGG - Intronic
1003948064 6:11093556-11093578 CACTGGCGCCTCAGCAGGACGGG + Intergenic
1006362289 6:33593284-33593306 CGCTGGAGCCTGGGGTGGCCTGG - Intergenic
1006831126 6:36968950-36968972 GGCTGGAGCCTCGGAAGAGCTGG + Exonic
1006904145 6:37521694-37521716 CGCTGGGGCTTGAGGAGGGCGGG + Intergenic
1008932433 6:56954849-56954871 CGGGGGCGCCTGGGGAGGGAGGG - Intergenic
1013459177 6:110358501-110358523 CCCTGGCACCTCCGGAGGGGCGG - Intergenic
1015842978 6:137493243-137493265 CGCTCGGCCCACGGGAGGGCAGG - Exonic
1018030379 6:159836897-159836919 CCATGGCCCCTTGGGAGGGCTGG + Intergenic
1019054385 6:169213109-169213131 CGCAGGCGCGCAGGGAGGGCTGG + Intergenic
1019344587 7:522979-523001 CCCTGGCACCCAGGGAGGGCGGG + Intergenic
1024979725 7:55147110-55147132 CCCTGGTGCTTCAGGAGGGCCGG - Intronic
1027190816 7:75994615-75994637 CGGAGGAGCCTCGGGTGGGCCGG - Exonic
1034275621 7:149822594-149822616 CCCTGGCCCCTCGGGACGCCGGG - Intergenic
1034342770 7:150368842-150368864 CGCTGTCGCCGCGGCGGGGCGGG + Exonic
1035124790 7:156600737-156600759 CACTGGAGCCTCGGAAGGGCGGG + Intergenic
1035638339 8:1163642-1163664 GGCGGCCGCCTGGGGAGGGCCGG + Intergenic
1037529223 8:19757338-19757360 CGGCGGCGGCTCGGGCGGGCGGG + Intronic
1037884541 8:22589312-22589334 CGCTGGCGACTCGGCGGTGCTGG + Exonic
1037957119 8:23068690-23068712 GCCTGGCGCCTGGAGAGGGCAGG - Intronic
1038798161 8:30727604-30727626 CGGGGGCGGCTCGGGCGGGCTGG - Exonic
1042844743 8:73158657-73158679 CTCTGGAGCCTCAGAAGGGCAGG + Intergenic
1043053257 8:75407456-75407478 CGCTGCGGTCTCGGGAGGCCGGG + Intergenic
1044609883 8:94080751-94080773 CGGTGCAGCCTCGGAAGGGCAGG + Intergenic
1044727750 8:95207199-95207221 CCCTGGAGCCTCCGGAGGGAGGG + Intergenic
1045510150 8:102807166-102807188 CGGGGGCGCCTCGGGCGCGCTGG - Intergenic
1049417872 8:142503790-142503812 TGCTGGACCCTGGGGAGGGCTGG + Intronic
1049724174 8:144137856-144137878 CGCTGGCGCCTCGGGAGGGCCGG + Exonic
1053313816 9:37035794-37035816 CGCGGGCGAGGCGGGAGGGCGGG - Intergenic
1057596119 9:96417654-96417676 CGCCGCCGCCTCGGGAGGTGAGG - Exonic
1058851214 9:109013502-109013524 CGCCGCCGCCTCGGGCGGGTGGG - Exonic
1059305310 9:113349487-113349509 CGCTGGCGCACCGGGAGGGCCGG + Intergenic
1060029786 9:120204529-120204551 GGCTGGGGCCCAGGGAGGGCAGG - Intergenic
1060525278 9:124316831-124316853 CGCTGGTTCCTGGGGAGGGGAGG - Intronic
1060794112 9:126503251-126503273 CGCTGGCTCCTCAGGACTGCGGG - Exonic
1061090047 9:128421209-128421231 CTCTGGCGGCTCGGGCTGGCAGG - Intronic
1061482294 9:130903162-130903184 GGCTGGGGCCTAGGCAGGGCTGG - Exonic
1190789547 X:53686350-53686372 CGCTGGCGCCTGCCGAGGCCTGG + Intronic
1198531107 X:137550091-137550113 CGCCGGCGCCTCGTTAGGGCCGG + Intergenic
1200107788 X:153724453-153724475 CTCCGGGGCCTCGCGAGGGCTGG - Intronic
1200123945 X:153804507-153804529 CGCTGTTGCCTCCGGAGGCCCGG + Exonic