ID: 1049730516

View in Genome Browser
Species Human (GRCh38)
Location 8:144175325-144175347
Sequence GGGGCAGCTCAGGTGTAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 179}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049730516_1049730530 7 Left 1049730516 8:144175325-144175347 CCCTGCTACACCTGAGCTGCCCC 0: 1
1: 0
2: 0
3: 23
4: 179
Right 1049730530 8:144175355-144175377 CTCCCAGCAACAGGTCTGGTCGG No data
1049730516_1049730534 12 Left 1049730516 8:144175325-144175347 CCCTGCTACACCTGAGCTGCCCC 0: 1
1: 0
2: 0
3: 23
4: 179
Right 1049730534 8:144175360-144175382 AGCAACAGGTCTGGTCGGATGGG No data
1049730516_1049730522 -2 Left 1049730516 8:144175325-144175347 CCCTGCTACACCTGAGCTGCCCC 0: 1
1: 0
2: 0
3: 23
4: 179
Right 1049730522 8:144175346-144175368 CCTCCCCCCCTCCCAGCAACAGG No data
1049730516_1049730533 11 Left 1049730516 8:144175325-144175347 CCCTGCTACACCTGAGCTGCCCC 0: 1
1: 0
2: 0
3: 23
4: 179
Right 1049730533 8:144175359-144175381 CAGCAACAGGTCTGGTCGGATGG No data
1049730516_1049730526 3 Left 1049730516 8:144175325-144175347 CCCTGCTACACCTGAGCTGCCCC 0: 1
1: 0
2: 0
3: 23
4: 179
Right 1049730526 8:144175351-144175373 CCCCCTCCCAGCAACAGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049730516 Original CRISPR GGGGCAGCTCAGGTGTAGCA GGG (reversed) Intronic
900146381 1:1160668-1160690 GGGGCACCCCAGGTGTCGCTGGG - Intergenic
901778409 1:11576459-11576481 GGGGCTGCTCCGGTGAAGCAGGG - Intergenic
903827556 1:26156700-26156722 GGGGCAGCTCTGGTCTGACAAGG - Intergenic
904412314 1:30331890-30331912 GGGGCTGCTCAGCTGGAGAAGGG - Intergenic
904726143 1:32549761-32549783 GGGGAAGTTCAGGGGTAGCAGGG - Intronic
904991804 1:34599094-34599116 AGGGCAGCTCTGGGGAAGCAAGG - Intergenic
908733981 1:67256685-67256707 GGAGCTGCTCAGGAGAAGCAGGG + Intronic
910369506 1:86501605-86501627 GAAGCAGCTCAGGAGAAGCATGG + Intergenic
911039760 1:93582497-93582519 GCGGCAGCTCAGATGGAGAAGGG - Exonic
911058132 1:93724767-93724789 GTGGCAGGTCAGGGGTAGTAAGG - Intronic
913582227 1:120237762-120237784 GGGGCAGATGATGTGTAGCTGGG - Intergenic
913625948 1:120660622-120660644 GGGGCAGATGATGTGTAGCTGGG + Intergenic
914564160 1:148849240-148849262 GGGGCAGATGATGTGTAGCTGGG - Intronic
914608666 1:149280999-149281021 GGGGCAGATGATGTGTAGCTGGG + Intergenic
915249285 1:154577027-154577049 GGAGCAGCACGGATGTAGCAGGG - Exonic
915273721 1:154773789-154773811 GGCTCAGCTCAGGTCTGGCAGGG - Intronic
915580349 1:156809436-156809458 GGGGCAGCTGAGGTTTGGCGGGG + Exonic
917964912 1:180172362-180172384 GGAACAGCTGAGGTGCAGCAGGG + Intronic
920220056 1:204390392-204390414 GGGGCAGTTAAAGGGTAGCAAGG - Intergenic
920337277 1:205253487-205253509 TGGGCAGCTGAGCTGTGGCAGGG - Intronic
922359582 1:224809323-224809345 CAGGCAGCTCTGGTGGAGCACGG - Intergenic
924428201 1:243973174-243973196 GAGGCAGCTGAGGTATAGCTGGG - Intergenic
1064143273 10:12807742-12807764 CGGGCAGATCTGGTGTAGGACGG - Intronic
1067085805 10:43237519-43237541 GAGGCAGCTCAGGAGGAGCCGGG - Intronic
1070299888 10:75195850-75195872 AAGGGAGCTCATGTGTAGCAAGG - Intergenic
1071672826 10:87626027-87626049 GGGACAACTCAGGTGAAACAAGG - Intergenic
1073053178 10:100682564-100682586 GAGGCAGCTCAGGTGTGGGATGG - Intergenic
1074755405 10:116620957-116620979 GTGGAAGCTCTGGTGCAGCATGG + Intronic
1075781093 10:125017729-125017751 GGAGCAGCTCAGATGCAGCATGG + Intronic
1076343790 10:129766918-129766940 GAGGGAGCTCAGGTCTGGCAGGG + Exonic
1077205049 11:1337870-1337892 GGGGCGGCTCTGGTGAAGAAGGG - Intergenic
1077375801 11:2204617-2204639 GGGGCACCTAGGCTGTAGCAGGG - Intergenic
1078060179 11:8038320-8038342 GGTGCATTTCAGGTGAAGCAAGG + Intronic
1080503545 11:32892450-32892472 GGCGCTGCTCAGGGGTAGCCGGG - Intergenic
1081711552 11:45219765-45219787 GGCGCAGCTCATGTGGAGCATGG - Intronic
1083609345 11:63997789-63997811 GGGGAAGCTCAGGAGTAGATAGG - Exonic
1084160717 11:67348300-67348322 GGTGCAGATGAGGTGCAGCAGGG + Intronic
1084694540 11:70745737-70745759 GGGACAGCTCAGGTGAGGCAGGG - Intronic
1084736477 11:71108676-71108698 GGGGCTGCTCAGCTGTAGCCAGG + Intronic
1089507168 11:118971714-118971736 GCGGCAGCTCAGGTGTGGAGCGG - Exonic
1089705133 11:120272341-120272363 GGAGCAGGGCAGGTGCAGCAAGG - Intronic
1090805114 11:130197848-130197870 GGGGCAGTTCACGTGCCGCACGG + Exonic
1091220704 11:133928486-133928508 GGGGCAGCTCAGGGGGTTCAGGG - Intronic
1091866103 12:3838866-3838888 GGGCCGGCTCAGGTGAAGCGGGG - Intronic
1092263633 12:6965212-6965234 GGGGCGGCTAAGGGGAAGCAAGG - Intergenic
1096551897 12:52378433-52378455 GGTGCAGCCCAGGGGTAGCATGG - Intronic
1096869277 12:54583338-54583360 GGGACAGATCAGGAGGAGCATGG - Intronic
1099126638 12:78767717-78767739 GGGGCAGGTCAAGTATATCAGGG + Intergenic
1101302226 12:103494886-103494908 GGGGCAGCACAGTTGTCACAGGG + Intronic
1103798224 12:123519792-123519814 GGGTTAGCTCAGGAGGAGCACGG - Intronic
1103934176 12:124466559-124466581 GGGGCAACTGAGGGCTAGCAGGG - Intronic
1104689882 12:130817956-130817978 GGGGCAGCTGGGCTGAAGCAGGG + Intronic
1107815570 13:44241715-44241737 GGGGCAGCTCAGGTGTTTGCTGG - Intergenic
1107976201 13:45691039-45691061 GGGGCAGCCCAAGTACAGCAAGG - Intergenic
1108602242 13:52004971-52004993 GGTGCGGCTCAGGTGTGGCTTGG - Intronic
1110776731 13:79416423-79416445 TGGGAAGCTCAGGTGTGGTAGGG + Intergenic
1113589575 13:111488979-111489001 GGGGCAGCTGAGGACTAGCCGGG - Intergenic
1114882929 14:26809262-26809284 AGGGCATCTCAGATGTGGCACGG - Intergenic
1115531459 14:34331954-34331976 GGGGCAGGTGAGGTTTAGTAGGG - Intronic
1121311104 14:92935548-92935570 GGCCCAGCTCAGGTGTGGCTGGG - Intergenic
1121328156 14:93033834-93033856 CGGGCAGCACAGGGGTAGCTAGG + Intronic
1122357433 14:101132102-101132124 GGGGCAGGGCAGGTGCTGCAGGG + Intergenic
1122438638 14:101715552-101715574 CAGGCAGCCCAGGTGTTGCAGGG + Intergenic
1122599374 14:102913690-102913712 GGGGCAGCCCAGATCTTGCAGGG + Intergenic
1123176200 14:106421616-106421638 GGTGCAGCTCAGGGCCAGCAGGG - Intergenic
1126121090 15:45252183-45252205 GGGGCAGCTTGGGTGGGGCATGG - Intergenic
1127792104 15:62407248-62407270 GAGGAAGCTAAGATGTAGCAAGG + Intronic
1129275241 15:74441178-74441200 GTGGCAGCTCAGGTCTTGGAGGG - Intergenic
1129652924 15:77504403-77504425 GAGCCAGCTCAGCTGTGGCAGGG - Intergenic
1129901959 15:79158097-79158119 GGGGCAGAGCAGGAGTGGCAAGG - Intergenic
1132719965 16:1310770-1310792 GGGGCAGATCAGGTGCGGCCAGG + Intronic
1132981518 16:2740655-2740677 GGGACAGCACAGGTGGTGCATGG - Intergenic
1139512638 16:67436207-67436229 GGGGCAGCTCAGCTTTGGCAAGG - Intronic
1139701648 16:68711454-68711476 GAGGAAGTTCAGGTGCAGCAGGG + Intronic
1140750840 16:78022092-78022114 TGCGCAGCTCAAGTGTAGCTTGG - Intergenic
1144583575 17:16474225-16474247 GGGGAAGCTGTGGTGTAGGAGGG - Intronic
1144659256 17:17057762-17057784 GGGCCACCTCGGGTGTAGGATGG - Intronic
1149388829 17:56169779-56169801 AGGGCAGAACAGGAGTAGCAGGG - Intronic
1152202662 17:78956220-78956242 GGGTCAACTCAGATGCAGCACGG + Intergenic
1152601019 17:81262226-81262248 GGGGCAGCTCTGGCGTAGGAGGG - Intronic
1153583367 18:6597664-6597686 GGGGCAGCTCAGGTCCTGCCTGG + Intergenic
1154123610 18:11671168-11671190 GGGGCAGCCCAGGGGCATCAGGG - Intergenic
1156328195 18:36093573-36093595 GGGGTGGCTCAGGAGCAGCACGG + Intergenic
1158623185 18:59049936-59049958 GGGGCAGCTGCGGGGCAGCATGG + Intergenic
1161258884 19:3324680-3324702 GGGGCAGGTCATGTGGACCATGG - Intergenic
1161271568 19:3392605-3392627 GGGGCATCACAGGTGCAACAAGG - Intronic
1162002107 19:7751786-7751808 GGGCCAGCTCAGCTGTCACAGGG - Intergenic
1163143542 19:15365679-15365701 GGGGAGGCAGAGGTGTAGCAGGG - Intronic
1165299640 19:34960680-34960702 GGGGCAGCTCAGGGAGAGGAGGG + Intronic
1166370055 19:42295370-42295392 GGGGCAGCTGAGGGGCTGCAGGG + Exonic
1166827909 19:45620983-45621005 GAGGCAGCACAGTTGGAGCAGGG + Intronic
1168387152 19:55973786-55973808 AGGACATCTCAGGTGTGGCAGGG - Exonic
1202711704 1_KI270714v1_random:22797-22819 GGGGCAGGTGAGGGGTGGCAGGG - Intergenic
926153729 2:10439030-10439052 GGGGCCACTCACGTGTAGCACGG + Intergenic
926634021 2:15161818-15161840 CAAGCAGCTCAGGTGTAGTAGGG + Intergenic
932075250 2:68656429-68656451 AATGCAGCTCAGGTGTGGCAGGG + Intergenic
933967489 2:87442025-87442047 GGGGGAGCACAGGTGTAGGCAGG + Intergenic
934475391 2:94590030-94590052 GGGGGAGCTCAGGGGAGGCATGG - Intronic
936326306 2:111508471-111508493 GGGGGAGCACAGGTGTAGGCAGG - Intergenic
937089452 2:119196226-119196248 GGGGGAGCTCAGGAGTAGGCAGG + Intergenic
937955083 2:127417565-127417587 GGGGCATCTCTGGTGCAGCCCGG + Intergenic
938710956 2:133975977-133975999 AGGGCAGCTCAGGACTAGAAAGG - Intergenic
939497347 2:142939825-142939847 GGGGCAGCTCACGTGGAGTCAGG + Intronic
944756647 2:202769898-202769920 AGGGCAGGTGAGGGGTAGCAAGG - Intergenic
945969393 2:216221243-216221265 GAGGCAGGACAGGTGTATCATGG - Intergenic
946999524 2:225437738-225437760 GAGGAAGCTCAGGTTTAGAAAGG + Intronic
947437341 2:230083934-230083956 GAGGCAGGTAAGGTGTAGCAAGG - Intergenic
1168972192 20:1938294-1938316 GGGCAAGCTCAGGTCTAGAAGGG - Exonic
1171375622 20:24692383-24692405 GGGACAGCGCAGGTGTAGGCAGG + Intergenic
1172279025 20:33697789-33697811 GATGCAGCACAGGTGTAGGAAGG + Intergenic
1172809142 20:37634531-37634553 GGGTCAGCTCAGGGGTTGAAAGG - Intergenic
1173250869 20:41363649-41363671 GGGGCTGCTCTGCTGTAGGAAGG + Exonic
1173712945 20:45176381-45176403 GGGACGGCACAGGTGCAGCAAGG - Exonic
1175895593 20:62334355-62334377 GGGGCTGGTCAGGTGCAGCTTGG + Intronic
1178976608 21:37226314-37226336 GTGGCAGCTCAGCTGTGGAAGGG + Intronic
1179404177 21:41111837-41111859 GGAGCAGCAGAGGTGTAGCACGG + Intergenic
1179635524 21:42706123-42706145 GGGGCAGCTCCGGGGTTCCATGG - Intronic
1180714462 22:17862232-17862254 GGGAAAGCTCAGGTGTTTCAGGG - Intronic
1181281963 22:21726737-21726759 GGGACAGCCCAGGTGCAGGAAGG - Intronic
1181473452 22:23154549-23154571 GGGGTAGCTGAGGTGGAGCCGGG + Intronic
1181888061 22:26037374-26037396 GGGGCAGCTGAGGCTCAGCAAGG + Intergenic
1182470432 22:30544768-30544790 GGGCAAGCTCAGGTCTAGAAGGG - Intronic
1183582402 22:38733764-38733786 GGGGCAGCACAGGTTTAGTTGGG + Intronic
1183903630 22:41023630-41023652 AAGGCAGCTCAGATGTAACATGG - Intergenic
1184648957 22:45910931-45910953 GGGGCAGCTCCTCTGGAGCAGGG - Intergenic
950793156 3:15489427-15489449 GAGGCAGCTCAGGTGGAGTGGGG + Intronic
953143487 3:40250934-40250956 GGGGCAGGTCAGAAGTACCAGGG - Intronic
954415769 3:50392542-50392564 GGGGCACCTCAGGTCAAGCCAGG + Intronic
965697855 3:171428007-171428029 GGAGCAGGTCAGGTTTGGCAGGG + Intronic
965827054 3:172742037-172742059 GAGACAGCTTAGGTGCAGCAAGG + Intergenic
966125395 3:176570401-176570423 GGTGGAGCTCAGGGGCAGCATGG - Intergenic
968621013 4:1603501-1603523 GGGGCAGCTCAGGGGCAGGGTGG + Intergenic
968977525 4:3829843-3829865 GGGGCAGCCCAGGTGAGCCAGGG + Intergenic
969703685 4:8781021-8781043 GGGCCAGCAAAGGTGTGGCAGGG + Intergenic
971858342 4:32072013-32072035 AGGGCAGCTCCAGTGTGGCATGG - Intergenic
972057102 4:34816628-34816650 GGGGCAGGTCACTTGTAGAAGGG + Intergenic
972277537 4:37571119-37571141 TGGGGAGCTCATGTGTAGTAGGG + Intronic
973175149 4:47196448-47196470 AGGGCAGATCAGGTACAGCATGG + Intronic
981475174 4:145180380-145180402 GGGCCGGCTCAGGTGAAGCGGGG + Intergenic
981683740 4:147429834-147429856 GGGACAGTTCAGGTGAGGCAAGG + Intergenic
985521382 5:375455-375477 TGGGCAGATCCGGTGAAGCATGG + Intronic
985585091 5:727252-727274 GGGGCAACTCAGGAAGAGCAAGG + Intronic
985598596 5:811567-811589 GGGGCAACTCAGGAAGAGCAAGG + Intronic
987927740 5:24364350-24364372 GGGGCAGGGCAGGTGCACCAGGG - Intergenic
992767627 5:80015668-80015690 GGGGAAGGTCAGCTGTTGCAGGG + Intronic
997358135 5:133277665-133277687 GGGGCAAGTCAGGTCTAGGAGGG - Intronic
997984660 5:138492586-138492608 GGGGCAGCTCGGCTGAAGCCAGG - Intergenic
998130898 5:139650592-139650614 GGGGCAGCTGAGGTGGAGCCGGG - Intronic
999082388 5:148856601-148856623 GGGGCAGATCAGCTGCAGCAAGG + Intergenic
1001665597 5:173431278-173431300 GGGCCAGCTCAGATGCAGGAAGG + Intergenic
1001850663 5:174962168-174962190 GAGGCAGCTCAAGTGGAGGAAGG + Intergenic
1002283309 5:178146074-178146096 GGGGCAGCTCAGGGGGTGCAGGG - Intronic
1002566298 5:180114204-180114226 CGGCCAGCACAGGTGAAGCAGGG - Intronic
1003127650 6:3368294-3368316 GGAGCAGCTCGGGTTGAGCATGG - Intronic
1004306983 6:14509867-14509889 GGGGCTGCCCAGGTTTAGCTGGG + Intergenic
1004363008 6:14987585-14987607 GGGGCTGCTCAGCTGAGGCACGG - Intergenic
1005320213 6:24646093-24646115 AGGGCAGCACAGGTGGAGCAAGG + Exonic
1006796037 6:36732911-36732933 GGGGCAGCTAGGGTGTGGCTGGG + Exonic
1007416826 6:41695918-41695940 GGGCCAGCCCAGGTGGAGCTGGG - Intronic
1009974191 6:70655480-70655502 GGAGCAGCCCAGGGGAAGCATGG + Intergenic
1010034038 6:71301335-71301357 GGGGGAAATCAGGTGTAGGAAGG - Intronic
1010152228 6:72746433-72746455 GAGGCAGTTCAGATGTACCAGGG + Intronic
1011254346 6:85405653-85405675 TGGGCAGTTCAGGTGGAGAAAGG - Intergenic
1014074838 6:117224067-117224089 GGGGCATCTTAGGTGTTTCAGGG - Intergenic
1017616473 6:156251784-156251806 GGGGCAGCTCAGGGTGAGAAAGG - Intergenic
1021639158 7:22721521-22721543 GGGGCAGGTCAGGTGTCAGAGGG - Intergenic
1022103580 7:27183409-27183431 GGGGCAGCCCAGGTGCTGGAAGG - Intronic
1022702211 7:32772085-32772107 GGGGGAGGTCAGGGGTGGCAGGG + Intergenic
1023042823 7:36187123-36187145 GAGGCAGCTGAGTTGTAACAAGG - Intronic
1024452467 7:49563660-49563682 AGGGCAGCTCTGGTGGAGCATGG + Intergenic
1026126878 7:67586984-67587006 GAGGGAGGTCAGGTGTAGTATGG + Intergenic
1031469099 7:122147619-122147641 GGGGCAGAGCAGGTGCAGAAAGG + Intergenic
1032013517 7:128361508-128361530 GGGGCGGCTCAGGGGCAGCGGGG - Intronic
1033673002 7:143511206-143511228 GGGGCAGCGCAGGCGGCGCAGGG + Intergenic
1034499434 7:151440251-151440273 GGGGCAGCGCAGGGGAAGAAAGG - Intronic
1034531482 7:151698584-151698606 GGGGGAGCTGAGGTGTCACATGG - Intronic
1034641613 7:152608397-152608419 GGGGGGGCTCAGGTGTGCCATGG + Intergenic
1035744212 8:1950144-1950166 GGGGCAGCTGAGGTGGTGAACGG - Intronic
1037748297 8:21663423-21663445 TGAGCAGCTCAGGTGCAGGAGGG + Intergenic
1041137463 8:54775590-54775612 GGGGCAGTTCAGCTGTGGCTGGG - Intergenic
1042155444 8:65841008-65841030 GGGGGAGCACAGGTGTACCCTGG + Intronic
1045167927 8:99627793-99627815 GGGGCAGTTGACCTGTAGCATGG + Intronic
1047770202 8:128024728-128024750 GGAGCAGCTCAGGTGTTCCCTGG - Intergenic
1049293145 8:141814460-141814482 GGGGCAGCTCAGGAGTCCCCAGG - Intergenic
1049328636 8:142038117-142038139 GAGCCAGCTCAGGGGTGGCAGGG - Intergenic
1049730475 8:144175151-144175173 GGAGAAGCTCAGGTGCAGCAGGG - Intronic
1049730485 8:144175209-144175231 GGGGCAGCTTGGGTGCAGCAGGG - Intronic
1049730501 8:144175267-144175289 GGGGCAGCTTGGGTGCAGCAGGG - Intronic
1049730516 8:144175325-144175347 GGGGCAGCTCAGGTGTAGCAGGG - Intronic
1050536415 9:6634574-6634596 CGGGCAGCCCAGGAGAAGCATGG - Intronic
1052380159 9:27761702-27761724 GGGGAAGCCAAGGTTTAGCAGGG + Intergenic
1055878003 9:80966230-80966252 GGGGCATCCCAGGAGGAGCAAGG - Intergenic
1057758771 9:97856144-97856166 GAGGCTGCTGAGGTGTAGCAGGG - Exonic
1058467711 9:105245174-105245196 CGGGCAGCTCAGGTGTGACTGGG - Intronic
1059391503 9:114002254-114002276 GGGACAGCTCAGGTGTGGGAGGG + Intronic
1060189118 9:121581143-121581165 GAGGCAGCTCAGGTGAGGCTGGG + Intronic
1060218564 9:121752669-121752691 GGGCCTGGTCAGGTGGAGCAGGG + Intronic
1060805128 9:126570596-126570618 AGGACAGCTCAGGGGTCGCATGG + Intergenic
1062601512 9:137320510-137320532 GGGGCAGCTTGGGGGTTGCAGGG + Intronic
1062730740 9:138106879-138106901 AGGGCAGCTCTGGTGAAGCTGGG - Intronic
1187032481 X:15502154-15502176 GGGGAAGCTGAGGTTTAGCTGGG + Intronic
1189896819 X:45664916-45664938 GGGGAGGCTCAGGCATAGCATGG + Intergenic
1192218454 X:69180152-69180174 GGAGCAGCTCAGGTGGAAGATGG - Intergenic