ID: 1049731237

View in Genome Browser
Species Human (GRCh38)
Location 8:144179614-144179636
Sequence GACTCAGGCCTAGCTTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 155}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049731225_1049731237 30 Left 1049731225 8:144179561-144179583 CCTCCAGCGAGATGACCAAGACG 0: 1
1: 0
2: 0
3: 0
4: 46
Right 1049731237 8:144179614-144179636 GACTCAGGCCTAGCTTGGGAAGG 0: 1
1: 0
2: 1
3: 12
4: 155
1049731228_1049731237 15 Left 1049731228 8:144179576-144179598 CCAAGACGAAGGTATTCAGCAGG 0: 1
1: 0
2: 1
3: 1
4: 92
Right 1049731237 8:144179614-144179636 GACTCAGGCCTAGCTTGGGAAGG 0: 1
1: 0
2: 1
3: 12
4: 155
1049731231_1049731237 -8 Left 1049731231 8:144179599-144179621 CCCTCTGGCCTCGCAGACTCAGG 0: 1
1: 0
2: 1
3: 8
4: 187
Right 1049731237 8:144179614-144179636 GACTCAGGCCTAGCTTGGGAAGG 0: 1
1: 0
2: 1
3: 12
4: 155
1049731233_1049731237 -9 Left 1049731233 8:144179600-144179622 CCTCTGGCCTCGCAGACTCAGGC 0: 1
1: 0
2: 4
3: 19
4: 242
Right 1049731237 8:144179614-144179636 GACTCAGGCCTAGCTTGGGAAGG 0: 1
1: 0
2: 1
3: 12
4: 155
1049731226_1049731237 27 Left 1049731226 8:144179564-144179586 CCAGCGAGATGACCAAGACGAAG 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1049731237 8:144179614-144179636 GACTCAGGCCTAGCTTGGGAAGG 0: 1
1: 0
2: 1
3: 12
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049731237 Original CRISPR GACTCAGGCCTAGCTTGGGA AGG Intronic
901083854 1:6598924-6598946 AACTGAGGCCTAGCTGGGGTTGG - Intronic
902822932 1:18954604-18954626 ATCTCAGGCCTGGCTGGGGAAGG - Intronic
903221846 1:21873668-21873690 GACTCTGGCCTGGCTGGGGCAGG + Intronic
904207794 1:28865902-28865924 GAAACAGGCCTATCCTGGGAGGG - Intergenic
904587071 1:31586506-31586528 CACCCAGGCCCAGCATGGGAGGG - Intronic
904634034 1:31865853-31865875 GACTTAACCCTAGCTTGGCATGG - Intergenic
904794277 1:33047081-33047103 GACAAAGGCCAGGCTTGGGAAGG - Intronic
904807644 1:33143059-33143081 GACAAAGGCCAGGCTTGGGAAGG - Intergenic
905303579 1:37002349-37002371 GAGTCAGACCTTGCTGGGGATGG + Intronic
906127018 1:43432939-43432961 GAGTCAGGCCCAGCTTCGGATGG + Intronic
906535586 1:46549316-46549338 AAATCAAGCCTAGGTTGGGAAGG + Intronic
906679524 1:47716250-47716272 GAGTCAGGCATAGCTTGGTTGGG - Intergenic
907662649 1:56407455-56407477 GACTCAGGGATAGCTTCTGAGGG - Intergenic
907992871 1:59599832-59599854 GTCTGAGGCCTAGCTTATGATGG + Intronic
910477456 1:87622315-87622337 GACTCAGGCATAGGTTGTGCTGG + Intergenic
915903399 1:159862082-159862104 GGCTCAGGAGGAGCTTGGGAAGG - Intronic
916649350 1:166820268-166820290 GCCTCAGGCCTAAGATGGGAGGG + Intergenic
918544726 1:185669711-185669733 GACGCAGGCCTGGCTTAGGTGGG + Intergenic
920285319 1:204874654-204874676 GCCCCAGGCCTAGGTGGGGAGGG - Intronic
920337271 1:205253441-205253463 GCCTCAGGCTTAACTTGGAAGGG + Intronic
920647996 1:207817341-207817363 GACTCAGGCTCAGCTGAGGATGG - Intergenic
922723071 1:227908716-227908738 GACTCATGCTTACCTTGGGGTGG - Intergenic
923314991 1:232771725-232771747 GGCTGAGGCCTAGTTTGGAAAGG + Intergenic
923542105 1:234895962-234895984 GACACTGGCCTGGCTGGGGACGG - Intergenic
1063715418 10:8521852-8521874 AACACAGGTCTAGCTTGGAATGG + Intergenic
1064540679 10:16402424-16402446 AACTGAGGCTTAGCCTGGGAGGG + Intergenic
1068753767 10:60626874-60626896 GACTGAGGACCAGCTGGGGAGGG + Intronic
1070479701 10:76870235-76870257 GACTCAGGGTCAGCGTGGGAAGG - Intronic
1070850809 10:79560261-79560283 GACCAAGGCCCAGGTTGGGAAGG - Intronic
1075166259 10:120070883-120070905 GACTCAGGGCCAGCTTCTGAGGG - Intergenic
1083306977 11:61766306-61766328 GACACTGGCCTGGCATGGGATGG + Intronic
1083421604 11:62556416-62556438 GACTCAGGCCTCCCTGGGGCAGG + Intergenic
1083994799 11:66266600-66266622 GTCTCAGGCCTACTTTGGGCTGG + Intronic
1085479620 11:76810363-76810385 GACCCAATCCTAACTTGGGATGG - Intergenic
1089400311 11:118160632-118160654 AACTCAGGCCAAGCTGGGGAGGG + Intergenic
1089605516 11:119639034-119639056 GACCCCAGCCCAGCTTGGGATGG + Intronic
1091243283 11:134069333-134069355 GACTCGGGCCTGGCTAGGGCGGG + Intronic
1091303272 11:134521483-134521505 GACTCAGGCCTGGGTGGGGAAGG - Intergenic
1093594840 12:20947866-20947888 GACTCAGACCTAACTTTGAAGGG + Intergenic
1096096662 12:48939971-48939993 TGCTCAGGCCTAGCGTGGGTTGG - Intronic
1097192372 12:57225751-57225773 GGCTCAGGACTGGCTGGGGAGGG - Exonic
1097279047 12:57833262-57833284 GCCTCAGTCCTAGATGGGGAGGG + Intronic
1101517974 12:105454571-105454593 ATCTCAGGGCTAGCCTGGGAGGG + Intergenic
1103722813 12:122983680-122983702 GACTCAGACCGAGCCAGGGAGGG + Exonic
1104093813 12:125537987-125538009 GAAGCAGGCCTGGCTGGGGATGG - Intronic
1104280737 12:127374232-127374254 GAAGCAGGCCTGGCTGGGGATGG + Intergenic
1105805651 13:23950411-23950433 GACCCAGGCCTAGATGAGGAGGG - Intergenic
1113252714 13:108472152-108472174 GCCTCAGGCCTATGATGGGAGGG - Intergenic
1120762683 14:88299936-88299958 GATTCAGGCCCAGTTAGGGAAGG - Intronic
1121487645 14:94331006-94331028 GGCCCAGGCCTTGCTTGGCAAGG + Intergenic
1123871690 15:24581511-24581533 GCATCAGGCCTAGGATGGGAGGG + Intergenic
1123879015 15:24657144-24657166 GTTTCAGGCCTGGCATGGGATGG + Intergenic
1124492493 15:30166729-30166751 CACTCAAGCATAGATTGGGAAGG + Intergenic
1124751042 15:32371588-32371610 CACTCAAGCATAGATTGGGAAGG - Intergenic
1125603097 15:40926224-40926246 GAAGCAGGCCTGGCTTGGGCGGG - Intergenic
1127621143 15:60736066-60736088 GACTCAGTCCTGGCTTCTGAAGG - Intronic
1131616664 15:94023613-94023635 GGTTCAGGCCTGGCTTGGAAAGG + Intergenic
1132614549 16:833633-833655 GGCTCAGGCACAGCTTGGGGAGG - Intergenic
1134192739 16:12135112-12135134 TACTCAGGCCCTGCTTGGAATGG + Intronic
1135275032 16:21104917-21104939 GACTCAGACCTAGCCTAGGAAGG - Intronic
1138289558 16:55835386-55835408 GACCCAGGCTTAGCATGGTAGGG + Intergenic
1141659934 16:85436363-85436385 GACTCAGGGCTAGGATGGGCTGG - Intergenic
1142223539 16:88866546-88866568 GACTCAGGCCTGGCTCCAGACGG - Exonic
1144841322 17:18188091-18188113 CACCCAGGCCTAACATGGGAAGG - Intronic
1144958256 17:19030493-19030515 GAGTCAAGCTGAGCTTGGGAGGG + Intronic
1144976902 17:19144031-19144053 GAGTCAAGCTGAGCTTGGGAGGG - Intronic
1145024543 17:19458110-19458132 GACTCAGGCCTAGCAGGGGAAGG + Intergenic
1145995414 17:29102248-29102270 TTCCCAGGCCTATCTTGGGAAGG - Intronic
1146413918 17:32614270-32614292 GTGTCAGGCATAGCTTTGGACGG - Intronic
1147135980 17:38434439-38434461 GATTCAGGCCGAGCTTTGAAAGG - Intronic
1147314200 17:39611865-39611887 GACTGTGGCCTCCCTTGGGATGG - Intergenic
1148747838 17:49928219-49928241 GACACTGGCATGGCTTGGGAGGG + Intergenic
1161149925 19:2702378-2702400 GGCTCAGGGCTAGCTGGGGAGGG - Intronic
1161626632 19:5330763-5330785 GACTCCGGCCCTGCTGGGGAAGG - Intronic
1163875055 19:19860922-19860944 GACTGAGGCCGAGCTGGGCAAGG + Intergenic
1163875735 19:19866117-19866139 GACTGAGGCCGAGCTGGGCAGGG - Intronic
1163884858 19:19956536-19956558 GACTGAGGCCAAGCTGGGCAAGG + Intergenic
1163906261 19:20151663-20151685 GACTGAGGCCGAGCTGGGCAAGG + Intergenic
1163908348 19:20167475-20167497 GACTGAGGCCGAGCTGGGTAAGG - Intronic
1163938618 19:20473306-20473328 GACTGAGGCCGAGCTGGGTAAGG - Intergenic
1163948821 19:20565494-20565516 GACTGAGGCCGAGCTGGGCAAGG + Intronic
1164005230 19:21142308-21142330 GACTGAGGCCGAGCTGGGCAAGG - Intronic
1164023415 19:21329068-21329090 GACTGAGGCCGAGCTAGGCAAGG + Intronic
1164026676 19:21359265-21359287 GACTGAGGCCGAGCTGGGCAAGG - Intronic
1164030288 19:21397390-21397412 GACTGAGGCCGAGCTGGGCAAGG - Intronic
1164136546 19:22422050-22422072 GACTGAGGCCGAGCTAGGCAAGG + Intronic
1164226421 19:23250096-23250118 GACTGAGGCCCAGCTGGGCAAGG + Intronic
1164241719 19:23395181-23395203 GACTGAGGCCGAGCTGGGCAAGG + Intronic
1164254144 19:23512370-23512392 GACTGAGGCCGAGCTGGGCAAGG + Intergenic
1165134760 19:33660921-33660943 AACTGGGGCCTAGCCTGGGAGGG - Intronic
1165755246 19:38289071-38289093 GACACAGGCCTAGCTGGGTCTGG - Intronic
926101437 2:10120731-10120753 GACTCAGGTTTAGCGCGGGAGGG + Intergenic
926135000 2:10330375-10330397 GACTCAGGGCTTGGTGGGGAGGG - Intronic
927082486 2:19644173-19644195 GACTCCAGCCTAGCTGTGGAGGG + Intergenic
927206749 2:20615949-20615971 GACACAGGCCTGGCCAGGGAAGG + Intronic
928476994 2:31637741-31637763 GACTGGGGCTCAGCTTGGGAGGG - Intergenic
934527755 2:95062133-95062155 GACTGAGGCCCTGCTTGGGTAGG - Intergenic
934562010 2:95318235-95318257 GACTCAGGACAAGCCTGGGCTGG + Intronic
934614173 2:95761171-95761193 GACTCAGGGACAGCTGGGGAGGG - Intergenic
934646737 2:96063357-96063379 GACTCAGGGACAGCTGGGGAGGG + Intergenic
934662121 2:96148629-96148651 CACTCAGGCGGAGCTTGGGGTGG - Intergenic
934840140 2:97619439-97619461 GACTCAGGGACAGCTGGGGAGGG + Intergenic
935217738 2:100988171-100988193 GACTCAGCCCCAGCTCGGGGCGG + Exonic
942485810 2:176438827-176438849 GAATCAGGCCTTGGCTGGGAAGG + Intergenic
942690829 2:178583204-178583226 CACTCAGGTCTATCCTGGGAGGG + Exonic
947150185 2:227107628-227107650 GTGTCAGTCCTAGCTTGGCATGG + Intronic
1170431378 20:16279703-16279725 GCTTCAGGCCTAGCTGTGGATGG - Intronic
1172030992 20:31981982-31982004 CAGCCAGGCCCAGCTTGGGAAGG - Intronic
1172447610 20:35001392-35001414 GACTCAGGGCTTGCTTGGGCTGG - Intronic
1173108542 20:40162248-40162270 GTCTCAGGCCTGGGTAGGGAAGG - Intergenic
1173815278 20:45983538-45983560 GACTCAGGACTGGCTTTGGGAGG - Intergenic
1173844345 20:46178547-46178569 GACCTTGGCCTAGCTGGGGACGG - Intronic
1174650455 20:52120340-52120362 ATCTCAGGCCTGGTTTGGGAAGG + Intronic
1177727886 21:24992217-24992239 GGCTCAGGCCTAACTTTGAAGGG - Intergenic
1178490829 21:33050352-33050374 GACTCTGGCAGAGTTTGGGATGG + Intergenic
1179731854 21:43372606-43372628 GACCCAGGCCTAGCCAGGGCGGG + Intergenic
1180057614 21:45367044-45367066 GACTCAGGCCCAGCTGGCGGGGG + Intergenic
1182365477 22:29775948-29775970 GCCTCAGGCTAAGCTTGGGAGGG - Intergenic
1183734626 22:39636969-39636991 GACTGAGGCCTAGATGGGAAGGG + Intronic
950449840 3:13059320-13059342 GACTCAGCCCAAGACTGGGAGGG - Intronic
954297177 3:49680746-49680768 GACACAGGCCCAGCTTGGCATGG + Intronic
954415966 3:50393488-50393510 AACTCAGGCCTAGGCTGGGATGG + Intronic
955367644 3:58325380-58325402 GGCTAAGGCCTAGCTGGGCATGG - Intergenic
956489962 3:69760319-69760341 GATTGGGGCCTAGCCTGGGAGGG + Intronic
956839232 3:73121619-73121641 GACTGGGGCTTAGCCTGGGAGGG + Intergenic
961552634 3:127677849-127677871 GGCTCAGGCAGAGCTGGGGATGG + Intronic
962210989 3:133477389-133477411 GCCTCTGGCCTAGCTTCTGAAGG + Intergenic
962583637 3:136819613-136819635 GACTCACCCCTTGCTTGGGTTGG - Exonic
969275766 4:6134845-6134867 GCCTCAAGCCTAGCATGGGAGGG + Intronic
969782573 4:9420564-9420586 CACTAAGGCCTACCTGGGGATGG + Intergenic
971876762 4:32318381-32318403 GTCACAGCCCTGGCTTGGGAGGG + Intergenic
978054221 4:104243313-104243335 CACTCAGGCCTACCTGAGGATGG - Intergenic
983685934 4:170409305-170409327 CTCTCAGGCCTTGCTTGTGAGGG - Intergenic
985054173 4:186021655-186021677 GGCCCAGGCCCAGCCTGGGAAGG + Intergenic
988603759 5:32663062-32663084 GACTCAAACCTAGCTTTGAAGGG + Intergenic
991630857 5:68655290-68655312 GCTTCAGGCCTGGCTGGGGAAGG - Intergenic
992351478 5:75933482-75933504 AACTCAGGCCTTTCTTAGGAAGG - Intergenic
993901570 5:93587662-93587684 GAGTCAGGCCTAGCTCCGGCGGG + Intronic
995285767 5:110386458-110386480 GACTAAGGCTTTGCTTGTGAGGG + Intronic
995370489 5:111413094-111413116 AACTGAGGCTTAGCTTGGGAGGG - Intronic
996843861 5:127878249-127878271 AACTCAGTCCTAGCTTAGGTTGG + Intergenic
997215110 5:132103612-132103634 AACTCATGCCTAGCTGGGCAGGG - Intergenic
1000357917 5:160418822-160418844 GACGCAGGCCTGGCCTGGCAGGG + Intronic
1001700951 5:173706131-173706153 GACTCAGGCCTCGCTCAAGAAGG + Intergenic
1007667748 6:43525567-43525589 AGCTCAGGCCTGGCTTGGGGAGG + Intronic
1009323621 6:62322234-62322256 GACTCAGTCCTATCCTGGAAGGG - Intergenic
1016822847 6:148362476-148362498 GACTGAGGCCTTGTGTGGGAGGG - Intronic
1017848183 6:158277892-158277914 GCCTCAAGCCAAGCTTGAGATGG - Intronic
1021420597 7:20441443-20441465 GACTCAAACCTAGCTTTGAAAGG - Intergenic
1024858264 7:53807132-53807154 AACTCAGTCCTAGCTGGGGAAGG + Intergenic
1026700080 7:72633373-72633395 AACTGGGGCTTAGCTTGGGAGGG - Intronic
1035382169 7:158447133-158447155 GGCTCTGTCCTTGCTTGGGAAGG - Intronic
1036629033 8:10497323-10497345 GGCTCAGAGCTATCTTGGGATGG + Intergenic
1036648666 8:10627969-10627991 GACTGAGGCACAGCTTGGGGAGG + Intronic
1049625462 8:143617749-143617771 GGCCCAGGCCCTGCTTGGGACGG + Intronic
1049731237 8:144179614-144179636 GACTCAGGCCTAGCTTGGGAAGG + Intronic
1049960543 9:734210-734232 GATTGAGGCCTTGTTTGGGAGGG - Intronic
1056668763 9:88604968-88604990 GACTCAGGGTTATTTTGGGAAGG + Intergenic
1057302560 9:93895301-93895323 AACTGAGGCTCAGCTTGGGAAGG + Intergenic
1058541842 9:106019819-106019841 GACCCTGGCCAAGCCTGGGAAGG - Intergenic
1058829076 9:108799267-108799289 GACTCAGACCCAGCTTTGAAGGG - Intergenic
1059930148 9:119252255-119252277 ATCTCAAGGCTAGCTTGGGAAGG - Intronic
1061251917 9:129431388-129431410 GGCTCAGGCCCAGCTGGGGGCGG - Intergenic
1062031979 9:134365856-134365878 GGCTCAGGCCTGTCTTGGGGAGG + Intronic
1062243093 9:135550164-135550186 ATCTCAGGCTCAGCTTGGGACGG + Intergenic
1187272588 X:17792472-17792494 GACAGTGGCCAAGCTTGGGATGG + Intergenic
1187963194 X:24585655-24585677 CACTCTGGCCTGGCATGGGATGG - Intronic
1188590122 X:31823306-31823328 GACTCAGTCCTGCCTTGCGAAGG - Intronic
1191740660 X:64433043-64433065 CACTCAGCTCTATCTTGGGAAGG + Intergenic