ID: 1049735146

View in Genome Browser
Species Human (GRCh38)
Location 8:144200990-144201012
Sequence GTCACACATATGTAAATTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 223}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049735146_1049735149 26 Left 1049735146 8:144200990-144201012 CCCTCAATTTACATATGTGTGAC 0: 1
1: 0
2: 1
3: 23
4: 223
Right 1049735149 8:144201039-144201061 ATTCACGTTTCCTTGTTTTAAGG 0: 1
1: 0
2: 1
3: 18
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049735146 Original CRISPR GTCACACATATGTAAATTGA GGG (reversed) Intronic
900474949 1:2871794-2871816 GTCACAAAGTGGTAAATTGAGGG - Intergenic
903472142 1:23594756-23594778 GCCTCACATCTGTAAAATGAAGG + Intronic
906396480 1:45470875-45470897 TTTACACATTTGTAAATTGGGGG - Intronic
908642109 1:66236549-66236571 ATCAAACATATGAAAGTTGAAGG - Intronic
911457749 1:98148307-98148329 GTCAGACAAATTTCAATTGAGGG + Intergenic
911578079 1:99601933-99601955 GTCGCACATGTGTTAATTGCAGG - Intergenic
918101374 1:181378159-181378181 ATCACAAATAAGAAAATTGAAGG - Intergenic
919512668 1:198485877-198485899 GTCACACAACTATAAAGTGAGGG - Intergenic
921958300 1:221007038-221007060 ATCAGACAAATGTAAATTTAAGG - Intergenic
922001049 1:221478610-221478632 GTCACACAAATATTTATTGAAGG + Intergenic
922655641 1:227380667-227380689 TTCATACAAATGAAAATTGAGGG + Intergenic
924025630 1:239830310-239830332 GTCACACATATTTTGACTGAGGG - Intronic
924033035 1:239906664-239906686 GTCACACATATGTGAACAAATGG - Intronic
924449458 1:244164406-244164428 GTGACACCTATGTAAGGTGAGGG - Intergenic
924481292 1:244436935-244436957 CTCAGACATATGTAACTTAAAGG + Intronic
1063873079 10:10440741-10440763 GCCAATCTTATGTAAATTGAAGG - Intergenic
1065089965 10:22221691-22221713 GTCACACAAATTTCAATAGAGGG - Intergenic
1065430497 10:25649886-25649908 TTCAAACAAATGTAAATTGGAGG - Intergenic
1065637728 10:27747075-27747097 GTGACACATATGAAATTTGAGGG - Intergenic
1066508059 10:36065961-36065983 GCCACGCAAATGCAAATTGAAGG - Intergenic
1067157195 10:43792187-43792209 GACACACATAAGTAAATGGAAGG - Intergenic
1067514612 10:46927487-46927509 GGGTCACATATGTAAATTCAGGG - Intronic
1067647648 10:48124326-48124348 GGGTCACATATGTAAATTCAGGG + Intergenic
1067905433 10:50286115-50286137 GACACACATATATAAATACATGG + Intergenic
1068896592 10:62210274-62210296 GTCACACTTAAGAAAATTTATGG - Intronic
1069131304 10:64707038-64707060 ATCAGACAAATGAAAATTGAGGG - Intergenic
1070798269 10:79229892-79229914 GGCTCACCTATGTAAACTGATGG - Intronic
1071035750 10:81242694-81242716 GTCAGACAAATAAAAATTGAGGG + Intergenic
1073123943 10:101138468-101138490 GTCACACACAAGTAAATACAGGG - Intergenic
1074263756 10:111880598-111880620 GCCCCACATCTGTAAAATGAGGG - Intergenic
1074852399 10:117449257-117449279 ATCACTCATCTGTAAAATGAGGG + Intergenic
1076094089 10:127716321-127716343 GTTACAGATAAGAAAATTGAGGG + Intergenic
1081437708 11:43045206-43045228 GTCAGACATATAGCAATTGATGG - Intergenic
1084463116 11:69307262-69307284 GTCACACATTTGCAATTTGATGG + Intronic
1085822918 11:79812175-79812197 GTCACACAGTTGGAAAATGAGGG - Intergenic
1086474218 11:87153121-87153143 ATCAAAAATATGTAATTTGAAGG - Intronic
1086885431 11:92200171-92200193 GTCACACATTTACAAATTCATGG - Intergenic
1087440334 11:98175926-98175948 TGCACACATATGTTAATTGTAGG + Intergenic
1087583080 11:100083715-100083737 ATCACAAATATCTAAATTAATGG + Intronic
1089394347 11:118126100-118126122 CACACACATATGTACATTCATGG + Intergenic
1089801495 11:121033169-121033191 GTTATTCATAGGTAAATTGAAGG + Intronic
1095054511 12:37583146-37583168 ATCACACATAATTAAATAGATGG - Intergenic
1095149959 12:38781844-38781866 ATCACACAAATGCAAATTTAGGG + Intronic
1095498384 12:42809380-42809402 GACACATTTATGTAAATTTATGG + Intergenic
1097417911 12:59336395-59336417 GTCAGACATATCTAAACTGTTGG + Intergenic
1097786103 12:63761320-63761342 GTTACACAAATGTATATAGAGGG + Intergenic
1098096878 12:66966678-66966700 GTCAGACAAATTTTAATTGATGG - Intergenic
1099135932 12:78901597-78901619 GTAACACAAGTGTAAATTGGAGG + Intronic
1099262983 12:80407725-80407747 GTCAGACAGATATAAATTCAAGG - Intronic
1100377605 12:94031703-94031725 TTTCCCCATATGTAAATTGACGG + Intergenic
1101506354 12:105350149-105350171 GCAACACATATAGAAATTGAAGG - Intronic
1103413523 12:120729178-120729200 TTCTGACCTATGTAAATTGATGG - Intronic
1106133776 13:26959434-26959456 TTCTCTCATTTGTAAATTGACGG + Intergenic
1106859670 13:33892328-33892350 GTCCCTCATATGTTAATAGAAGG + Intronic
1107173319 13:37369740-37369762 GTCCCACAAATCCAAATTGAAGG - Intergenic
1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG + Intronic
1110116607 13:71825073-71825095 TTCACACATACCAAAATTGATGG + Intronic
1111569709 13:90067882-90067904 AGCACATATATTTAAATTGATGG - Intergenic
1111976945 13:94976408-94976430 ATCAGACAAATCTAAATTGAGGG - Intergenic
1114928077 14:27430585-27430607 TGCACACATATGTAATTTGTTGG - Intergenic
1119317879 14:73710676-73710698 ATCACACCTGTGTAAAATGAAGG - Intergenic
1119537464 14:75414104-75414126 TTTTCACATATGTAAAATGAGGG + Intergenic
1119972501 14:78987317-78987339 GTCACACATTTGGTAATTGAAGG - Intronic
1120669955 14:87352006-87352028 GTTCCACATCTGTAAAATGAGGG + Intergenic
1120913436 14:89688708-89688730 GCCTCACATATGCAAATCGATGG - Intergenic
1122130267 14:99601093-99601115 GTCCCACTAATGTAAATGGAAGG - Intronic
1123214977 14:106800175-106800197 GACACACACATATAAATTAAAGG + Intergenic
1123689069 15:22822171-22822193 GTCACTTCCATGTAAATTGAGGG - Intronic
1125104262 15:35952432-35952454 TTCCCACATATGGAAACTGAGGG + Intergenic
1128907753 15:71483289-71483311 TTCACACGTATGAAGATTGAGGG - Intronic
1129415730 15:75377688-75377710 GTTAAAAAGATGTAAATTGAGGG - Intronic
1130916558 15:88309631-88309653 GTCACTCAAATGAAAATTTAAGG - Intergenic
1137330570 16:47491408-47491430 GTCACCAATATGTAAATAGGAGG - Intronic
1138793705 16:59941632-59941654 GTAACAAATATGAAAATTGCTGG - Intergenic
1139129010 16:64117896-64117918 GTTACACAATTGTAAACTGAAGG - Intergenic
1140388722 16:74566010-74566032 GTCACACAAACCCAAATTGAGGG - Intronic
1143057828 17:4175722-4175744 GTCTCACAGATGTATATTCATGG + Intronic
1146432267 17:32809016-32809038 CACACACATATGTATATTTAGGG + Intronic
1149491562 17:57088523-57088545 GTCACACAAATTCAAATTGAGGG + Intronic
1149675315 17:58454828-58454850 GTCACAAATAAATAAATGGAAGG + Intronic
1150581786 17:66480986-66481008 GTAACACCTATGTAAAATTATGG - Intronic
1151135005 17:71938051-71938073 GTCAAACATATTTACAGTGATGG + Intergenic
1155625166 18:27826098-27826120 GTCCCACAAGTGTAATTTGAGGG - Intergenic
1156604173 18:38646036-38646058 GTAAAACACATGTCAATTGAAGG + Intergenic
1156652941 18:39248646-39248668 TTCACAGATTTGTAAATTCATGG - Intergenic
1157365424 18:47059879-47059901 TTTCCACATTTGTAAATTGAGGG + Intronic
1159564170 18:70029557-70029579 GTCACACAACTGGTAATTGATGG - Intronic
1159721143 18:71892569-71892591 TTCACACATATATATATTCAAGG + Intergenic
1164483075 19:28630885-28630907 GTCTCACATATGTAAACACATGG + Intergenic
1167698954 19:51031053-51031075 GTCATAAATATGTAACTTGGAGG - Intronic
926588968 2:14719544-14719566 GTGACACATAGGTCAAGTGATGG + Intergenic
929345435 2:40877779-40877801 GTCACACATATGTTAATTTGTGG + Intergenic
930129459 2:47834431-47834453 ATCACACATATTTTAAGTGAAGG - Intronic
931195510 2:60048847-60048869 ACCACACATAGGCAAATTGAGGG - Intergenic
933924929 2:87083460-87083482 CTCAGACAAATGAAAATTGAGGG - Intergenic
935097088 2:99955475-99955497 AACACACATATTTAAATTTATGG - Intronic
935373727 2:102374425-102374447 GTAACACATTTGTACATTGATGG - Intronic
935727314 2:106035034-106035056 GTCAGACAAAAGTAAATTGAAGG + Intergenic
939450304 2:142365091-142365113 CTCACACATATGTAAAAAAAGGG - Intergenic
941543991 2:166822272-166822294 ATCACACACATCTAAATTTAAGG + Intergenic
942237364 2:173924652-173924674 GTCACACAGTTGAAAATGGATGG + Intronic
942370999 2:175284572-175284594 GTCACACAGCTGGTAATTGATGG - Intergenic
942861189 2:180614318-180614340 GTCACACATATAGTAATTGATGG + Intergenic
943117900 2:183696007-183696029 GTCACAAAGATGTAAATTCCAGG - Intergenic
943121199 2:183738262-183738284 GCAAAACATATGTAAATAGAGGG - Intergenic
945614125 2:212046281-212046303 GTCCCTCATCTGTAAAGTGAAGG - Intronic
947327585 2:228994550-228994572 CTCACAGTTATGTAAGTTGATGG + Intronic
948692910 2:239718153-239718175 GTCACACAGATGTAAACAGCAGG + Intergenic
1171074266 20:22106236-22106258 ATCAGACAAATGTAAAGTGAAGG - Intergenic
1171098076 20:22351870-22351892 GTCACAAATATGTTGATTAATGG + Intergenic
1171510641 20:25681303-25681325 TTCCCACCTATGTAAACTGAGGG + Intronic
1172080877 20:32339646-32339668 TTCACAAATAAGTAAATTTAAGG + Intergenic
1173186145 20:40841847-40841869 GTCCCACCAATGTAGATTGAGGG - Intergenic
1177268798 21:18819392-18819414 GACACAGATATGAAACTTGATGG - Intergenic
1177717642 21:24860282-24860304 GTCACTCATGTATAAAGTGACGG + Intergenic
1182408006 22:30154712-30154734 ATCAGACAAATGCAAATTGAAGG - Intronic
1182964920 22:34511860-34511882 GTCACACAGATGCAAAAGGAAGG - Intergenic
950992898 3:17459807-17459829 GTAACACATAGATGAATTGAAGG + Intronic
951064662 3:18249855-18249877 GTCACACACATCTAATATGATGG - Intronic
951866601 3:27315673-27315695 GACACACATATGTAGATGGCAGG + Intronic
953340110 3:42126608-42126630 TACACAGATATGTAAATTGTTGG - Intronic
956136278 3:66102197-66102219 ATCACACAAACTTAAATTGAGGG - Intergenic
956955827 3:74338576-74338598 GTAATACATATATAAAGTGATGG - Intronic
957303055 3:78418887-78418909 CTCACACAAGTGAAAATTGAGGG + Intergenic
959266797 3:104151179-104151201 ATAACAAATATGTATATTGATGG - Intergenic
959340431 3:105122652-105122674 GTCAAACATATATGAAATGAAGG - Intergenic
959432635 3:106273755-106273777 GTGACACATTTGAAAATTTAGGG - Intergenic
960825655 3:121781033-121781055 TTCACACTTATGTAATTTTATGG - Intronic
962314366 3:134350000-134350022 GACACACATACAGAAATTGAGGG + Intergenic
964580704 3:158233774-158233796 GTTACACAGATGGAAATTCATGG - Intronic
964580789 3:158235025-158235047 GTTACACAGATGGAAATTCATGG + Intronic
967245107 3:187478715-187478737 TTCACTCATATATAAAATGAAGG - Intergenic
967332770 3:188308484-188308506 GTGACCCATCTGAAAATTGATGG + Intronic
967451122 3:189624324-189624346 ACCACACATATGTAAAGTTATGG - Intergenic
967458976 3:189723211-189723233 ATTACAGATATGGAAATTGAAGG + Intronic
968157144 3:196390885-196390907 GGAACACATATGTTAAATGAAGG - Intronic
969075037 4:4571300-4571322 GTCAGACAAATGCAGATTGAAGG - Intergenic
969858790 4:10020018-10020040 CTCACAAATATGTCAAATGATGG - Intronic
974332092 4:60493951-60493973 GTCACACATATGTACTTAGTGGG - Intergenic
974617453 4:64307568-64307590 GTTACACATATGGAAAGAGAGGG - Intronic
974689275 4:65274058-65274080 CACACACATATGGAAATTAATGG + Intergenic
975200516 4:71582843-71582865 CTCAGACAAATCTAAATTGAAGG + Intergenic
975992499 4:80271765-80271787 GTCACGCATATTAAATTTGATGG - Intronic
976056819 4:81078873-81078895 GTCACACAAATGTTAGTTGAGGG + Intergenic
977028397 4:91850697-91850719 GGCATACTTATTTAAATTGAAGG + Intergenic
977517503 4:98039661-98039683 GTATCACATATGTAATTTTAAGG - Intronic
977649970 4:99458212-99458234 ATCACAGATAAGTAAATTGAAGG + Intergenic
978019749 4:103792946-103792968 TTCACACATATGTTTATTGCAGG + Intergenic
980015079 4:127640602-127640624 AACACACATGTGTATATTGATGG + Intronic
980338452 4:131507322-131507344 TTTACACATAGGTAAAATGAGGG - Intergenic
980819625 4:137996527-137996549 CTCACAGACATGTAAATTAATGG - Intergenic
981508650 4:145530860-145530882 GTCACACAGCTGCTAATTGAGGG - Intronic
983719802 4:170836313-170836335 GTCATACATATTTTGATTGAGGG - Intergenic
983976966 4:173946447-173946469 CTCACACACATGTATATTCATGG + Intergenic
984305607 4:177985426-177985448 TACTCACATATGTAAAATGAAGG + Intronic
984414318 4:179437069-179437091 GTCACACATTTGATAAGTGATGG + Intergenic
985192230 4:187387553-187387575 ATCAAACATTTGTAAATTCATGG + Intergenic
986628525 5:9746460-9746482 TGCACACATATGTTTATTGAAGG + Intergenic
986658742 5:10040511-10040533 GTGACACAAATGTCCATTGATGG - Intergenic
987154423 5:15074388-15074410 GTCAAATGTGTGTAAATTGAGGG - Intergenic
988109336 5:26797492-26797514 GACAGACATTTGTAAATTTATGG - Intergenic
988109759 5:26803900-26803922 CTCACACATATGTATATACATGG - Intergenic
988313856 5:29598093-29598115 GTCACAGAGATGAAAATTGTTGG + Intergenic
990012482 5:51017051-51017073 GCCACACCTAAGAAAATTGATGG - Intergenic
990101064 5:52187862-52187884 TTCACACATTTGGAAAATGAAGG - Intergenic
990505739 5:56442827-56442849 GTTTCACATATGTATTTTGAGGG + Intergenic
990963340 5:61417978-61418000 GTTATTCATATGTAAATTGATGG - Intronic
991009593 5:61869190-61869212 ATCAGACAAATGTGAATTGAGGG - Intergenic
991372557 5:65934493-65934515 ATCACACAAATGAAAATTGAGGG - Intronic
991925650 5:71702928-71702950 GTCACACACATGCTCATTGAAGG - Intergenic
992700048 5:79332932-79332954 CTCATTCATCTGTAAATTGAAGG + Intergenic
993556935 5:89351448-89351470 GTCTAACATACGTAATTTGAGGG + Intergenic
993581527 5:89667590-89667612 ATAACACATATATAAATAGATGG - Intergenic
993919962 5:93789179-93789201 GTTACACATATGTACTGTGAGGG + Intronic
995247709 5:109953593-109953615 TTCACAGATAAGTAAATTAAGGG + Intergenic
995898469 5:117042107-117042129 CTCACCCATATGTGAATTGAAGG + Intergenic
996209003 5:120781689-120781711 TTTTCACATATGTATATTGACGG - Intergenic
996999984 5:129747975-129747997 CTCACACACATGTACATGGAGGG - Intergenic
998045795 5:138985647-138985669 GTCTCACAGAAGTAAAATGATGG + Intronic
1001182943 5:169537952-169537974 TTCCCACATATGAAAGTTGAGGG + Intergenic
1002096844 5:176836407-176836429 TTCACAGATGTGCAAATTGAGGG - Intronic
1003617254 6:7666948-7666970 ATCACACATAGGAATATTGATGG - Intergenic
1009763958 6:68043935-68043957 GTCCAACATTTTTAAATTGAGGG + Intergenic
1010098731 6:72077738-72077760 TTCCCTCATCTGTAAATTGAGGG - Intronic
1010128197 6:72459791-72459813 GTCACACAGCTGTAAAGTGAAGG - Intergenic
1010337740 6:74707133-74707155 ATCAGAGATATGTACATTGAGGG - Intergenic
1011067489 6:83343110-83343132 GGTACAAATATGTCAATTGAAGG - Intronic
1011439384 6:87371250-87371272 GTCACACAGCTGGAAAATGATGG + Intronic
1011442710 6:87404049-87404071 TTCACAGATGTGGAAATTGAAGG + Intergenic
1013379199 6:109550002-109550024 TTCACCCTTAAGTAAATTGATGG + Intronic
1014100664 6:117508332-117508354 ACCACATATATGTAAAATGAGGG - Intronic
1016810681 6:148258447-148258469 GTTTCACATCTGTAAATTGGGGG - Intergenic
1020245898 7:6429291-6429313 ATCACACAAATGCAAATTGAAGG + Intronic
1020653355 7:10901608-10901630 GTTACACATATAAAAATTAAAGG - Intergenic
1020859355 7:13471121-13471143 AACACACATATGTAAAATGTTGG - Intergenic
1021722935 7:23521349-23521371 GCCAAACACATTTAAATTGATGG + Intronic
1021860349 7:24899993-24900015 GTCACACATACACAAATAGAAGG - Intronic
1022308340 7:29171905-29171927 GTCAAACATATGGGAATTGGGGG - Intronic
1024672241 7:51606762-51606784 TTCCCACATTTGTAAAGTGAGGG - Intergenic
1025870941 7:65433754-65433776 TTCACTCATATGTAAAATGAGGG - Intergenic
1030780962 7:113599483-113599505 GTCAGACACATTCAAATTGAGGG + Intergenic
1031517326 7:122717318-122717340 TTCAAAGATGTGTAAATTGAGGG + Intronic
1031844406 7:126787240-126787262 GTCACACACATGAAACTTGTTGG - Intronic
1033768814 7:144525204-144525226 GTTACACATATGTAAAAGGTGGG - Intronic
1036153871 8:6324127-6324149 GTCACACATCTTTAATTTGAGGG + Intergenic
1037478377 8:19279677-19279699 GACACAGATATGTCATTTGAAGG - Intergenic
1038388607 8:27173807-27173829 CACACACATATATATATTGATGG + Intergenic
1038560152 8:28569606-28569628 GTCATTTACATGTAAATTGATGG + Exonic
1041023742 8:53663111-53663133 GTCAGACATATTTATATTTAAGG - Intergenic
1041065675 8:54080526-54080548 TTGAGAAATATGTAAATTGATGG + Intronic
1041824439 8:62077400-62077422 GTGACACTGATGTAAATTGAGGG - Intergenic
1042081588 8:65059983-65060005 GTCACACAAATGCAAATTGAAGG - Intergenic
1044096963 8:88078788-88078810 GTGACACATTTGTAGATTTATGG - Intronic
1044154777 8:88831013-88831035 TACATATATATGTAAATTGAGGG + Intergenic
1044734673 8:95268015-95268037 GACATACATATGGAAATTTAAGG - Intronic
1044766656 8:95583064-95583086 ATCACACACATGTCCATTGATGG + Intergenic
1045357347 8:101401491-101401513 GTAACACATATCTCAATGGAGGG + Intergenic
1046324090 8:112617907-112617929 GCTACACATATGAGAATTGAAGG - Intronic
1046825742 8:118689593-118689615 GTCCCACAGAGGTAAAATGAAGG + Intergenic
1047049018 8:121088783-121088805 GTCACACATAAATAAATTAGTGG - Intergenic
1047857388 8:128926471-128926493 GACACACATATGTACATTAATGG - Intergenic
1048102297 8:131366431-131366453 GTCACACATATATAATTTTAGGG + Intergenic
1048474465 8:134730721-134730743 GTCCCCCATCTGTAAACTGAGGG - Intergenic
1048760680 8:137791439-137791461 GTCCCATATTTGTAAACTGAAGG - Intergenic
1049735146 8:144200990-144201012 GTCACACATATGTAAATTGAGGG - Intronic
1051133565 9:13891696-13891718 TTCAAAAATATGTAAGTTGATGG + Intergenic
1051383560 9:16482900-16482922 GTCACACATGAGTAGACTGATGG - Intronic
1051405477 9:16733497-16733519 GACTCACATATGTAAATAGATGG + Intronic
1051829847 9:21263829-21263851 ACCACACATATCCAAATTGATGG - Intergenic
1053362438 9:37498618-37498640 GTTACACAGATGTATCTTGAAGG + Intronic
1055868893 9:80850124-80850146 TACACACATATGTATATTTAGGG - Intergenic
1055874010 9:80921085-80921107 GTCACACAAGTGTAAAGTAAAGG + Intergenic
1056720624 9:89068773-89068795 GACACACATATCTAGATTGTTGG - Intronic
1059242560 9:112819732-112819754 GTCAGACAAATGTCAACTGAGGG - Intronic
1186885418 X:13908401-13908423 GTCAGACAAATCCAAATTGAGGG + Intronic
1189101137 X:38191235-38191257 TTCATTCAAATGTAAATTGATGG - Intronic
1191101970 X:56739559-56739581 GGCACACAAATTTAAATTAAAGG - Intergenic
1191866179 X:65705702-65705724 CTCACACATATGGTAATTGGAGG + Intronic
1193013071 X:76699102-76699124 GTCAGACAAATGAAAACTGAAGG + Intergenic
1193568312 X:83107757-83107779 GTAACACATTTGTGAAGTGATGG + Intergenic
1193998884 X:88401585-88401607 GTTACACATTTGTGAATTCAGGG + Intergenic
1194203225 X:90979786-90979808 ATAACATATATTTAAATTGATGG - Intergenic
1198162191 X:134018838-134018860 TTCACTCATATGTAAAATGAGGG + Intergenic
1198244069 X:134812356-134812378 GTCACTCATAAGAAAATTGGAGG - Intronic
1198707529 X:139464680-139464702 GTCACACATAGATCAATTCAAGG + Intergenic
1199419761 X:147631277-147631299 ATCAGAAATATGAAAATTGATGG + Intergenic
1199930330 X:152511958-152511980 ATCCCACATATGTATAATGATGG + Intergenic
1201330001 Y:12808216-12808238 GTCACAAATATTTAAGTTGCTGG - Intronic