ID: 1049736694

View in Genome Browser
Species Human (GRCh38)
Location 8:144211391-144211413
Sequence CTGGGTAAGCAAATGGTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 82}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049736694_1049736702 0 Left 1049736694 8:144211391-144211413 CCAGGTACCATTTGCTTACCCAG 0: 1
1: 0
2: 1
3: 10
4: 82
Right 1049736702 8:144211414-144211436 GGGTATGGTTCATATAAGAAAGG No data
1049736694_1049736703 4 Left 1049736694 8:144211391-144211413 CCAGGTACCATTTGCTTACCCAG 0: 1
1: 0
2: 1
3: 10
4: 82
Right 1049736703 8:144211418-144211440 ATGGTTCATATAAGAAAGGCAGG No data
1049736694_1049736705 9 Left 1049736694 8:144211391-144211413 CCAGGTACCATTTGCTTACCCAG 0: 1
1: 0
2: 1
3: 10
4: 82
Right 1049736705 8:144211423-144211445 TCATATAAGAAAGGCAGGGTTGG No data
1049736694_1049736708 22 Left 1049736694 8:144211391-144211413 CCAGGTACCATTTGCTTACCCAG 0: 1
1: 0
2: 1
3: 10
4: 82
Right 1049736708 8:144211436-144211458 GCAGGGTTGGCCGGGCACAGTGG No data
1049736694_1049736706 13 Left 1049736694 8:144211391-144211413 CCAGGTACCATTTGCTTACCCAG 0: 1
1: 0
2: 1
3: 10
4: 82
Right 1049736706 8:144211427-144211449 ATAAGAAAGGCAGGGTTGGCCGG No data
1049736694_1049736704 5 Left 1049736694 8:144211391-144211413 CCAGGTACCATTTGCTTACCCAG 0: 1
1: 0
2: 1
3: 10
4: 82
Right 1049736704 8:144211419-144211441 TGGTTCATATAAGAAAGGCAGGG No data
1049736694_1049736707 14 Left 1049736694 8:144211391-144211413 CCAGGTACCATTTGCTTACCCAG 0: 1
1: 0
2: 1
3: 10
4: 82
Right 1049736707 8:144211428-144211450 TAAGAAAGGCAGGGTTGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049736694 Original CRISPR CTGGGTAAGCAAATGGTACC TGG (reversed) Intronic
901092117 1:6648870-6648892 CTGGGTCTGCAAAGGGGACCGGG - Intronic
901107765 1:6770642-6770664 CTAGGTATGCAAGTGGTTCCAGG + Intergenic
905931467 1:41790892-41790914 GTGGGGAAGAAAATGGTACAGGG - Intronic
906236134 1:44212288-44212310 CAGGGTAAGGAAATGGTCCTTGG - Intergenic
914384301 1:147152961-147152983 CAGAGTAAGCAAATGGGCCCAGG + Intergenic
919407058 1:197198452-197198474 CTGGGTAAGTAATTTCTACCAGG + Intronic
923467299 1:234260751-234260773 CTGATTAAGCACATGGCACCGGG + Intronic
1070149187 10:73795321-73795343 CTGGGTAAGCAGATTGGACCTGG + Intronic
1073095172 10:100975093-100975115 CTGGGGAGGCAGATGGAACCAGG + Intronic
1074354815 10:112773291-112773313 TTGGGAAAGCACATAGTACCTGG + Intronic
1075705438 10:124497542-124497564 CTGGGGCAGCTAATGGGACCTGG - Intronic
1077959744 11:7062734-7062756 CTTAGTACGCAAATGGTACCTGG + Intronic
1085577463 11:77619842-77619864 CTGAGAAAGAAAATGCTACCTGG + Intronic
1089786021 11:120907835-120907857 CTGGGCAAGCAAAAGGTAGAAGG + Intronic
1098181904 12:67856289-67856311 CTGGCTCAGCAAATGTCACCAGG - Intergenic
1098944058 12:76570963-76570985 CAGGGTAACCAAATAGTTCCAGG - Intergenic
1105529212 13:21203037-21203059 CTGGGGAAGCAAATGCTTGCTGG + Intergenic
1105903673 13:24781609-24781631 CTGGGTAACCAAGTGAGACCTGG + Intronic
1106736410 13:32592089-32592111 CAGGATAAGCAGATGGTACAAGG - Intronic
1108041762 13:46345928-46345950 CTTGGTAATCAAAGGGTACTAGG - Intronic
1110965833 13:81695850-81695872 CTGAATAAGCAAACGTTACCAGG - Intergenic
1113961223 13:114127339-114127361 GTGTGTGAGCAAATGGTGCCTGG - Intronic
1120071078 14:80103291-80103313 CTTAGTAAGGAAATGCTACCAGG + Intergenic
1124014752 15:25864996-25865018 CAGGGTAAGCAAATGGAATGAGG - Intronic
1124681614 15:31736609-31736631 CTGGGGACGGAAATGGCACCTGG - Intronic
1127406232 15:58650171-58650193 CTGACAAAGGAAATGGTACCTGG - Intronic
1129441474 15:75583929-75583951 CTAGGCAAGCAAATGGTTCTAGG + Intergenic
1130193338 15:81756876-81756898 CTGTGAAAGAAAATGGGACCGGG + Intergenic
1130843810 15:87725728-87725750 CTGGCTCAGCAAATGGTAGAGGG - Intergenic
1138669338 16:58600305-58600327 CTGGGTGAGAAAGTGGTACTCGG + Intronic
1145896807 17:28463338-28463360 CTGGGTAAGCCCTTGGTCCCAGG - Intronic
1151593600 17:75063267-75063289 CTGGCTAAGCAAATGAAAGCAGG - Exonic
1153822390 18:8843394-8843416 CTGGGAAAGCAAATGGAGCCAGG + Intergenic
1158302278 18:56065416-56065438 CTGGGTAAGCATATGGACTCTGG + Intergenic
926374615 2:12214342-12214364 TGGTGTGAGCAAATGGTACCAGG + Intergenic
931444337 2:62314219-62314241 CTTGGTAAGCAACTTATACCTGG - Intergenic
932276493 2:70455746-70455768 GTGGGCAAGCAAATGGGGCCAGG + Intronic
935266923 2:101402858-101402880 CTGGGTAAGCTATTGGAACGAGG - Intronic
939568151 2:143809101-143809123 CTGGGTAAGGAAATGATAAAAGG + Intergenic
940002909 2:148984689-148984711 CTGGGAAAGCAAAGGGGACTGGG + Intronic
941069569 2:160940787-160940809 TTGGGTGAGCAGATGGTCCCAGG - Intergenic
941613526 2:167692145-167692167 AGGTGTGAGCAAATGGTACCTGG - Intergenic
1169403059 20:5300114-5300136 GTAGCTATGCAAATGGTACCTGG - Intergenic
1170230577 20:14042888-14042910 CTGGGTTTGCAACTGGTATCAGG - Intronic
1170873452 20:20229573-20229595 CTGGGTAAGCAAATGGATGGAGG + Intronic
1172894607 20:38291692-38291714 CTGAGCATGTAAATGGTACCAGG - Intronic
1174463547 20:50699787-50699809 CTGGGTGAGCACATGGACCCTGG + Intergenic
1182342730 22:29637064-29637086 CTGGGCAAGCAGAAGTTACCAGG + Intronic
1184483110 22:44759602-44759624 CTGGGTATGCAGATGAGACCCGG - Intronic
954563618 3:51579635-51579657 CTTAGTAATTAAATGGTACCGGG - Intronic
955181246 3:56672437-56672459 TTGGTTAACCAAGTGGTACCAGG - Intronic
960108722 3:113824862-113824884 CTGTGTAAGCAAAGGGTGACTGG + Intergenic
963277504 3:143347547-143347569 CAGGGTAAGGAAAGGGCACCCGG + Intronic
971134062 4:23847581-23847603 CTGTGTAAGCAATGAGTACCTGG + Intronic
975823121 4:78291526-78291548 CTGGTTTAGGAGATGGTACCTGG + Intronic
982596004 4:157384006-157384028 CTGGGTAAGCCATTGGCACCTGG + Intergenic
986823135 5:11491205-11491227 CTGGGAAAGCAACTGGAACCAGG - Intronic
988957327 5:36332582-36332604 CTGGGTCACCAAATGTTACCAGG + Intergenic
991202731 5:64013190-64013212 CTGTGTAAGCAAATGTCAACAGG - Intergenic
991449063 5:66732431-66732453 CTGGGTCAGCAAAGGCTTCCAGG - Intronic
995893177 5:116980380-116980402 CTGGGTAAACAACTAGTACCAGG - Intergenic
1002719099 5:181247029-181247051 CTGGGTCAGCAAAGGGAGCCCGG + Intronic
1004068817 6:12277803-12277825 CTGGATAAGGAAATGGAACCTGG + Intergenic
1005886407 6:30101043-30101065 CTGGGTAGGCGGATGGGACCAGG - Intergenic
1006361502 6:33589663-33589685 CTGGGTAAGCCAGGGGTCCCTGG + Intergenic
1007202108 6:40118340-40118362 CTGGGTAAGCCAATGGGACCAGG + Intergenic
1008405850 6:51117784-51117806 CTGGGTAAGAACATGGTAGGTGG + Intergenic
1008582705 6:52921142-52921164 CTGGGTCGCCAAATGTTACCGGG + Intergenic
1015537381 6:134280299-134280321 ATAGGTAATCAAATGGTACTAGG - Intronic
1018544909 6:164924786-164924808 CTGGGTAAGCAACTCGCCCCAGG - Intergenic
1022853562 7:34292513-34292535 CTGGGGAAAAAAGTGGTACCAGG - Intergenic
1034897396 7:154886263-154886285 CTGGCCATGCAAATGGCACCTGG + Intronic
1035030996 7:155860552-155860574 CTGGGTCATCAAATGGTAACCGG + Intergenic
1039260629 8:35767302-35767324 CTGGGGAAGGAACTGGTACCAGG + Intronic
1042034316 8:64514584-64514606 CTGGGCAAGGAAATGGGAACAGG + Intergenic
1043090229 8:75892115-75892137 CTGAATCATCAAATGGTACCCGG - Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1044423411 8:92024664-92024686 CTGGGGATGCAAATGGTTCAAGG - Intronic
1044908999 8:97036556-97036578 CAGATTAGGCAAATGGTACCTGG - Intronic
1045517572 8:102873788-102873810 CTGGCTAAGTAATTGGTACAAGG + Intronic
1045668431 8:104517853-104517875 TTTGGTAAGCAAATGGTGTCTGG + Intronic
1049189750 8:141280471-141280493 CTGGGTAACCAAATGCAACATGG + Intronic
1049736694 8:144211391-144211413 CTGGGTAAGCAAATGGTACCTGG - Intronic
1050035369 9:1430013-1430035 CTGGGTACACAAATGTAACCTGG - Intergenic
1053002605 9:34585661-34585683 CTGGGAAGGCAAGTGGTCCCTGG - Intronic
1055942429 9:81663252-81663274 CTGGGTACCCAAATAGTTCCAGG - Intronic
1057704024 9:97385261-97385283 TTGGGTCAGGAAATGGTCCCTGG + Intergenic
1059168393 9:112100530-112100552 CTGGTTAAAAAAATTGTACCTGG + Intronic
1059987365 9:119833688-119833710 CTGGCACAGCGAATGGTACCTGG - Intergenic
1185840755 X:3389046-3389068 CTGAGTATGCAAATGCTACATGG + Intergenic
1186944175 X:14546629-14546651 CTGGGTTTGCAAATGGCTCCTGG + Intronic
1195683326 X:107564700-107564722 CTGGGACAGAAAATGGTTCCTGG - Intronic
1196089464 X:111724494-111724516 GTGGGTCAGCAAATGGGATCCGG + Intronic
1196394689 X:115246731-115246753 CTGGGTAACGAACTGGTACTGGG - Intergenic