ID: 1049737557

View in Genome Browser
Species Human (GRCh38)
Location 8:144217889-144217911
Sequence CCCTCGGGTGGCTGCGTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049737548_1049737557 9 Left 1049737548 8:144217857-144217879 CCCTCTGGGTGGCTGTGTTAGTG 0: 2
1: 2
2: 2
3: 24
4: 249
Right 1049737557 8:144217889-144217911 CCCTCGGGTGGCTGCGTTAGAGG No data
1049737544_1049737557 30 Left 1049737544 8:144217836-144217858 CCAGTAGGGCATTGTCAGGATCC 0: 1
1: 0
2: 0
3: 7
4: 64
Right 1049737557 8:144217889-144217911 CCCTCGGGTGGCTGCGTTAGAGG No data
1049737549_1049737557 8 Left 1049737549 8:144217858-144217880 CCTCTGGGTGGCTGTGTTAGTGG 0: 1
1: 2
2: 2
3: 24
4: 209
Right 1049737557 8:144217889-144217911 CCCTCGGGTGGCTGCGTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049737557 Original CRISPR CCCTCGGGTGGCTGCGTTAG AGG Intronic
No off target data available for this crispr