ID: 1049740921

View in Genome Browser
Species Human (GRCh38)
Location 8:144240476-144240498
Sequence CCCCATGTGCTGTGGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 275}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049740921_1049740930 10 Left 1049740921 8:144240476-144240498 CCCTGCAGCCACAGCACATGGGG 0: 1
1: 0
2: 0
3: 20
4: 275
Right 1049740930 8:144240509-144240531 GCTCCAGCCAGCCCTGTGAGGGG 0: 1
1: 0
2: 3
3: 50
4: 490
1049740921_1049740933 15 Left 1049740921 8:144240476-144240498 CCCTGCAGCCACAGCACATGGGG 0: 1
1: 0
2: 0
3: 20
4: 275
Right 1049740933 8:144240514-144240536 AGCCAGCCCTGTGAGGGGTCGGG 0: 1
1: 0
2: 2
3: 28
4: 309
1049740921_1049740928 8 Left 1049740921 8:144240476-144240498 CCCTGCAGCCACAGCACATGGGG 0: 1
1: 0
2: 0
3: 20
4: 275
Right 1049740928 8:144240507-144240529 AGGCTCCAGCCAGCCCTGTGAGG 0: 1
1: 0
2: 2
3: 53
4: 389
1049740921_1049740932 14 Left 1049740921 8:144240476-144240498 CCCTGCAGCCACAGCACATGGGG 0: 1
1: 0
2: 0
3: 20
4: 275
Right 1049740932 8:144240513-144240535 CAGCCAGCCCTGTGAGGGGTCGG 0: 1
1: 0
2: 1
3: 30
4: 397
1049740921_1049740929 9 Left 1049740921 8:144240476-144240498 CCCTGCAGCCACAGCACATGGGG 0: 1
1: 0
2: 0
3: 20
4: 275
Right 1049740929 8:144240508-144240530 GGCTCCAGCCAGCCCTGTGAGGG 0: 1
1: 0
2: 4
3: 29
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049740921 Original CRISPR CCCCATGTGCTGTGGCTGCA GGG (reversed) Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
901396748 1:8987354-8987376 CCCAAAGTGCTGTGGTTACAGGG - Intergenic
901430615 1:9211806-9211828 CCTCATGTGCTGAGGCTCGAAGG - Intergenic
902917143 1:19645632-19645654 CCCCAGATGCTGGGGCTGCTTGG + Intronic
905484596 1:38286347-38286369 CTGGCTGTGCTGTGGCTGCAGGG + Intergenic
905632788 1:39527936-39527958 CCCCAAGTCCTATGGCAGCAGGG - Intergenic
905752649 1:40479214-40479236 CCCCAGGTCCTGGTGCTGCAGGG + Exonic
906145575 1:43558342-43558364 GCCCAACTGCTGTGGCTCCAGGG + Intronic
906149907 1:43581628-43581650 CCCCAGGCGCTGGGGCTGAAGGG - Intronic
909083677 1:71146774-71146796 CACCATGTCCTGAGGCTGCATGG - Intergenic
912558932 1:110536553-110536575 GGCCATGTCCTGTGACTGCATGG - Intergenic
916479514 1:165202334-165202356 CCCCATGTACAATGGCTGCTGGG + Exonic
917274974 1:173322306-173322328 CCCCATGTGCATTAGCTGTAAGG + Intergenic
920502938 1:206496900-206496922 CTCCCTGGGCTGTGTCTGCAAGG + Intronic
921032706 1:211347677-211347699 TCACATGTGCTGTGTCTGCCAGG + Intronic
922239623 1:223747195-223747217 CCCCATCTGCTCTTGCTGAAGGG + Intronic
1062816612 10:505688-505710 CCCCATCTCCTGTGGCGTCAGGG - Intronic
1063663161 10:8047571-8047593 CCCCTTTTGCTTTGGCTGCTGGG + Intergenic
1064020609 10:11805631-11805653 GCCCACGTGCTGTGCTTGCAGGG + Intergenic
1064991377 10:21259733-21259755 CCCCACGTGCGATGGCTTCAGGG + Intergenic
1068252066 10:54455807-54455829 CACCATGTCCTGAGGCTGCATGG - Intronic
1071458142 10:85867162-85867184 CCCCTTTTGCTGTGGGTGAAAGG - Intronic
1072952708 10:99861857-99861879 CCCCAGGGGCCGAGGCTGCAGGG - Intergenic
1075731349 10:124638609-124638631 CTCCTTGTGCTGTGTCTGCCTGG - Intronic
1075752531 10:124784987-124785009 CCCAAAGTGCTGGGGGTGCAGGG - Intronic
1076054448 10:127360296-127360318 CCCCATATCCTGTGGGTGCGTGG - Intronic
1077530473 11:3092544-3092566 TCCCAGGGGCTGTGGCTGGAGGG + Exonic
1079111608 11:17608172-17608194 CCCCATTTGCTTTCCCTGCATGG + Intronic
1080792991 11:35537893-35537915 CTCTATGTGGTGTGACTGCAGGG - Intergenic
1083240523 11:61384639-61384661 CCCCATGTGCTTGGAGTGCATGG + Intergenic
1083638687 11:64133799-64133821 CAGCAGGTGCTGGGGCTGCAAGG - Intronic
1083708242 11:64531240-64531262 CCCCATAGGCTGTAGCTGCTTGG + Intergenic
1084466865 11:69328379-69328401 CCCCCTGTCCCGTGGCTACAGGG + Intronic
1084509380 11:69593683-69593705 CCCCATGGGCTGTGGAAGGAGGG - Intergenic
1084557468 11:69883579-69883601 TCCCATGAGCTGTGGCCGCCAGG + Intergenic
1084564313 11:69920651-69920673 CCTCAGCTGCTGGGGCTGCAGGG + Intergenic
1085153190 11:74268443-74268465 CCCCAGGTCCTGGGGCTGCAGGG + Intronic
1085466740 11:76729142-76729164 CCTCATGTCCTGTAGGTGCAGGG - Intergenic
1085861798 11:80244082-80244104 CACCAAGTCCTGAGGCTGCAGGG - Intergenic
1089016429 11:115168928-115168950 ACCCATGTGCTGGGACTGTAGGG + Intergenic
1089632411 11:119791948-119791970 CCCCATCTCCTGTGGCTGTGTGG + Intergenic
1089648661 11:119897275-119897297 TCCTATGTGCTGTGGAGGCAAGG + Intergenic
1090063762 11:123486286-123486308 CCCCAAGTGCTGGGATTGCAGGG - Intergenic
1092924160 12:13258578-13258600 CCCCATTTGGTTTGGCTCCAAGG - Intergenic
1094829475 12:34293456-34293478 ACCCATATGCAGTGGCTGCTGGG + Intergenic
1095765646 12:45891810-45891832 CTCCATGTTCAGTTGCTGCATGG - Exonic
1096510097 12:52122958-52122980 CCCAGTGTGCTCTAGCTGCAGGG - Intergenic
1096511413 12:52131740-52131762 CAGCATGTGCTGAGACTGCATGG + Intergenic
1098446742 12:70573762-70573784 CCCAAAGTGCTGGGGATGCATGG + Intronic
1098695590 12:73550236-73550258 CTCCCTGTACTGGGGCTGCAGGG + Intergenic
1099267940 12:80471266-80471288 CACCATTTGGGGTGGCTGCAGGG + Intronic
1101380206 12:104207789-104207811 CCACAGGTGATGTGGCTTCACGG + Intergenic
1101448504 12:104755524-104755546 CCCAAAGTGCTGAGACTGCAGGG - Intronic
1102435571 12:112920332-112920354 CTACATGTGCTGTGAGTGCAAGG + Intronic
1103814849 12:123646519-123646541 CCCCAAGTGCTGGGACTGCAGGG + Intronic
1104840927 12:131825263-131825285 CCTCATGTGCTGTGGCCCCACGG + Intergenic
1107476924 13:40745946-40745968 TCCCTTGTGCTTTGCCTGCATGG - Intronic
1108572096 13:51761788-51761810 TTCCATGTACCGTGGCTGCATGG - Exonic
1108779146 13:53806731-53806753 TCTCATGTGCTGTGGCTCCAAGG - Intergenic
1109591118 13:64483985-64484007 CTCCACGTGTTGTGTCTGCATGG - Intergenic
1110232213 13:73178853-73178875 CCACATGTGTGGTGTCTGCAGGG - Intergenic
1112199081 13:97257951-97257973 CACCCTGTGCTGTGTCTCCATGG - Intronic
1113767760 13:112891628-112891650 CCGCAGGAGCTGAGGCTGCAGGG - Intergenic
1113864579 13:113512633-113512655 CCCCAGGTGCTGGGACTGGAAGG + Intronic
1113864607 13:113512769-113512791 CCCCAGGTGCTGGGACTGGAAGG + Intronic
1113864624 13:113512837-113512859 CCCCAGGTGCTGGGACTGGAAGG + Intronic
1114663564 14:24366303-24366325 CTGCATGTGCTGTGCCTGCGGGG + Intronic
1117694149 14:58341380-58341402 GCCCATTTGCTGTAGCTCCAGGG + Intronic
1118617578 14:67585279-67585301 TCCAGTGTGCTGTGGCAGCATGG + Intronic
1120155387 14:81087806-81087828 CCCCAGGGGCTGTAGCTGCCAGG - Intronic
1120413775 14:84193784-84193806 CACCATGTCTTGAGGCTGCATGG - Intergenic
1120818834 14:88893029-88893051 TCCCATCAGCTGTGGCTGGAGGG - Intergenic
1121112568 14:91322211-91322233 CCCCAGGGGCTGTGGGTACAGGG + Intronic
1121318768 14:92978591-92978613 TGCCATGTCCTGAGGCTGCATGG - Intronic
1121520840 14:94585292-94585314 GCCCAACTGCTGTGGCTGCTGGG + Intronic
1121691963 14:95884371-95884393 CCCCAGGTCCTGTGGCTCCTTGG - Intergenic
1121804407 14:96803428-96803450 CCCAAAGTGCTGGGACTGCAGGG + Intronic
1122483020 14:102059975-102059997 CCCAATGTGCTGGGGCTAAAGGG + Intergenic
1122890069 14:104728123-104728145 GCCCCTGTGCTGTGGCTGTTGGG + Intronic
1122930623 14:104931642-104931664 CCCCATGTGGTGTGGAGGGAGGG - Intronic
1123014519 14:105367424-105367446 CCCGATGTGCCATGGCTGGAAGG - Intronic
1123041644 14:105492645-105492667 CGCCATGTGCAGTGGCTGATGGG + Exonic
1123100320 14:105793321-105793343 CCCCATGTGACCAGGCTGCAGGG - Intergenic
1123760295 15:23426653-23426675 CCCCATGTGCAGTGAGAGCAAGG - Intergenic
1124054758 15:26232010-26232032 CCCCTTGGGCTGTAGCTGTAGGG - Intergenic
1124319554 15:28702899-28702921 CCCCAGGCCCTGGGGCTGCAGGG + Intronic
1125723007 15:41854056-41854078 GCGCCTGTGCTGTTGCTGCAGGG + Exonic
1126270823 15:46815060-46815082 CCTTATGTCCTGTAGCTGCAAGG - Intergenic
1128303278 15:66580826-66580848 CCCCCTGGGCTTTGGCTGCCTGG + Intergenic
1128314486 15:66652085-66652107 GCCCAGGTGCTGAGGCAGCAGGG + Intronic
1129148553 15:73671788-73671810 CTCCCCGTGCTGTGGCTCCAAGG + Intergenic
1131996225 15:98135443-98135465 CCCCATGTGCTGAAGCACCAGGG + Intergenic
1132696259 16:1203358-1203380 GCCTGTGTGCTGTGGCTGCTGGG + Intronic
1132756574 16:1488164-1488186 CCCCACGTGGTGCAGCTGCATGG - Intronic
1133722606 16:8508857-8508879 TTCCATGTTCTGTGGCTTCATGG + Intergenic
1134327556 16:13220890-13220912 CCCCCTTTGTTGTGGCTGCCAGG - Intronic
1138427775 16:56947673-56947695 CCCTATCTCCTGTAGCTGCAGGG + Intergenic
1138972551 16:62163360-62163382 CCCAAAGTGCTGGGTCTGCATGG - Intergenic
1139422856 16:66859632-66859654 CCCCATGGCCTGTGGATGTAAGG - Intronic
1140064188 16:71596177-71596199 CCCAATGTGCTGGGGTTACAGGG - Intergenic
1141862312 16:86726260-86726282 ACCCATGTTGTGGGGCTGCATGG - Intergenic
1142033241 16:87848782-87848804 CCCCATGAGCTCTGGATGCGGGG + Intronic
1142110061 16:88326603-88326625 CTCCATGTGAGGTGGCTGGAGGG - Intergenic
1142592177 17:1011066-1011088 GGCCATCTGCTGTGGCTGCTTGG + Intronic
1143361455 17:6374942-6374964 TCCCCTGTGCTGGGACTGCATGG - Intergenic
1143456315 17:7070152-7070174 TCCCCTGTGCTGTAGCTCCAGGG - Intergenic
1143508718 17:7383814-7383836 CCACACGTGCTGCGTCTGCACGG + Exonic
1144022927 17:11252766-11252788 CCACATGCCCTGTCGCTGCAGGG - Intronic
1144032189 17:11333007-11333029 CTCCCTGTGCGGTGGCTGCCAGG + Intronic
1144482647 17:15640315-15640337 GCCCATGGGCTGTGGCTGTGTGG + Intronic
1144916040 17:18724717-18724739 GCCCATGGGCTGTGGCTGTGTGG - Intronic
1145035708 17:19539168-19539190 CCCCAAGTGCTGCGATTGCAGGG + Intronic
1145990211 17:29074719-29074741 CCCCAGGGCCTGTGGCTGCCTGG - Exonic
1146578536 17:34015166-34015188 CCCCAAGTGCTGGGACTACAGGG + Intronic
1147688490 17:42300993-42301015 CTCCAGTTGCTGTGGCTGCTAGG + Intronic
1150143585 17:62750236-62750258 ACCCCTGTGCTGTGCCTTCAGGG - Intronic
1151181495 17:72332258-72332280 CCCCAAGTGCTGAGTCTTCAGGG + Intergenic
1151747341 17:76018584-76018606 CCCCAGGTGCAGCTGCTGCAGGG - Exonic
1151925419 17:77192510-77192532 CCCCAGGGGCTTTGGCTCCAAGG + Intronic
1152804475 17:82348560-82348582 CCCCAGGGCCTGGGGCTGCAGGG + Intergenic
1154406935 18:14101108-14101130 CCCCTTGTGCTGTGGAGGGATGG + Intronic
1154423901 18:14257638-14257660 CCCCATGGTCTGTGACAGCAAGG - Intergenic
1155939896 18:31792493-31792515 CACCATGTGATGTGGCTTCACGG + Intergenic
1156188762 18:34694858-34694880 GCTCATTTGCTGTGGCTGAATGG - Intronic
1156461870 18:37325789-37325811 CCCCAGGAGCCATGGCTGCATGG - Intronic
1158624988 18:59063250-59063272 CTCAAGGTGCTGTGGCTGGAAGG - Intergenic
1159102902 18:63974863-63974885 GCACATGTATTGTGGCTGCAGGG + Intronic
1160147513 18:76377183-76377205 GCCCATGTGCTCTGGGTGGACGG - Intronic
1160475924 18:79187632-79187654 CCCCCTGTGCTGCTGCTGAATGG + Intronic
1160866353 19:1257975-1257997 CCCCATGGGGTTTGGGTGCAGGG + Exonic
1161070187 19:2256101-2256123 CCCCATGGCCTCTGGCTGCTGGG + Intronic
1164436285 19:28232703-28232725 TCCCATGTGGTGTGTGTGCAGGG + Intergenic
1164639743 19:29815514-29815536 CACCATGTGCTGTGTCTTCGAGG + Intronic
1164988645 19:32668421-32668443 CCCAATGTGCTGGGGTTACAAGG + Intronic
1164996166 19:32721055-32721077 ACCCATGGGCTGGGGCTGCCCGG - Intronic
1165277690 19:34769302-34769324 CACAACGTGCTGAGGCTGCAGGG + Intronic
1167397642 19:49241728-49241750 CACCCTGTGCCCTGGCTGCAGGG - Intergenic
925176588 2:1788778-1788800 CCCCAAGTGTGGTGGCTGCAGGG + Intergenic
925216307 2:2098616-2098638 CCCCCTGCCCTGTGTCTGCAGGG - Intronic
925654964 2:6136762-6136784 CCCCATGTGTTGTGGGAGGAGGG + Intergenic
926911971 2:17859688-17859710 TCCCATGTGAGGTGCCTGCAAGG + Intergenic
927110029 2:19858057-19858079 CCCCATCAGCTGTGCATGCAAGG + Intergenic
927185050 2:20476104-20476126 CACCATGTGATGTGCCTGCTTGG - Intergenic
927685248 2:25166151-25166173 CCCCAGGCGCTGGGCCTGCACGG + Intronic
929023352 2:37575803-37575825 GCCCAGGTGCTGTGGCTGGAGGG - Intergenic
929261864 2:39874957-39874979 CCCAAAGTGCTGGGACTGCAGGG + Intergenic
929430183 2:41879842-41879864 TCCCAGGACCTGTGGCTGCAGGG - Intergenic
931432557 2:62219878-62219900 AGCCATGTGCTGAGTCTGCAGGG + Intronic
933539404 2:83619292-83619314 TGCCATGTACTGAGGCTGCACGG + Intergenic
934769872 2:96900807-96900829 TCCCAGGTGCTGTGACTGCAAGG - Intronic
935651541 2:105386360-105386382 GCCCATCGGCTGTGACTGCAAGG - Exonic
935717995 2:105955357-105955379 CCTCCTGTGCTGTGGGTGGAAGG - Intergenic
938574324 2:132589812-132589834 CCCCAGGTCCTGTAGCAGCAGGG - Intronic
938765113 2:134455709-134455731 CCCCATGTGTTGGTGCCGCACGG + Intergenic
939911594 2:147989954-147989976 CCCCATCTGCTGGAGCTGTAAGG - Intronic
940728818 2:157366214-157366236 CCCTTTGTGCTGTGGCTAAATGG - Intergenic
941813384 2:169776495-169776517 TCCTATTTTCTGTGGCTGCACGG - Intronic
943357308 2:186872698-186872720 CACCATCTGCTGTGGGTACATGG + Intergenic
944536363 2:200714052-200714074 CTCTATGTCCTGTGGATGCAGGG + Intergenic
944880793 2:204011080-204011102 CCCCATCCCATGTGGCTGCAGGG + Intergenic
947119319 2:226799478-226799500 CCCCAGCTGCAGTGGCTGCCCGG - Exonic
948031111 2:234818390-234818412 CCCCACGTGCTGTGTCTTCATGG + Intergenic
948167605 2:235875111-235875133 CCCCATCTGCCCTTGCTGCAAGG + Intronic
948586497 2:239023314-239023336 CCCCCTTTGCTGTGACTGCTGGG + Intergenic
948888830 2:240897101-240897123 GCCCACGTGCGGTGGCTACAGGG - Intergenic
948953823 2:241272389-241272411 CCCCTGGTGCCGTGGCCGCACGG - Intronic
1170121447 20:12916845-12916867 CCCTGTGAACTGTGGCTGCAAGG + Intergenic
1172045915 20:32079982-32080004 AACCAGGTGCTGTGGCTGCCAGG + Intronic
1172109636 20:32537334-32537356 CCACATCTGCTGTGGCTCCGGGG + Intronic
1173972129 20:47161217-47161239 CCCCATGTGCAGAGGCTACTGGG - Intronic
1174364599 20:50048754-50048776 CTCTATGTGATGTGGCTACATGG + Intergenic
1175373813 20:58511006-58511028 CCCTCTGTGCTGTCCCTGCAGGG - Intronic
1175681749 20:60994480-60994502 CCCCATGTTCTCTGTCTCCATGG - Intergenic
1175989282 20:62779434-62779456 CCTCAAGTGCTGTTGTTGCAGGG - Intergenic
1176108187 20:63399263-63399285 CACCATGAGCTGGGCCTGCAGGG - Intergenic
1179820411 21:43933955-43933977 CCCCATGTGCTGTCACTGTGTGG + Intronic
1179944204 21:44659659-44659681 CCCAATGTGCTGGGGTTACAGGG - Intronic
1180701005 22:17781429-17781451 CCCCAGGAACTGGGGCTGCAGGG + Intergenic
1181045154 22:20210852-20210874 CCCCATGTGCTGGGGTGGCCAGG + Intergenic
1181169146 22:20998504-20998526 CCCAAGGAGCTGTGGCTTCATGG - Exonic
1181443927 22:22953809-22953831 ACCCATGTACTGTGGCTCCTGGG - Intergenic
1182384345 22:29923461-29923483 CCCAAAGTGCTGGGACTGCAGGG + Intronic
1183369275 22:37423286-37423308 CGCCCTTTGCTTTGGCTGCAAGG - Intronic
1183774966 22:39958081-39958103 CCCCATGGGCTGTAGCTCCCAGG + Intronic
1184266394 22:43349149-43349171 CTCCACGTGGTGTGGCTACAAGG - Intergenic
1185292741 22:50035319-50035341 CCCGATGTCCTGTGTCTTCAGGG - Intronic
949263282 3:2127231-2127253 CCCAATGTGCTGTGGGTGAAGGG + Intronic
949397206 3:3627323-3627345 CTCCCTCTGCTGTTGCTGCAGGG + Intergenic
950534832 3:13572707-13572729 CCCCATGAGCTGTGGCGAGAAGG + Intronic
952141136 3:30480340-30480362 CACCATGTCCTGAGGCTGCATGG - Intergenic
953108257 3:39907093-39907115 CCCCATGGACTGTGTCTGCTTGG + Intronic
953421753 3:42759059-42759081 CCCAAAGTGCTGTGATTGCAAGG - Intronic
953564116 3:44016514-44016536 CTCCATGTTCTGTGGCTTCTTGG + Intergenic
954303910 3:49715590-49715612 CGCCATGTGCTGCTGCAGCAGGG - Exonic
954385223 3:50240570-50240592 CCCCATAACCTGTGGCTGCAGGG - Intronic
954881227 3:53837348-53837370 CCCCTTGTGCCCTGGCTGCTCGG + Intronic
958655080 3:96991112-96991134 CCCAAAGTGCTGTGATTGCAGGG + Intronic
959944947 3:112116198-112116220 CCCCCTGTGTTGTGTCTGCTTGG + Intronic
960538471 3:118839293-118839315 CACCATGTCCTGAGGCTGCACGG + Intergenic
961588898 3:127960091-127960113 CCCAATGTCCTCTGCCTGCAGGG - Intronic
962383260 3:134913531-134913553 TCCCAAGTGCTGTGGATGCGAGG + Intronic
962957077 3:140276143-140276165 CCCCATGAGGTGTAGCTCCATGG + Intronic
963657522 3:148076043-148076065 TGCCATATGCTGTGGCTGGAGGG - Intergenic
964891397 3:161540364-161540386 CCGCATGTGCTGAGGCTGAGGGG - Intergenic
968451654 4:678823-678845 CCCCATGTGGGCTGGCTCCAGGG + Intronic
968491006 4:890459-890481 CCCAATGTGCTGCGGGTGCCCGG + Intronic
968761400 4:2444236-2444258 CCCCATGGCCTGGGCCTGCAGGG + Intronic
968887129 4:3341087-3341109 ACCCAGGGGCTGTGGCTGCCGGG - Intronic
969463266 4:7340060-7340082 GCCCAGGTGCTGGGGCTGCCAGG + Intronic
972356375 4:38282694-38282716 CGCCATGTCCTCTGGCTGAATGG - Intergenic
975268164 4:72395842-72395864 ACGCATGTGCTGTGGATACATGG + Intronic
976286832 4:83378718-83378740 TCCCATGTACAGTGTCTGCAGGG - Intergenic
982171610 4:152667127-152667149 CCCCATCTGCTGTGTGTGGAAGG + Intronic
985848398 5:2371052-2371074 CTCCATGTGGTGTGGCTCCAGGG - Intergenic
988064618 5:26218605-26218627 CCCCAAGTCCAGTGGCTCCAGGG - Intergenic
988491088 5:31706265-31706287 CTCCATGTGCTTTGTCTACAAGG - Intronic
988843003 5:35101437-35101459 CCCACTGAGATGTGGCTGCAAGG + Intronic
991996894 5:72396582-72396604 CCCCTTGTGTTATGGATGCAGGG + Intergenic
992320895 5:75612025-75612047 CACCATGTACTGTGGGTGGAAGG + Intronic
997580292 5:135012668-135012690 GCCCCTGTCCTGTGGCTTCAGGG - Intergenic
997707958 5:135976440-135976462 CTCCTTGTGCTGTGGCTCCTGGG - Intergenic
998453118 5:142249925-142249947 CTCCAAGTGCTGGTGCTGCAGGG + Intergenic
998907522 5:146922519-146922541 CCCCATGTGCTGTGGAGTCTAGG - Intronic
999083942 5:148870576-148870598 CTCCATGTGCTGTAACTGGAAGG - Intergenic
999198929 5:149802457-149802479 CCCCATCTGTTGTGGCCCCATGG + Intronic
999271072 5:150296711-150296733 CCCCAAGCGCTGTGGGTGGAGGG - Exonic
999361200 5:150988195-150988217 ACCCAGGAGCTATGGCTGCAGGG - Intergenic
1000304535 5:159983419-159983441 CCCCATGTGTTCTGGCACCACGG + Intergenic
1004911773 6:20292702-20292724 CCCCAGTTGCTGTGGCATCAGGG + Intergenic
1005148082 6:22715309-22715331 ATACATGTGCTGTGGCTTCAAGG + Intergenic
1005494909 6:26379930-26379952 GTCCATGTGGTGAGGCTGCAGGG - Intergenic
1005499346 6:26416518-26416540 GTCCATGTGGTGAGGCTGCAGGG - Intergenic
1005504133 6:26455343-26455365 GTCCATGTGGTGAGGCTGCAGGG - Intergenic
1005982112 6:30844455-30844477 CCCCATGTGCTGAGTCTTCTGGG - Intergenic
1007649385 6:43408753-43408775 CCCCAAGTGCTGGGATTGCAGGG - Intergenic
1008064517 6:47033137-47033159 CACCTTGTGCTGTGGCTGCTGGG + Intronic
1009554786 6:65148958-65148980 AACCATGTCCTGAGGCTGCACGG + Intronic
1010049152 6:71482975-71482997 CTGCATGTGCTGTGACTGAATGG - Intergenic
1010350329 6:74866477-74866499 TGACATGTGCTGTGGCTACATGG - Intergenic
1013399753 6:109781349-109781371 CCTCATATGCTGTGGTTTCAAGG + Intronic
1013418691 6:109947161-109947183 CACCAGGTGCTGTAGCTGGAAGG + Intergenic
1013497100 6:110708373-110708395 TCCTATGTGCTGCAGCTGCAGGG - Intronic
1015840560 6:137472208-137472230 CACCATCTGCTGTGGCTGGGGGG + Intergenic
1016130266 6:140459565-140459587 CCCCATGTGTTATGGCTTAAAGG + Intergenic
1018235707 6:161721668-161721690 CCCCCCGTGCTGGGGCTGCGTGG + Intronic
1019327861 7:446960-446982 CCACATGAGCTGGGGCAGCAGGG - Intergenic
1019696129 7:2447040-2447062 CCTGATGTGCTGAGGGTGCAGGG + Intergenic
1019938145 7:4269664-4269686 CCCTAAGTGCTGGGACTGCAGGG + Intergenic
1021495627 7:21271311-21271333 CCCCAGTAGCTGTGGCTACAGGG - Intergenic
1023751664 7:43378951-43378973 CCCCATGTTCTATGTCTGGAAGG - Intronic
1023864254 7:44231403-44231425 CCTCATGTGTTGGGGATGCAGGG - Intronic
1024178508 7:46864218-46864240 TCCCATGCCCTGTGGCTGCCAGG + Intergenic
1027159432 7:75791521-75791543 CCCCATCTGCTGTGGTTCCCAGG + Intergenic
1028660724 7:93269884-93269906 CCCTATTTGCTTTGGCTGCTAGG + Intronic
1029308965 7:99643648-99643670 CCCCATCTGCTGTTGCTCCTTGG - Intergenic
1029630511 7:101747499-101747521 CCCCAGGGGCTGTGGGAGCACGG - Intergenic
1030921866 7:115400741-115400763 CTGCATGTGCTGTGGGTTCAAGG - Intergenic
1032789781 7:135233736-135233758 CCCCATTGGCTGTGGCGGCCAGG + Intronic
1033214322 7:139482976-139482998 CCCCACGTGCTGCCGCTGCAAGG - Exonic
1033220324 7:139523366-139523388 CACCCTCTGCTGTGGCTCCAGGG + Intergenic
1034399529 7:150852837-150852859 CCCCATGTGCAGTGGCAGTGGGG - Intronic
1035270148 7:157714989-157715011 CCCCATGTGCTTTTCCTGAATGG + Intronic
1037971884 8:23177812-23177834 GCCCATGGGCAGGGGCTGCAGGG - Intergenic
1040276836 8:46018177-46018199 CCCCATGTGCTGGGCCCGGAAGG - Intergenic
1040899358 8:52402685-52402707 CGCCAGGTGCAGTGGCAGCAAGG + Intronic
1043083576 8:75798075-75798097 CTCCATCTGCTGTTGCTGGAAGG - Intergenic
1044873151 8:96639887-96639909 CCGCATGTGCTATGGTTGGAGGG + Intergenic
1045224336 8:100229849-100229871 CCACAGGTGGAGTGGCTGCAGGG + Intronic
1045857726 8:106783133-106783155 ACCCAGGTGCTCTGGCTCCAGGG + Intergenic
1048985741 8:139733816-139733838 ACCTCTGTTCTGTGGCTGCAAGG + Intronic
1049122113 8:140748080-140748102 CCCCATGGGTTGTGGCTTCCAGG - Intronic
1049740921 8:144240476-144240498 CCCCATGTGCTGTGGCTGCAGGG - Intronic
1049755564 8:144309952-144309974 CCCCGGGTGCTGTGGGGGCAGGG + Intronic
1051835672 9:21335184-21335206 CGCCACGTACTGTGGCTCCACGG + Exonic
1053139412 9:35673547-35673569 CCCCATGTCCTCTGGCTGAGAGG - Intronic
1053434448 9:38066280-38066302 CCACCTGGGGTGTGGCTGCAGGG + Intronic
1053513336 9:38708230-38708252 CTCCCTGTGCTCTCGCTGCAGGG + Intergenic
1055155621 9:73059468-73059490 CCCCAGGGACTGTGGCTACAAGG - Intronic
1057181805 9:93034649-93034671 CCCCAGGTGCTGCACCTGCAGGG + Exonic
1058425636 9:104873512-104873534 CCCCATGTCCTGTGACTTTAGGG + Intronic
1060267415 9:122120415-122120437 CCCCATTTGCAGTGGATGCAGGG + Intergenic
1060845453 9:126833333-126833355 CACCGTGTGCTCTGTCTGCACGG - Exonic
1061764840 9:132875191-132875213 CAGCATGTTCTGTGGGTGCAGGG + Exonic
1186044968 X:5525883-5525905 CCCCATCAGCTGTGGCACCACGG + Intergenic
1188511178 X:30938029-30938051 CCCCACGTGCTGGGATTGCAGGG + Intronic
1191180958 X:57563178-57563200 CACCATTTTCTATGGCTGCATGG - Intergenic
1191251161 X:58260848-58260870 GCCCCTGTGCTGGGCCTGCAGGG + Intergenic
1193851001 X:86537200-86537222 CCACATGAGCTATGGCTGCGTGG + Intronic
1195097484 X:101517532-101517554 CCCAAAGTGCTGGGACTGCAAGG + Intronic
1199373750 X:147083301-147083323 CGCCATGTCCTGAGGCTGTACGG - Intergenic
1199496754 X:148460680-148460702 CCCCATGGGCTGTGGCAGAATGG - Intergenic
1199523317 X:148762722-148762744 CCCTCTGTGCTCTGGCTGCTAGG + Intronic
1199608717 X:149596040-149596062 CACCAGTTGCTGTGGCTGGAAGG - Intergenic
1199630405 X:149773320-149773342 CACCAGTTGCTGTGGCTGGAAGG + Intergenic
1200122784 X:153798948-153798970 TCCCGTGTGCTGTGCCTTCATGG + Intergenic
1200917770 Y:8586291-8586313 CAGCATGTCCTGAGGCTGCATGG - Intergenic