ID: 1049742820

View in Genome Browser
Species Human (GRCh38)
Location 8:144249178-144249200
Sequence CACCCGAGGAGGGCTGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 398}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049742820_1049742836 21 Left 1049742820 8:144249178-144249200 CCCTGCCCAGCCCTCCTCGGGTG 0: 1
1: 0
2: 1
3: 30
4: 398
Right 1049742836 8:144249222-144249244 CTCTCCCTACAGGACTACCATGG 0: 1
1: 0
2: 0
3: 8
4: 113
1049742820_1049742831 11 Left 1049742820 8:144249178-144249200 CCCTGCCCAGCCCTCCTCGGGTG 0: 1
1: 0
2: 1
3: 30
4: 398
Right 1049742831 8:144249212-144249234 GCTCTGCCCCCTCTCCCTACAGG 0: 1
1: 0
2: 5
3: 39
4: 393

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049742820 Original CRISPR CACCCGAGGAGGGCTGGGCA GGG (reversed) Intronic
900175984 1:1291558-1291580 CAGCCGAAGAGAGCTGGGCTGGG + Exonic
900347561 1:2216875-2216897 CACCCGAGGCCACCTGGGCACGG + Intergenic
900379144 1:2375284-2375306 CACCCAGGGAGGGCCGGGCAGGG - Intronic
900579100 1:3399560-3399582 CATCCGTGGAGGGCTGGGGTTGG + Intronic
900621849 1:3591144-3591166 CATGCGAGGAGGGCGGGGCGCGG - Intronic
901492051 1:9601656-9601678 CACCCGCTGTGGGCTGGGCCGGG + Intronic
901635541 1:10668542-10668564 CTGCCGAGGTGGGCTGGGCCGGG + Intronic
901796330 1:11681426-11681448 CGCCGGAAGAGGGCTGGGGAGGG + Exonic
901843369 1:11966977-11966999 CATCCGGGCAGGGCTGGGGAGGG - Exonic
902338057 1:15765135-15765157 CACCCGAGGCTGGCTTGGCGGGG + Exonic
902451318 1:16498771-16498793 CACACTAGGAGGGCAGTGCAGGG + Intergenic
902501554 1:16914511-16914533 CACACGAGGAGGGCAGTGCAGGG - Intronic
902563042 1:17289960-17289982 GACCTGAGCAGGGCTGGGCAGGG + Intergenic
902811391 1:18889970-18889992 CACCCGAGAGGTGCAGGGCATGG - Intronic
904012029 1:27395448-27395470 AACCCGAGGAGGGCAGGCCTGGG - Exonic
904051199 1:27640034-27640056 CACCAGAGGATTGCTGGGCCTGG - Intergenic
904724987 1:32539964-32539986 CGCGCGGGGAGGGCAGGGCAGGG + Intronic
906520916 1:46466512-46466534 GGCCCGAGGAGGGCGGGGCGGGG - Intergenic
907046849 1:51304867-51304889 CACCCTGGGAGGGCCAGGCAGGG + Intronic
907426817 1:54384998-54385020 CTCCAGAGTAGGCCTGGGCAGGG + Intronic
908605813 1:65795780-65795802 CACCTGAGGAAGGATGGGGAAGG - Intronic
910674281 1:89801187-89801209 CATCACAGCAGGGCTGGGCATGG - Intronic
911024389 1:93421604-93421626 GACTCAAGAAGGGCTGGGCACGG - Intergenic
912265549 1:108153486-108153508 CACTCGAGGGAGGCTGGACAGGG + Intronic
912570956 1:110620528-110620550 CCAGAGAGGAGGGCTGGGCAGGG + Intronic
915457628 1:156051215-156051237 CAGAGGTGGAGGGCTGGGCAGGG + Exonic
915468226 1:156110552-156110574 AACCCTGAGAGGGCTGGGCATGG + Intronic
915552252 1:156642046-156642068 GCCCCGGGGAGGGCGGGGCAGGG + Exonic
915849560 1:159306667-159306689 CAGCTTAGGAGGGCTGGGAAAGG + Intronic
916148310 1:161761311-161761333 TACTCCAGGAAGGCTGGGCAAGG + Intergenic
917456873 1:175193034-175193056 CACCCGAGGTGGGCTGGCCCAGG - Intergenic
920683463 1:208090853-208090875 CACCATGGGAGGCCTGGGCAGGG - Intronic
922423017 1:225471925-225471947 CACCCGAGGAGAGCCAAGCAGGG + Intergenic
922661242 1:227432299-227432321 TCCCTAAGGAGGGCTGGGCATGG + Intergenic
922671206 1:227509845-227509867 CACCTGGGCTGGGCTGGGCAAGG - Intergenic
922768087 1:228166270-228166292 CACCCGGGGAGGGCCGGGATGGG + Intronic
923698854 1:236281586-236281608 GACGCGGGGAGGGCCGGGCAGGG - Intronic
924544813 1:245016484-245016506 GACACGAGGAGTGCTGGGCGTGG - Intronic
1063140387 10:3251454-3251476 CTCCTGGGGAGGGCTGGACATGG + Intergenic
1063390214 10:5645461-5645483 CAAAGGAGGAGGGCTGGGGAGGG - Intronic
1067944026 10:50679329-50679351 CACCAGAGGTGTGCTGGGGAAGG - Intergenic
1068129429 10:52879057-52879079 TACCTTGGGAGGGCTGGGCATGG + Intergenic
1068225083 10:54097846-54097868 CACCTCAGGAGGGGAGGGCATGG + Intronic
1070162314 10:73873934-73873956 CACCCGCGGGGGGCGGGGCCGGG + Intronic
1070649300 10:78223178-78223200 CCCCGGAGGGGTGCTGGGCAAGG - Intergenic
1070720417 10:78753046-78753068 CAGCCAAGGAGTGCTGAGCATGG - Intergenic
1070865519 10:79706198-79706220 CACCAGAGGTGTGCTGGGGAAGG - Exonic
1070879313 10:79844329-79844351 CACCAGAGGTGTGCTGGGGAAGG - Exonic
1070913228 10:80136145-80136167 CCCCAGAGGAGGGCTCGGCTGGG - Intronic
1071154463 10:82673039-82673061 AACCCATGAAGGGCTGGGCACGG - Intronic
1071453666 10:85824500-85824522 CAACCAAAAAGGGCTGGGCATGG - Intronic
1071518487 10:86314728-86314750 CATCTGAGGAGTGCTGGGAAAGG - Intronic
1071632419 10:87228419-87228441 CACCAGAGGTGTGCTGGGGAGGG - Exonic
1072191757 10:93081599-93081621 GACCCGGGGAGGACTGGGGAAGG - Intergenic
1072418704 10:95271144-95271166 AATCAGAGGGGGGCTGGGCACGG + Intronic
1074143670 10:110698323-110698345 CACAGGAGGTGGGCTGGGAAGGG + Intronic
1074610590 10:115017386-115017408 GAGCTGAGGGGGGCTGGGCATGG + Intergenic
1075004192 10:118818716-118818738 CTCCCGGGAAGGCCTGGGCACGG - Intergenic
1075187485 10:120276087-120276109 CAACCGAAGAGGACTGGCCAAGG + Intergenic
1075558317 10:123449306-123449328 CAGGTGAGGAGGGCAGGGCAGGG - Intergenic
1075566304 10:123506984-123507006 ATCCAGGGGAGGGCTGGGCATGG - Intergenic
1076406092 10:130213420-130213442 CACCAAATGAGGGCGGGGCAGGG + Intergenic
1077035619 11:493076-493098 TTCCCGAGGAGGGCGAGGCAGGG + Intergenic
1077147099 11:1051222-1051244 GCCCGGAGGAGGGCTGGGCAAGG - Intergenic
1077218600 11:1405391-1405413 CACAGGGGGAAGGCTGGGCAAGG - Intronic
1077324298 11:1957095-1957117 AACCCGAGAAGGGCCGGGAAGGG + Intronic
1077498712 11:2899197-2899219 GACCCTGGGAGCGCTGGGCAGGG - Intronic
1077620922 11:3722534-3722556 CACCCAAAATGGGCTGGGCATGG + Intronic
1078095116 11:8291948-8291970 GTCAAGAGGAGGGCTGGGCATGG + Intergenic
1078232129 11:9453261-9453283 AACAGGAGTAGGGCTGGGCATGG + Intergenic
1078451084 11:11441442-11441464 CACCTGGGCAGGGCTGGGCAGGG + Intronic
1080706575 11:34701251-34701273 CAGCAGAGGAGGCCTGGGCAGGG + Intergenic
1081460707 11:43270112-43270134 AACCTGAAGTGGGCTGGGCATGG + Intergenic
1083044666 11:59723289-59723311 CATCTGGGGAGGGTTGGGCATGG + Intronic
1083236534 11:61354374-61354396 AAAGGGAGGAGGGCTGGGCACGG + Intronic
1083680250 11:64348409-64348431 GCCCGGAGGAGGGCAGGGCAGGG + Intronic
1083768258 11:64852589-64852611 CAGCAGAGCAGGACTGGGCAGGG + Exonic
1083891030 11:65595818-65595840 CACCTGGGAGGGGCTGGGCAGGG + Exonic
1084184313 11:67463680-67463702 GACCCCAGGATGGCCGGGCACGG - Exonic
1084214784 11:67641437-67641459 CAGCCGGGGAGGGGTGTGCAGGG - Intergenic
1084518081 11:69647082-69647104 CACCCCTGGAGGACTGGGCCGGG - Intronic
1084649443 11:70480148-70480170 CAGATGAGGAGGGCTGGGCAGGG - Intronic
1086087176 11:82967245-82967267 CACATGGTGAGGGCTGGGCATGG - Intronic
1087027207 11:93661574-93661596 CCCCCGAGGAAGGCGGGACAGGG + Intergenic
1087163345 11:94973228-94973250 CACCCCTGCAGTGCTGGGCACGG - Intronic
1088581897 11:111324751-111324773 CATCCCAGGAGGGCTGGGTGAGG + Intergenic
1089170521 11:116508331-116508353 CACCAGTGGTGGGCTGGGCCAGG + Intergenic
1089311310 11:117559985-117560007 CACCCAAGGAGCTCTGGGCAGGG - Intronic
1089347802 11:117802271-117802293 GACCAGAGGAGGCCTGGTCAGGG - Intronic
1089365657 11:117919481-117919503 CACCCCAGGAGGGAAGGGCAGGG - Intronic
1089450435 11:118591679-118591701 AAACCCAGAAGGGCTGGGCATGG - Intronic
1089465433 11:118682190-118682212 CATCACAAGAGGGCTGGGCATGG - Intergenic
1089513838 11:119018963-119018985 CATCCGAGGTGGGCTAGGCTCGG + Exonic
1089618876 11:119711097-119711119 CACGGGAGGCTGGCTGGGCACGG + Intronic
1090187041 11:124745765-124745787 CTCCTGGGGAGGGCTGGGGAAGG - Intronic
1091045045 11:132317885-132317907 TCCCCCAGGAGGGCTGGGAAGGG + Intronic
1202807284 11_KI270721v1_random:12290-12312 AACCCGAGAAGGGCCGGGAAGGG + Intergenic
1091490798 12:931035-931057 CATCCGAAGGGGCCTGGGCATGG - Intronic
1091853217 12:3717759-3717781 CAGCTGTGGAGGGCTGGGCCTGG + Intronic
1093938969 12:25031950-25031972 CACACAAGGACGGCTGGGCGTGG - Intronic
1094701326 12:32873386-32873408 CACAAGAGCAGGGCCGGGCATGG - Intronic
1096262875 12:50103936-50103958 CACCCCTGGAGGGCGGGGCTTGG + Exonic
1097976953 12:65696729-65696751 CACTAGAGCAGGGGTGGGCATGG + Intergenic
1102683144 12:114704111-114704133 TGCCCAAGGAGGGCTGGGCAGGG + Intergenic
1103487374 12:121292417-121292439 AAATTGAGGAGGGCTGGGCACGG - Intronic
1103825841 12:123737255-123737277 CACTGGAGGAGGGCTCGGTAAGG + Exonic
1103917969 12:124385645-124385667 CACCCCAGGAGGCATGGGCCAGG - Intronic
1105393372 13:20003937-20003959 CAGCAGAAGAGGGCTGGGCATGG - Intronic
1114262947 14:21051908-21051930 TACCCCAGGAGGGCTGAGCGAGG - Intronic
1114476009 14:22995387-22995409 AACACTAGGAAGGCTGGGCATGG + Intronic
1114954126 14:27796361-27796383 CACATGGGAAGGGCTGGGCACGG - Intergenic
1115200136 14:30844152-30844174 AACAAAAGGAGGGCTGGGCATGG - Intergenic
1116833146 14:49742377-49742399 TTCCCGGGGAGGGCTGGGCGTGG + Intronic
1118319117 14:64743043-64743065 CAGCCGAGGAGGGCTTGGGAGGG - Exonic
1119480242 14:74954277-74954299 CAGCCAAGGCGGGCTGTGCAGGG - Intronic
1119849832 14:77859255-77859277 CATCCGAGAAGATCTGGGCAAGG + Exonic
1121008918 14:90508562-90508584 CACCAGAGGAAGGCAGGGCCCGG - Intergenic
1122267001 14:100551226-100551248 CACCCTAGCAGGGCCGGGCCGGG - Intronic
1122424657 14:101598883-101598905 CCCTGGAGGAAGGCTGGGCAGGG - Intergenic
1122809980 14:104283076-104283098 CACAGGAGCAGGGCTGGGCTTGG + Intergenic
1122900384 14:104779913-104779935 GTCCCGAGGCTGGCTGGGCAGGG - Intronic
1123037926 14:105478864-105478886 CAGCAGAGGTGGGCTGGGCGCGG + Exonic
1125297996 15:38223339-38223361 CACTGGCTGAGGGCTGGGCAAGG - Intergenic
1125795226 15:42399432-42399454 CAGGTGAGGAGGGCTGGGAACGG - Intronic
1126373534 15:47971716-47971738 CACCGAAGTAGGGCAGGGCAGGG + Intergenic
1128343946 15:66842280-66842302 CACCCGCGGGAGGCTGGGGAGGG + Intergenic
1128350275 15:66883858-66883880 CACCTCAGGAGGGCTGGCCTTGG + Intergenic
1129465453 15:75722077-75722099 CACATGAGGAGGTCTGGGAACGG + Intergenic
1129669556 15:77599689-77599711 CTGGCGAGGAGGGATGGGCAGGG - Intergenic
1129760431 15:78126087-78126109 CAGCCCAGGAGGGCTGGGAATGG + Intronic
1129826892 15:78640418-78640440 CACCCGAGGTGTGCCGGGCCTGG - Intronic
1129836302 15:78709507-78709529 GACCCGAGCAGGGCGGGGTAGGG - Intronic
1132039011 15:98509158-98509180 CACACCATCAGGGCTGGGCATGG + Intronic
1132942156 16:2513766-2513788 CACCCGCGGAGGCCGAGGCAGGG + Intronic
1133783452 16:8956892-8956914 CTGCCCAGAAGGGCTGGGCATGG - Intronic
1134077134 16:11299886-11299908 CAGCCTAGGAAGGCTGGGCCAGG + Intronic
1134207548 16:12250264-12250286 CTCCCCATGAGAGCTGGGCAGGG - Intronic
1134465356 16:14471654-14471676 CACCTGAGGAGAGGTGGGAATGG - Intronic
1135345667 16:21686612-21686634 CTCCCCAGATGGGCTGGGCATGG + Intronic
1135719445 16:24802791-24802813 CACCCGAGGTGAGCTCAGCATGG + Intronic
1136222518 16:28837146-28837168 CCCACGAGGATGGCTGGACAAGG + Exonic
1137444589 16:48523948-48523970 CACCCGAGAGTGGCTGGGCCAGG + Intergenic
1138558910 16:57788470-57788492 CAGCCGGGGAGGACAGGGCATGG + Intronic
1141644157 16:85358470-85358492 CACCAGGGGCGGGCTGGGCTGGG - Intronic
1141858442 16:86700787-86700809 CACTCAAGGAGGGCTGGACGGGG - Intergenic
1141919680 16:87127569-87127591 CTCCAGAGGTGGGCTTGGCAGGG + Intronic
1141950987 16:87339258-87339280 CATCCCAGGAGGTCTGGACATGG - Intronic
1142065484 16:88059947-88059969 CACCCCAGGAGGGCTGAGGTTGG + Intronic
1142239407 16:88938333-88938355 CGCCCGGGCAGGGCTGGACAGGG + Intronic
1142319440 16:89371633-89371655 CACCCAAGGAGGGGTGTGGAGGG + Intronic
1142400492 16:89855904-89855926 CACCTGGGGTGGGGTGGGCATGG - Intronic
1142470436 17:160553-160575 CCCCCTAAGAGGACTGGGCAAGG - Intronic
1142995015 17:3755062-3755084 CACCTGATGAGGGCGGGGCCTGG - Intronic
1143255685 17:5556157-5556179 CACACATGAAGGGCTGGGCATGG + Intronic
1143450954 17:7036402-7036424 CCCCCGACGGGGGCTGGGGATGG + Exonic
1144053247 17:11515792-11515814 CAACCAAGGAGACCTGGGCAGGG + Intronic
1145242224 17:21246754-21246776 CAGCAGAGGAGGGGTGGGGAGGG + Intronic
1146657876 17:34645669-34645691 CACCAGGGGAGGGGTGGGCTGGG - Intergenic
1148342810 17:46883687-46883709 TTCCCGGGGAGTGCTGGGCACGG + Intronic
1148650905 17:49249454-49249476 CAGGCAAGGAGGGGTGGGCAGGG + Intergenic
1149368543 17:55969664-55969686 CACCCCAGCACGGCTGAGCAGGG - Intergenic
1149557590 17:57585109-57585131 GACCCTAAGAGGGCTGGGCGTGG - Intronic
1149655117 17:58305830-58305852 CACCTGGACAGGGCTGGGCAGGG + Exonic
1149989218 17:61371799-61371821 CGGCTGAGCAGGGCTGGGCATGG - Intronic
1150054580 17:62002197-62002219 CATCAAAAGAGGGCTGGGCACGG + Intronic
1150211788 17:63445988-63446010 CACCCGGGCAGGCCAGGGCAGGG + Exonic
1150426578 17:65082023-65082045 GACTTGAGAAGGGCTGGGCAAGG + Intergenic
1152202309 17:78954324-78954346 CATGCAGGGAGGGCTGGGCAGGG - Intergenic
1152418879 17:80181400-80181422 GACCCTAGGAGGGGTGGCCATGG - Exonic
1152504841 17:80742008-80742030 CACACGAGGAGGACTGAGGATGG + Intronic
1152642887 17:81456548-81456570 CAGCCACGGAGGGCTGGGCTGGG - Exonic
1152708780 17:81860014-81860036 CCCCCGGGGAGGACTCGGCAAGG + Intronic
1152738886 17:82010628-82010650 CCCCCGTGGCAGGCTGGGCATGG - Intronic
1152740412 17:82016150-82016172 CACCCGAGGAAGGTGGGGCCAGG - Intronic
1153275628 18:3364823-3364845 CTCCCAAACAGGGCTGGGCATGG + Intergenic
1153481467 18:5551432-5551454 CATCCGCTGAAGGCTGGGCACGG + Intronic
1156293125 18:35766549-35766571 CACCAAATCAGGGCTGGGCATGG + Intergenic
1156594238 18:38528593-38528615 AACCCAAAGAAGGCTGGGCATGG + Intergenic
1157897920 18:51486138-51486160 CTCTAGAGGAGGGATGGGCATGG + Intergenic
1158403154 18:57139349-57139371 AAGCCCAGGAGGGCTGGCCAAGG - Intergenic
1160812599 19:1019444-1019466 CACCTGAGCAGGGCTGTGAAGGG - Intronic
1160940479 19:1618411-1618433 CAGCCGTGGAGGGCTGAGGAGGG - Intronic
1160968128 19:1755478-1755500 CACCCGAGAATGGCGGGGGAGGG + Intronic
1161012887 19:1968722-1968744 CACCTAAGCAAGGCTGGGCACGG - Intronic
1161119365 19:2516939-2516961 CACCCCAGCAGGGCTGGGGCTGG + Intronic
1161167612 19:2796717-2796739 CTCCCGAGGAGGCAGGGGCAGGG - Intronic
1161251397 19:3282284-3282306 CACCCAAGGATGGGTGGGCAGGG + Intronic
1161304105 19:3557451-3557473 CACCCAAGAAGGCCTGGCCAGGG - Exonic
1161351204 19:3792921-3792943 CAGCCGAGGACGGCTAGGCCGGG - Intronic
1161563958 19:4989149-4989171 CTGCCGTGGAGGGCTTGGCAGGG + Intronic
1161588053 19:5116108-5116130 CACCAGACTGGGGCTGGGCATGG + Intronic
1162352563 19:10159497-10159519 CCACCGTGGAGGGCTGGGCGCGG - Intronic
1162737689 19:12755595-12755617 CACCTGGGCAGGGCGGGGCAGGG - Exonic
1163118128 19:15200346-15200368 CACCCCGGGCGGGCTGGGCCAGG - Intronic
1163241089 19:16064344-16064366 CACCCCAGGAGCCCTGGTCAGGG - Intergenic
1163275226 19:16279438-16279460 AAGTCAAGGAGGGCTGGGCACGG + Intergenic
1163338333 19:16688124-16688146 CACCTGAGGTGGGGTGGCCAGGG - Exonic
1163633422 19:18428069-18428091 AGCCAGAGGAGGGCTGGGGATGG + Intronic
1163970459 19:20788760-20788782 TACCCTAGAAAGGCTGGGCATGG + Intronic
1164373093 19:27658486-27658508 TACCTGGGGTGGGCTGGGCACGG + Intergenic
1165322394 19:35094098-35094120 CACCTGGGCTGGGCTGGGCAGGG + Intergenic
1166051934 19:40265670-40265692 GACACGGGGAGGGCAGGGCACGG - Intronic
1166290990 19:41863422-41863444 TACCCTGGGAGGGCTTGGCAGGG + Intronic
1167051994 19:47085100-47085122 CAGCCGAGGAGGGATGAACAAGG - Exonic
1167746168 19:51353081-51353103 CTCCCGAGCAGGGATGAGCAAGG + Intronic
1167798564 19:51726397-51726419 CACCCGAGCAGGGCGGGGTGGGG - Intergenic
1168536405 19:57174029-57174051 CACCTGAGGTGGGCCGGGCGCGG - Intergenic
1168536442 19:57174173-57174195 CACCTGAGGTGGGCCGGGCGCGG - Intergenic
1168710531 19:58497582-58497604 CACACGAGAAGGGATGGGCAGGG + Intronic
925285691 2:2714288-2714310 CACCACAGGAGGACTGGGGATGG - Intergenic
925917680 2:8618484-8618506 CACTCAAGGAGGCCTGAGCAGGG + Intergenic
926192424 2:10738840-10738862 CTCCTGTGGAGGGCTGGACAGGG - Intronic
926295592 2:11566461-11566483 AACCCTAGGAGGGGTGGACAGGG - Exonic
927455703 2:23247502-23247524 CTTCCAGGGAGGGCTGGGCAGGG + Intergenic
927694577 2:25231192-25231214 CACTCCAGGAGGGCTGGGGGAGG - Exonic
927705022 2:25291459-25291481 CACCCCAGGAAGGCCGAGCAAGG - Intronic
928426678 2:31184171-31184193 AACCTGAGGAGGGCCGGGCGCGG - Intronic
932189662 2:69730209-69730231 AAACCCAGGAGGGCTGGGCATGG + Intronic
932209595 2:69915635-69915657 CACTCGTGAAGGGCTGGGGAAGG - Intronic
932282686 2:70508152-70508174 AAGACTAGGAGGGCTGGGCATGG + Intronic
932571855 2:72942415-72942437 GACCAGAGGAGGGCCAGGCAGGG + Exonic
934571610 2:95376238-95376260 CACCCCAGGAGAGAGGGGCAGGG - Intronic
936000014 2:108818013-108818035 AACTAGATGAGGGCTGGGCACGG + Intronic
936095589 2:109528437-109528459 CTTCCCAGGAGGGCAGGGCATGG - Intergenic
936350357 2:111707644-111707666 AAACTTAGGAGGGCTGGGCACGG - Intergenic
937881535 2:126870099-126870121 CATCACAGGAAGGCTGGGCAGGG + Intergenic
941490902 2:166141108-166141130 CACCCGGGGAGTGGTGAGCAGGG - Intergenic
943407701 2:187510431-187510453 CACACCAAGAGGGGTGGGCAGGG - Intronic
943872056 2:193012111-193012133 CAGCCTGGGAGGGCTGGGCCAGG - Intergenic
945987861 2:216369963-216369985 CCCCCGAGAAGTGGTGGGCAGGG - Exonic
947844903 2:233236212-233236234 GACCCGAGAAGGGCTCTGCAAGG + Intronic
948150144 2:235738415-235738437 CAGCCAGGGAGGGCTCGGCAGGG + Intronic
948423027 2:237872184-237872206 CAGCCAAGGAGGGCCTGGCACGG + Intronic
948920354 2:241063414-241063436 CTCCCGAGGAGGGGTGGGTTTGG + Intronic
949060913 2:241956794-241956816 CACCCAGGGCTGGCTGGGCAAGG + Intergenic
1168829885 20:840119-840141 CCTCCGTGGAGGGCTAGGCAGGG + Intronic
1169324124 20:4661446-4661468 CACCAGATGAGGACGGGGCAGGG - Intergenic
1169712964 20:8585064-8585086 CACCCAATGAGGGCAGTGCAAGG - Intronic
1169913539 20:10666474-10666496 CATCCCAGGAGGGCTTGGAAAGG + Intronic
1170558037 20:17531219-17531241 CGGCCGACGAGGGCTGGGCTGGG - Exonic
1170567021 20:17613257-17613279 CACCCCAGGAGGGTGGGCCAGGG - Intergenic
1170687543 20:18583108-18583130 TGCACAAGGAGGGCTGGGCATGG + Intronic
1171372503 20:24670646-24670668 CACCCTGGGAGCCCTGGGCACGG - Intergenic
1172750209 20:37245472-37245494 CCCCTGAGGAAGGCAGGGCAGGG - Intergenic
1174480544 20:50828271-50828293 GACCAGAGGAGGGCTAGGCGTGG + Intronic
1175219080 20:57406701-57406723 AACCCTGTGAGGGCTGGGCACGG + Intronic
1175366502 20:58459850-58459872 CAACCGAGGATGGCTGGGCAGGG + Exonic
1175466246 20:59192628-59192650 CAGCCCAGGCGGGCTGGGCCGGG - Exonic
1175945724 20:62557874-62557896 CACCCAGGAAGAGCTGGGCATGG + Intronic
1176236546 20:64056304-64056326 CAGCAGAGGAGGGCAGGGGATGG - Intronic
1176416001 21:6475141-6475163 CACCCAGAGTGGGCTGGGCAAGG - Intergenic
1176428884 21:6564303-6564325 CGCCCCAGGAGGTGTGGGCAGGG - Intergenic
1178513257 21:33225250-33225272 AACCAGAGAAGGGCTGGGCATGG - Intergenic
1179465460 21:41568701-41568723 CTCCAGACGAGGGCTGGACAGGG + Intergenic
1179531518 21:42022657-42022679 CGCCCGCGGGGCGCTGGGCAAGG + Intergenic
1179610524 21:42547400-42547422 CTCCTGAGGAGGCCTGGCCAGGG - Intronic
1179691501 21:43083475-43083497 CACCCAGAGTGGGCTGGGCAAGG - Intergenic
1179704374 21:43172619-43172641 CGCCCCAGGAGGTGTGGGCAGGG - Exonic
1180987273 22:19912344-19912366 CACCCTGGGAGGGCGTGGCAGGG + Intronic
1181036009 22:20169969-20169991 CACCAGATGAGGCGTGGGCAGGG - Intergenic
1181115892 22:20632347-20632369 CTGCAGAGGAGGGCTGGGCCAGG + Intergenic
1181277934 22:21698498-21698520 CACCCGTGGCAGGCTGGGGACGG + Exonic
1181533481 22:23530275-23530297 CAACCAAGGAGGGAGGGGCAGGG - Intergenic
1181720778 22:24772941-24772963 CACCCAGGGAGGCCTGGGGAGGG - Intronic
1182079796 22:27520851-27520873 CTCCCAGGGATGGCTGGGCATGG - Intergenic
1182447527 22:30398160-30398182 CATCCCAGGAAGGCTGGACAGGG + Intronic
1182518084 22:30870240-30870262 CACCCTGGGAAGGCTGGGCCAGG + Intronic
1183357475 22:37367400-37367422 CACCAGAGGAGGGGTGGGCCAGG + Intergenic
1183560641 22:38570186-38570208 CAAACGAGGAGGGCGGGGCGAGG + Exonic
1183684484 22:39353627-39353649 CACCCGAACTGGGCTGGGCTGGG + Intronic
1183745971 22:39691857-39691879 CATCCCAGGAGGACAGGGCAGGG - Intergenic
1183766616 22:39882712-39882734 TACACAAAGAGGGCTGGGCACGG + Intronic
1184035928 22:41918122-41918144 CACCAGGTGAGGGCTGGACATGG - Intergenic
1184538707 22:45105522-45105544 CACCCGAACAGGGATGGTCACGG + Intergenic
1184722561 22:46323550-46323572 CCCCTGGGGTGGGCTGGGCACGG - Intronic
1185159282 22:49213152-49213174 AACCTTAGGATGGCTGGGCATGG - Intergenic
1185320931 22:50200021-50200043 CTGCAGAGGAGGGTTGGGCACGG + Intergenic
950543194 3:13624508-13624530 GACCCGGGGATGGCTGGGAATGG - Intronic
950719234 3:14870670-14870692 CACCTGCGTAGGGCTGGCCATGG - Intronic
950886334 3:16366130-16366152 AACCAGAGGAATGCTGGGCAAGG + Intronic
952429577 3:33209801-33209823 GAGCCAAAGAGGGCTGGGCATGG - Intronic
952971519 3:38653797-38653819 CTGCTGGGGAGGGCTGGGCAAGG - Intergenic
953912884 3:46901710-46901732 CACCCTAGTGGGGCGGGGCAAGG - Intronic
953950881 3:47189205-47189227 CAGATAAGGAGGGCTGGGCATGG + Intergenic
953982691 3:47420515-47420537 CTCCAGAAGAGGGCAGGGCAGGG + Intronic
954065760 3:48104655-48104677 ACCCCGAGGGAGGCTGGGCACGG - Intergenic
954703595 3:52466273-52466295 GAGACGAGGAGGGCCGGGCATGG + Intronic
955290678 3:57689770-57689792 GATCAGAGAAGGGCTGGGCATGG + Intronic
958962314 3:100522138-100522160 CAACCAAGGAGGGGTGGGGAAGG - Intronic
959539367 3:107523119-107523141 CGCCCAGGGAGGGCTGGGGATGG - Intronic
960102557 3:113760436-113760458 AACGAGAGGATGGCTGGGCATGG + Intronic
961455060 3:127019941-127019963 CACCAGGGGCAGGCTGGGCAGGG - Intronic
961522044 3:127472635-127472657 CACAGGAGGAGGGCAGGGCAGGG - Intergenic
962344598 3:134610054-134610076 GAGCCGAGGAGGAGTGGGCATGG + Intronic
964030451 3:152132612-152132634 TAGCAGAGGATGGCTGGGCATGG - Intergenic
967028082 3:185581995-185582017 TACCAGACGAGGGCTGGGCGCGG - Intergenic
967983224 3:195077872-195077894 AACCCCAGGCAGGCTGGGCACGG - Intronic
968460289 4:721417-721439 CCCCAGAGGAAGGCTGGGCTGGG + Intronic
968546775 4:1202910-1202932 CGGCCAAGGAGGGCTGGGCCAGG + Intronic
968578992 4:1380982-1381004 CGCCCGGGTAGGTCTGGGCAAGG + Exonic
968651768 4:1763028-1763050 CACCCGAGGGGGCGTGGGGAAGG - Intergenic
968799391 4:2732274-2732296 CACCCTAGGCGGGCTGGGCGGGG + Exonic
968901750 4:3435358-3435380 CTCCTGCGGAGGGCGGGGCACGG - Intronic
968966155 4:3769995-3770017 CCCCCGACCAGGCCTGGGCAGGG + Intergenic
969373772 4:6749999-6750021 CACGGGAGGTGGGGTGGGCAGGG + Intergenic
969682716 4:8652205-8652227 CACCAGAGCTGGGTTGGGCAGGG - Intergenic
969758061 4:9162807-9162829 CACAGGAGGCTGGCTGGGCACGG + Intergenic
969927336 4:10597250-10597272 CACCCCAGGAAGGCTTGGCCAGG + Intronic
971351974 4:25863079-25863101 GCCGGGAGGAGGGCTGGGCAGGG - Intronic
971583166 4:28369141-28369163 CTGCTGAGGATGGCTGGGCACGG - Intronic
972177978 4:36430834-36430856 CAAGCAAGGGGGGCTGGGCATGG + Intergenic
979439533 4:120734808-120734830 CATAGGAGGAGGGCTAGGCAAGG - Intronic
981785907 4:148479486-148479508 AACCAAATGAGGGCTGGGCATGG + Intergenic
982117270 4:152108001-152108023 CATAGGAGGAGGGCTGGGCTGGG + Intergenic
982781232 4:159493186-159493208 CACCCCTGGAAGGCAGGGCATGG + Intergenic
986177844 5:5366953-5366975 CACACTGGGAGGGCTGCGCACGG - Intergenic
986199385 5:5567801-5567823 CAGCTGAGCCGGGCTGGGCAGGG - Intergenic
987817873 5:22927458-22927480 AACCCTATAAGGGCTGGGCATGG - Intergenic
988318167 5:29658848-29658870 AATCTGAGGAAGGCTGGGCATGG + Intergenic
990049778 5:51483370-51483392 AACCTGAAGAGGGCTGGGCGCGG + Intergenic
990111208 5:52327580-52327602 TACCTGTGCAGGGCTGGGCATGG + Intergenic
990878296 5:60511257-60511279 CACCATGGCAGGGCTGGGCATGG - Intronic
992067396 5:73120493-73120515 GGCCCGGGGAGGGCAGGGCAGGG - Exonic
992381693 5:76243789-76243811 CACCCAAGGAGGGCCCGGCCAGG - Intronic
996624247 5:125550954-125550976 CACCCGGGATGGGCCGGGCACGG + Intergenic
997977616 5:138449551-138449573 ATCCCAAGGAGGCCTGGGCATGG - Intergenic
999315471 5:150580733-150580755 CACCCAATGAGGGGTGGGAATGG - Intergenic
1000302140 5:159965776-159965798 CGCCCCAGCAGGGATGGGCAAGG + Intronic
1001401909 5:171450998-171451020 GACCCCAGGAGGGCTGCGCGGGG + Intronic
1001876886 5:175209393-175209415 CCCCTGAGGAGGGCTGGAGATGG + Intergenic
1002191712 5:177481731-177481753 GAGACGAGAAGGGCTGGGCACGG - Intergenic
1002260809 5:177992843-177992865 CTCCTGTGGAGGGCTGGGAAGGG + Exonic
1002346900 5:178554467-178554489 CACACCAGGAGGGCTGGGCGTGG - Intronic
1002469182 5:179424764-179424786 CACCCAAGGAGAGCTGGGGTGGG + Intergenic
1002567482 5:180119968-180119990 CAGCCCAGGATGGCTGGGGAAGG - Intronic
1002604126 5:180371888-180371910 CACCCCAGGGGCACTGGGCAGGG - Intergenic
1002670480 5:180861837-180861859 CACCGGCGGTGGGGTGGGCAGGG - Intergenic
1003134956 6:3427928-3427950 CACCCGAGGTGGGGTGAGCCAGG + Intronic
1003368491 6:5500481-5500503 CACCAGCGGAGGGTGGGGCAAGG + Intronic
1004004996 6:11630263-11630285 CATCAGAGGAGGCCAGGGCAGGG + Intergenic
1005034304 6:21541713-21541735 AAACCATGGAGGGCTGGGCACGG + Intergenic
1006123408 6:31821635-31821657 CACCAGAGGAGGGCTGGAGCAGG + Intergenic
1006694752 6:35921220-35921242 CTCCCGAGGAGGGGGCGGCAAGG + Exonic
1007457517 6:41991347-41991369 TACCTGAGCGGGGCTGGGCATGG - Intronic
1007656569 6:43454697-43454719 CAAGCGAGGACGGCTGGACAGGG + Intronic
1007769593 6:44182436-44182458 CACACAAAGAGCGCTGGGCAGGG + Intronic
1013367579 6:109447305-109447327 GGCCCGGGGAGGGCAGGGCAGGG - Intronic
1017319650 6:153074973-153074995 CATCCGGGGAGGGCAGTGCAGGG - Intronic
1017561876 6:155636785-155636807 CTCCCGAAGAGGACAGGGCAGGG + Intergenic
1018629464 6:165809746-165809768 CCCACTAGGAGGGCTGGGAAGGG - Intronic
1019495210 7:1335092-1335114 CTGCCGAGTGGGGCTGGGCACGG - Intergenic
1019501488 7:1367028-1367050 CAGCTGAGGAGGGCAGGGCTGGG - Intergenic
1019616207 7:1963720-1963742 CACCCAGGGAGGGCAGCGCACGG - Intronic
1019788260 7:2993394-2993416 CACCAGAGGAGGGATGGAGAAGG + Intronic
1019793889 7:3035589-3035611 AATCCAAGGAGGGCTGGGCGCGG - Intronic
1019923046 7:4174884-4174906 CAACAGAGGAGGGGTGGGAACGG - Intronic
1020014771 7:4824491-4824513 CAGCCGAGCAGGGCTGGGGGAGG + Intronic
1020036462 7:4966258-4966280 AACCCAAGAAGGGCGGGGCATGG + Intergenic
1020388755 7:7635858-7635880 AAACCCAGGAAGGCTGGGCATGG + Intergenic
1021905203 7:25326549-25326571 CCCCAGTGGAGGGCTGGGGACGG + Intergenic
1022008957 7:26292260-26292282 CAGCCGAGGTGTGCCGGGCAGGG + Intronic
1022507787 7:30917307-30917329 GACCCAAGGAGGGTTGGGCGGGG + Intronic
1023552728 7:41387505-41387527 CTCCACATGAGGGCTGGGCAGGG - Intergenic
1023830904 7:44038634-44038656 GAACCTAGGAGGGCCGGGCACGG - Intergenic
1025143400 7:56484076-56484098 CAGCCCAGGAGGGTTGGGCAGGG + Intergenic
1025202953 7:56973291-56973313 CACCAGGCAAGGGCTGGGCATGG + Intergenic
1025259036 7:57404905-57404927 CAGCCCAAGAGGGTTGGGCAGGG + Intergenic
1025609816 7:63068249-63068271 CAGCCCAAGAGGGTTGGGCAGGG - Intergenic
1025668991 7:63603635-63603657 CACCAGGCAAGGGCTGGGCATGG - Intergenic
1025710162 7:63900948-63900970 CAGCCCAGGAGGGTTGGACACGG + Intergenic
1026299962 7:69089330-69089352 CACTCCATGAGGCCTGGGCAGGG + Intergenic
1027140173 7:75651105-75651127 CACAGGAGGAGGGAGGGGCATGG + Intronic
1029741240 7:102492954-102492976 GAACCTAGGAGGGCCGGGCACGG - Intronic
1029759230 7:102592123-102592145 GAACCTAGGAGGGCCGGGCACGG - Intronic
1029776600 7:102688033-102688055 GAACCTAGGAGGGCCGGGCACGG - Intergenic
1031342740 7:120624488-120624510 AACCCATGGTGGGCTGGGCATGG + Intronic
1031393577 7:121245981-121246003 TGCCTGTGGAGGGCTGGGCATGG - Intronic
1032277829 7:130475261-130475283 AAACCAAGGAGGGCTGGGCGCGG - Intergenic
1032764216 7:134975451-134975473 CAGCCAAGGAGGACTGAGCAAGG + Intergenic
1034156405 7:148959331-148959353 AAACCCAAGAGGGCTGGGCATGG + Intergenic
1034188343 7:149195882-149195904 GGCCCGAGGCGGGCGGGGCACGG + Intronic
1034890695 7:154836344-154836366 CTCCCCAGGTGGGTTGGGCATGG - Intronic
1034954916 7:155328131-155328153 CACCCGGGGTGGTCTGAGCAGGG - Intergenic
1035179416 7:157078344-157078366 CACGCGAGGAAGGGAGGGCAGGG - Intergenic
1037309266 8:17537340-17537362 CACACAGGGTGGGCTGGGCACGG - Intronic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1039065584 8:33604790-33604812 CAGCCCAGGAGGGATGGGCATGG - Intergenic
1039560846 8:38511223-38511245 CAGCCCAGGCCGGCTGGGCATGG - Exonic
1040561321 8:48525526-48525548 CATCTGAGGTGGGCTGTGCAAGG - Intergenic
1040593847 8:48819367-48819389 CACTCGGGGAGGGCTGGGCTCGG + Intergenic
1041195722 8:55399757-55399779 CTACATAGGAGGGCTGGGCAAGG + Intronic
1044572385 8:93734380-93734402 CACCTGAGGAGGACTGGAGACGG - Exonic
1047205728 8:122801960-122801982 CAGCCGTGGGTGGCTGGGCAGGG - Intronic
1047397755 8:124517919-124517941 CACCTGAGGTTGGCTGGGCACGG + Intronic
1048580872 8:135729052-135729074 CATCTGAGATGGGCTGGGCAGGG - Intergenic
1049220930 8:141428466-141428488 CACACATGGTGGGCTGGGCAGGG - Intronic
1049287045 8:141781514-141781536 CACCCGAGAGAGGCTCGGCAGGG + Intergenic
1049542203 8:143213711-143213733 GGCCCGAGGATGGCTGGGGAGGG + Intergenic
1049611955 8:143559973-143559995 GGCCCGAAGAGGGCAGGGCAGGG + Intronic
1049730269 8:144173776-144173798 CACGCCAGCATGGCTGGGCAAGG - Intronic
1049741126 8:144241528-144241550 CACCGGTGCAGGGCTGGGGACGG + Intronic
1049742820 8:144249178-144249200 CACCCGAGGAGGGCTGGGCAGGG - Intronic
1049842554 8:144782545-144782567 AACTCAAGGAGGGCCGGGCACGG + Intronic
1053114118 9:35487266-35487288 CAGCTGAGGAGAGCTGGTCAGGG - Intergenic
1055934467 9:81591980-81592002 CACCAGGGCAGGGCAGGGCAGGG + Intronic
1057138981 9:92715504-92715526 GAGCAGAGGAGGGCAGGGCAGGG + Intronic
1057215646 9:93227012-93227034 CCTCAGAGGAGGGCTTGGCAGGG - Intronic
1057897560 9:98921966-98921988 GACCCTAGGAAGGCTGGCCAAGG - Intergenic
1060317526 9:122526591-122526613 AACCCGTGGTGGGGTGGGCAAGG - Exonic
1060324928 9:122605039-122605061 CTCCCCAGACGGGCTGGGCACGG + Intergenic
1061010720 9:127953005-127953027 CTCCCGAGTACGGCTGGGCATGG - Intronic
1061246993 9:129405568-129405590 CAACCAAGGAGGGAGGGGCAGGG + Intergenic
1061255180 9:129451158-129451180 TGCCCCAGGATGGCTGGGCAGGG + Intergenic
1061281067 9:129597813-129597835 CCCCAGAGGAGTCCTGGGCAGGG - Intergenic
1061320104 9:129823435-129823457 CATCCCAGGAGGGCCGGGCCTGG - Intronic
1061433227 9:130544438-130544460 CTCCTGAGGAAGGCTGGGCCTGG + Intergenic
1061573290 9:131490887-131490909 CACACGGGGCGGGGTGGGCAAGG - Intronic
1062041523 9:134406593-134406615 GAGCCCTGGAGGGCTGGGCAGGG + Intronic
1062160148 9:135075481-135075503 CCTCCGGGCAGGGCTGGGCAGGG - Intronic
1062262085 9:135667796-135667818 CCCCAGAGGAGGCCTGGGCATGG + Intergenic
1062350384 9:136135835-136135857 CACAGCAGGCGGGCTGGGCAGGG - Intergenic
1062581405 9:137230704-137230726 CACTCCAGGAGGGTTGGGCTGGG + Intergenic
1185977106 X:4733769-4733791 CCCCCGAGAATGGTTGGGCATGG + Intergenic
1186979055 X:14939598-14939620 CCCCCAAGGTGGGCTGGGCATGG - Intergenic
1189303136 X:39967297-39967319 CATGCAAGGTGGGCTGGGCACGG - Intergenic
1190453343 X:50602380-50602402 AACCCAACAAGGGCTGGGCACGG - Intronic
1193957589 X:87881593-87881615 CACCCTTCCAGGGCTGGGCACGG + Intergenic
1197211330 X:123830574-123830596 CAACCGACAAGGGTTGGGCAAGG - Intergenic
1200048123 X:153413373-153413395 CACGCGGGGAGGGCTGGGAAGGG - Intergenic
1200327813 X:155260881-155260903 CAATCCAGGAGGGCTGGGAAGGG - Exonic