ID: 1049743846

View in Genome Browser
Species Human (GRCh38)
Location 8:144254734-144254756
Sequence GGTCCACGGCACCCAGGTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049743834_1049743846 30 Left 1049743834 8:144254681-144254703 CCCAGCTGGCTGCAGCTGAGCCT 0: 1
1: 0
2: 7
3: 49
4: 343
Right 1049743846 8:144254734-144254756 GGTCCACGGCACCCAGGTGGCGG 0: 1
1: 0
2: 0
3: 9
4: 161
1049743838_1049743846 10 Left 1049743838 8:144254701-144254723 CCTGGTGGCTGTGTCTGAGCGTC 0: 1
1: 0
2: 1
3: 13
4: 142
Right 1049743846 8:144254734-144254756 GGTCCACGGCACCCAGGTGGCGG 0: 1
1: 0
2: 0
3: 9
4: 161
1049743835_1049743846 29 Left 1049743835 8:144254682-144254704 CCAGCTGGCTGCAGCTGAGCCTG 0: 1
1: 0
2: 5
3: 59
4: 428
Right 1049743846 8:144254734-144254756 GGTCCACGGCACCCAGGTGGCGG 0: 1
1: 0
2: 0
3: 9
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049743846 Original CRISPR GGTCCACGGCACCCAGGTGG CGG Intronic
901144438 1:7055663-7055685 GGGCCAAGCCACCCAGGTGAAGG - Intronic
902902106 1:19524927-19524949 GAGCCACTGCACCCAGCTGGTGG - Intergenic
903173224 1:21566201-21566223 AGTCCCCAGCACCCAGGGGGTGG - Intronic
903344287 1:22674314-22674336 GGTACACTGCCACCAGGTGGCGG + Intergenic
903779032 1:25810031-25810053 GGTCCCAGGCACAGAGGTGGAGG - Intronic
904115888 1:28161629-28161651 GAGCCACTGCACCCAGCTGGTGG + Intronic
905894033 1:41533767-41533789 GGCCATCAGCACCCAGGTGGAGG - Intronic
911785854 1:101946087-101946109 TGACCAAGGCACCCAAGTGGAGG - Intronic
913374887 1:118140097-118140119 GGTCAAGGGCACCCATCTGGTGG - Intronic
920002870 1:202811431-202811453 GTTGCACGGCGCCCAGGGGGAGG - Intergenic
921937754 1:220810520-220810542 GGTCACCGGCTCACAGGTGGCGG - Intronic
922301345 1:224303791-224303813 GGGGCACGACGCCCAGGTGGTGG + Exonic
1063160853 10:3417001-3417023 GGTGCAGGGCACAGAGGTGGGGG + Intergenic
1063352714 10:5371588-5371610 GGTCCACTGCACTCATGTGTGGG + Intronic
1063961002 10:11305351-11305373 GGGCGCCGGCACCCAGGTGTGGG - Intronic
1066055202 10:31674213-31674235 GGGCCAGGGCACCCAGTTGAGGG + Intergenic
1072921840 10:99583356-99583378 GCTCCAGGGCAGGCAGGTGGAGG + Intergenic
1076786847 10:132754167-132754189 GGACCATGGCGGCCAGGTGGCGG - Intronic
1076847342 10:133075741-133075763 GGGCCACAGGACCCAGGTAGTGG - Intronic
1077251786 11:1563983-1564005 GCCCCATGGCCCCCAGGTGGAGG - Exonic
1077360191 11:2137440-2137462 GGTCCAGGGCTCCCGGTTGGGGG - Intronic
1077437815 11:2551278-2551300 CGTCCACGGTTCCCAGGTGCGGG - Intronic
1078366936 11:10714753-10714775 GGGACACAGCACCTAGGTGGTGG + Intergenic
1078608141 11:12795637-12795659 GGTCCATGGACCACAGGTGGAGG - Intronic
1085295893 11:75431450-75431472 GGGCCGCTGGACCCAGGTGGAGG + Intergenic
1090567023 11:128006200-128006222 AGTCCACGGCACTCACGAGGAGG + Intergenic
1092766029 12:11853814-11853836 GGTCCATGACAGCCAGGTGCAGG + Intronic
1096241274 12:49961638-49961660 GGGCCACGTGACCCAGGCGGCGG - Intergenic
1097450747 12:59734172-59734194 CCTCCATGGCACCCAGGTAGGGG + Intronic
1098216890 12:68230156-68230178 GGGCCAGGACACACAGGTGGAGG - Intergenic
1101858357 12:108462917-108462939 GGTCCTCAGAACCAAGGTGGGGG + Intergenic
1103702212 12:122853768-122853790 CGTCCTGGGCTCCCAGGTGGAGG + Intronic
1103974396 12:124692863-124692885 GGTCCGAGGCACTCTGGTGGTGG + Intergenic
1105756290 13:23467141-23467163 TGCCCAAGGCACACAGGTGGTGG + Intergenic
1108527755 13:51300281-51300303 AGTCCCAGACACCCAGGTGGGGG + Intergenic
1112174787 13:97011371-97011393 AGACCATGGCACACAGGTGGTGG + Intergenic
1113854564 13:113436436-113436458 GGGACCCGGCACCCAGGTGCAGG + Intronic
1113854616 13:113436604-113436626 GGGACCCGGCACCCAGGTGCAGG + Intronic
1113854655 13:113436730-113436752 GGGACCCGGCACCCAGGTGCAGG + Intronic
1117972486 14:61265808-61265830 GAGCCACTGCACCCAGCTGGGGG - Intronic
1122814819 14:104307225-104307247 CGTCCCCGGCACCCAGAAGGAGG - Intergenic
1127358919 15:58227889-58227911 GGTACACTGCCACCAGGTGGAGG + Intronic
1128159076 15:65411222-65411244 GCTCCAGGTCACCCTGGTGGGGG + Exonic
1128553829 15:68616547-68616569 GGCCCACGGCACCCAGCAGGCGG - Intronic
1128644957 15:69370178-69370200 GCTTCACAGCACCCAGCTGGTGG - Intronic
1131686314 15:94771891-94771913 AGGCCACTGCATCCAGGTGGTGG + Intergenic
1132104006 15:99049896-99049918 GGTAGGAGGCACCCAGGTGGGGG - Intergenic
1132606836 16:797168-797190 GGGCCAAGGCACCCATGGGGTGG + Intronic
1132606883 16:797304-797326 GGGCCAAGGCACCCATGGGGTGG + Intronic
1133774087 16:8884426-8884448 GGTACACAGCAGCCAGGTGAGGG - Intergenic
1134628750 16:15741664-15741686 GGTCAGCTGCACGCAGGTGGTGG + Exonic
1137494991 16:48962689-48962711 GGTCCCAGGCACCTAAGTGGAGG + Intergenic
1137879300 16:52030236-52030258 GATCCAAGGCACACAGGTAGTGG - Intronic
1138650085 16:58455199-58455221 GCTCCAGGTCACCCAGGTAGTGG + Intergenic
1139967246 16:70752610-70752632 GGGCCACGGCAGCCAGGAGAAGG + Intronic
1141867649 16:86761729-86761751 GATGCACGGCACCCAGCTTGCGG - Intergenic
1142023886 16:87801971-87801993 CCTGCAGGGCACCCAGGTGGGGG - Intergenic
1142104291 16:88293915-88293937 GGTTCACGTGACACAGGTGGAGG + Intergenic
1142202572 16:88768159-88768181 GGTCCAGGGCTGCCAGCTGGTGG + Intronic
1142231305 16:88901473-88901495 GGCCCTCGGCTGCCAGGTGGGGG + Intronic
1142478001 17:201060-201082 GGTCCATCTGACCCAGGTGGTGG + Intergenic
1142964817 17:3573885-3573907 AGTCCACGTCGCACAGGTGGCGG - Exonic
1143088751 17:4436037-4436059 GGTCCACAGCAGCCAGCAGGGGG - Intronic
1143455541 17:7065341-7065363 AGTGGACGGCAACCAGGTGGGGG + Intergenic
1144807514 17:17977667-17977689 GGACCAGGGCCCCCAGGAGGAGG + Exonic
1146488322 17:33261906-33261928 AGGCCACGGCACCCAGATGGAGG - Intronic
1147964871 17:44189220-44189242 GGTCCACATGCCCCAGGTGGAGG - Exonic
1151351550 17:73534917-73534939 GGTCTAAGGAACCCAGGAGGAGG + Intronic
1152242486 17:79167766-79167788 GGTCCAGGGCACCCCGGAGCCGG + Intronic
1152486768 17:80599675-80599697 AATCCAGGGCACCCATGTGGTGG - Intronic
1152754931 17:82083255-82083277 GTTCCATGGGGCCCAGGTGGAGG - Exonic
1157627086 18:49060189-49060211 GGTCCTGGGCACCCAGTTTGTGG - Intronic
1157884744 18:51355784-51355806 GGTCCACGGATCCCAGTTTGAGG - Intergenic
1160732126 19:646083-646105 GGACACCGGCACCCTGGTGGGGG - Intergenic
1163612008 19:18306566-18306588 AGTCCAGGCCACCCAGGAGGGGG + Exonic
1163631557 19:18420214-18420236 GGGCCAGGGCAGACAGGTGGCGG - Intronic
1165353896 19:35292090-35292112 GGCCCCTGGCACCCAGGGGGAGG + Intergenic
1165840573 19:38787196-38787218 ACTCCAAGGCACCAAGGTGGGGG - Intergenic
1166732039 19:45064536-45064558 GGCCGGCGGCACTCAGGTGGGGG + Exonic
1166773760 19:45300062-45300084 GGGCCATGGCACCCAGCCGGAGG - Intronic
1167503117 19:49858281-49858303 GGTCCCAGGCAGCCAGCTGGTGG + Intronic
1167574212 19:50309928-50309950 GTTGCAGGGGACCCAGGTGGGGG - Exonic
930510148 2:52334634-52334656 GGTCCACAGCCCGCAGGTTGGGG - Intergenic
937047526 2:118859538-118859560 GGTCCAACGCACCCCGGTGAAGG + Intergenic
937221340 2:120344664-120344686 GGTCCGGGGCGCCCACGTGGTGG + Intergenic
941915261 2:170808573-170808595 GAGCCACGGCACCCAGTGGGGGG + Intergenic
946786264 2:223246995-223247017 GGTCCACGACACTCATGGGGAGG - Intergenic
947641020 2:231707998-231708020 GGTCCAAGGCGCCCAGGCGCGGG + Intronic
947799867 2:232922017-232922039 GTACCCAGGCACCCAGGTGGAGG + Intronic
948108802 2:235437593-235437615 GGTCCACGGCACAGAGGCTGGGG + Intergenic
948684874 2:239664198-239664220 CGTCCACGGGACCCAGCTGTGGG + Intergenic
1169123439 20:3110872-3110894 GGTCCAGTGCACCAAGGTTGGGG + Intronic
1173224327 20:41153047-41153069 GGTCCACAGGCCACAGGTGGGGG + Intronic
1173861601 20:46287492-46287514 GGGCGAGGGCAGCCAGGTGGAGG + Intronic
1175923494 20:62461041-62461063 GGTCCTGGGCACCCTGGGGGAGG - Intergenic
1175953627 20:62596785-62596807 TGCCCACGGCACCCAGATGGTGG + Intergenic
1176002556 20:62839576-62839598 GCTCCAGGGCACCCAGGCAGAGG - Intronic
1176002582 20:62839678-62839700 GCTCCAGGGCACCCAGGGAGAGG - Intronic
1176002600 20:62839726-62839748 GCTCCAGGGCACCCAGGGAGAGG - Intronic
1176002618 20:62839774-62839796 GCTCCAGGGCACCCAGGGAGAGG - Intronic
1176117500 20:63439454-63439476 GGTCCACAGCCCCCAGGAGCTGG - Intronic
1184228253 22:43143123-43143145 GGGCCAGGGCAGCCAGGTGGTGG - Exonic
1184331655 22:43831644-43831666 GCTCCGCGCCACGCAGGTGGAGG + Intronic
1184583171 22:45430591-45430613 GGTGCAGGGCTCCCAGGTGCAGG - Intronic
949484431 3:4524147-4524169 GGTCCCCTGCACCCAGGTGAGGG + Intronic
953924887 3:46977764-46977786 GGCCCACTGGACCCAGGTTGGGG - Intronic
955363465 3:58292630-58292652 GAGCCACCGCACCCAGCTGGAGG - Intronic
958427553 3:93996787-93996809 GGTCCACGGCCCCGGGGTTGGGG - Intronic
962373260 3:134838788-134838810 GGTACACTGCCACCAGGTGGCGG - Intronic
963293463 3:143518223-143518245 GGTCCATGGCAGGGAGGTGGTGG + Intronic
967056088 3:185829526-185829548 AGTCCATGGCACCAAGGTTGGGG + Intergenic
968001326 3:195208847-195208869 GGGCCACGACACCCAGCAGGGGG + Intronic
968516795 4:1018876-1018898 GGTCCGGGGAGCCCAGGTGGGGG + Intronic
968690599 4:1987889-1987911 GGCTCACGGCACCAGGGTGGGGG + Intronic
968917075 4:3501247-3501269 GGGCCACAACACCCAGGTGAAGG - Intronic
968974116 4:3812194-3812216 GGGCCATGGCACCCAGCTGGTGG - Intergenic
969669273 4:8580791-8580813 GGTCCGGGGCACCCGGGGGGAGG - Exonic
969858718 4:10019635-10019657 GGACAACGGCACTCAGGTGACGG - Intronic
979045051 4:115852214-115852236 GGTCCACTGCAGCTAGTTGGGGG - Intergenic
979573547 4:122258748-122258770 GGTCCAGAGCTACCAGGTGGAGG - Exonic
985789229 5:1916322-1916344 GGTCCCCGACACACAGGAGGGGG + Intergenic
985986575 5:3521424-3521446 GTCCCAAGGCAGCCAGGTGGTGG + Intergenic
990377273 5:55184315-55184337 GAGCCACTGCACCCAGCTGGTGG - Intergenic
990585446 5:57207015-57207037 GGTCGTTTGCACCCAGGTGGTGG + Intronic
992346861 5:75888215-75888237 AGTCCGCTGCAACCAGGTGGGGG + Intergenic
997228745 5:132228131-132228153 GGGCCAAGGCCCGCAGGTGGGGG - Intronic
998483219 5:142480053-142480075 GGTCAAGGGCACCAAGGTGCTGG - Intergenic
999103164 5:149044506-149044528 GGTACAAGGCAAGCAGGTGGAGG - Intronic
1001082295 5:168676243-168676265 GATCCACAGCACCCAGGACGAGG - Intronic
1001664441 5:173421050-173421072 GAGCCACTGCACCCAGGTGGGGG + Intergenic
1004699446 6:18065364-18065386 GGTCCACGGCCCCAGGGTTGGGG - Intergenic
1006278064 6:33022082-33022104 CGTCCAGGCCACCCAGGTGCGGG + Intergenic
1006410911 6:33872740-33872762 GGGCCAAGGCCCACAGGTGGGGG + Intergenic
1006680741 6:35795401-35795423 GGCCCACGGCACCCCTGGGGAGG - Intronic
1012522384 6:100136727-100136749 AGCACAGGGCACCCAGGTGGCGG - Intergenic
1013422504 6:109979133-109979155 GCTCAACGACTCCCAGGTGGTGG + Exonic
1016946066 6:149535070-149535092 GAGCCACTGCACCCAGCTGGAGG - Intronic
1018434994 6:163751533-163751555 TTTCCACGGGACCCAGGTGTCGG + Intergenic
1018623226 6:165751538-165751560 AGGCCAAGGCAACCAGGTGGAGG + Intronic
1019424882 7:969874-969896 TGTCCACGGCACCCTGGCAGAGG + Intronic
1022177047 7:27881214-27881236 GGTGCATGGCCCACAGGTGGTGG + Intronic
1026256728 7:68718663-68718685 GCTCAATGGCACCCAGGTGCAGG - Intergenic
1026890284 7:73977669-73977691 GGTCTGCAGCAGCCAGGTGGGGG - Intergenic
1028905878 7:96153538-96153560 GGTCCCCTGCAGCCAGGTGCAGG - Intronic
1031998153 7:128246345-128246367 GGTGCAGAGGACCCAGGTGGAGG + Intronic
1033564945 7:142569471-142569493 GGTCCATGGCACTCAGGGAGAGG + Intergenic
1033611568 7:142968057-142968079 CGTCCACAGCACCCAGATGCTGG - Intergenic
1034641572 7:152608117-152608139 GGTCCACGCCTCCCATGTGGAGG + Intergenic
1037989157 8:23308341-23308363 GGTCCCAGGCTCTCAGGTGGTGG + Intronic
1042928447 8:73990381-73990403 GGTCCACGGCCCCCAGAGGATGG - Intergenic
1045148775 8:99378932-99378954 GGTCCACGGCCCAGAGGTTGAGG - Intronic
1047646821 8:126878543-126878565 TGTCCATGGCAGGCAGGTGGAGG + Intergenic
1049688773 8:143949820-143949842 GCTCCTCGGCACTGAGGTGGGGG - Intronic
1049732897 8:144187883-144187905 GCTACACGGGAGCCAGGTGGGGG + Intronic
1049743846 8:144254734-144254756 GGTCCACGGCACCCAGGTGGCGG + Intronic
1049936610 9:505556-505578 GTTCCACGGGACCCGGGTGAAGG - Intronic
1052481402 9:29031565-29031587 GAGCCACCGCACCCAGCTGGTGG + Intergenic
1055965426 9:81860959-81860981 GGTCCCCAACACCCCGGTGGGGG - Intergenic
1056379717 9:86046413-86046435 GGTGCACGGCACCTGGGAGGCGG - Intronic
1056391341 9:86144312-86144334 GAGCCACGGCATCCAGCTGGGGG + Intergenic
1057996570 9:99824929-99824951 GGTCCCCTGCACCCAGAGGGCGG - Intronic
1058725229 9:107796826-107796848 ATTCCAAGGGACCCAGGTGGAGG - Intergenic
1061160022 9:128888353-128888375 TGTCCCCTGAACCCAGGTGGTGG - Intronic
1061295688 9:129675557-129675579 GATCCACTGCCCCCAGGGGGCGG + Intronic
1062082336 9:134630633-134630655 GGGCCACAGCGCCCAGGTGAAGG - Intergenic
1062094103 9:134694276-134694298 CGGGCACTGCACCCAGGTGGAGG - Intronic
1187677957 X:21736873-21736895 AGTCCACAGGAGCCAGGTGGAGG + Intronic
1190556781 X:51643868-51643890 GGTCCCCAGCTCCCAGGTGGGGG + Intergenic
1198811653 X:140541947-140541969 GAGCCACCGCACCCAGCTGGGGG + Intergenic
1199894026 X:152115384-152115406 GGTCCCAGGCACCCTGGGGGAGG - Intergenic
1200018481 X:153182503-153182525 GGTCCTGGGCACCCTGGAGGAGG + Exonic