ID: 1049744079

View in Genome Browser
Species Human (GRCh38)
Location 8:144255758-144255780
Sequence GCGTGTGCACGCGCGTGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 11, 3: 16, 4: 130}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049744073_1049744079 7 Left 1049744073 8:144255728-144255750 CCTCCAGTACTGATTCGGAAGCA 0: 1
1: 0
2: 1
3: 1
4: 77
Right 1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG 0: 1
1: 0
2: 11
3: 16
4: 130
1049744072_1049744079 10 Left 1049744072 8:144255725-144255747 CCACCTCCAGTACTGATTCGGAA 0: 1
1: 0
2: 1
3: 3
4: 61
Right 1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG 0: 1
1: 0
2: 11
3: 16
4: 130
1049744067_1049744079 19 Left 1049744067 8:144255716-144255738 CCCCACTTCCCACCTCCAGTACT 0: 1
1: 0
2: 7
3: 63
4: 815
Right 1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG 0: 1
1: 0
2: 11
3: 16
4: 130
1049744074_1049744079 4 Left 1049744074 8:144255731-144255753 CCAGTACTGATTCGGAAGCACAG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG 0: 1
1: 0
2: 11
3: 16
4: 130
1049744071_1049744079 11 Left 1049744071 8:144255724-144255746 CCCACCTCCAGTACTGATTCGGA 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG 0: 1
1: 0
2: 11
3: 16
4: 130
1049744068_1049744079 18 Left 1049744068 8:144255717-144255739 CCCACTTCCCACCTCCAGTACTG 0: 1
1: 0
2: 2
3: 68
4: 416
Right 1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG 0: 1
1: 0
2: 11
3: 16
4: 130
1049744069_1049744079 17 Left 1049744069 8:144255718-144255740 CCACTTCCCACCTCCAGTACTGA 0: 1
1: 0
2: 2
3: 48
4: 457
Right 1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG 0: 1
1: 0
2: 11
3: 16
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049744079 Original CRISPR GCGTGTGCACGCGCGTGGTG GGG Intronic
900215585 1:1479875-1479897 GCGTGTGCATGCCCGTGTGGGGG - Intronic
900325825 1:2108208-2108230 GCTGGTCCAAGCGCGTGGTGAGG + Intronic
900392021 1:2437834-2437856 GTGTGTGCACGTGTGTGGTTTGG - Intronic
900406151 1:2493921-2493943 GTGTGTGCAGGGGCGTGCTGTGG + Intronic
901762661 1:11480662-11480684 GTGTGTGCACGCGCGCGCTGGGG - Intronic
904541935 1:31239367-31239389 GCGTGTGCCCGGGCGGGGGGTGG - Intronic
905037687 1:34928710-34928732 GCGTGTGCGCGCGCGTGCGTTGG - Intronic
905488952 1:38328654-38328676 GCAGGTGCACGTGCATGGTGGGG - Intergenic
907526478 1:55056865-55056887 GCGTGCGCGCGCGCGCGTTGGGG + Intronic
908131975 1:61082974-61082996 GCGTGTGCCCGCGGGTGGGGGGG + Intronic
918995793 1:191757538-191757560 GTGTGTGCGCGCGCGTGGGTGGG - Intergenic
922648722 1:227318513-227318535 GCGTGTGCGCGCGCGTGTGCCGG - Intergenic
923072034 1:230574505-230574527 GGGTGTGCATGGGGGTGGTGTGG + Intergenic
1062934519 10:1375885-1375907 GTATGTGCACGTGTGTGGTGTGG - Intronic
1065816975 10:29491342-29491364 ACGTGTGCATGGGCGTGGTAGGG - Intronic
1067222771 10:44355974-44355996 GTGTGTGCACGCTAGGGGTGGGG + Intergenic
1068519797 10:58065621-58065643 GTGTGTGCGCGCGCGTGTTTAGG + Intergenic
1070399458 10:76040592-76040614 GCGTGTGCATGCTCGTGGTTGGG - Intronic
1071997567 10:91163008-91163030 GCGAGCGCGCGCGCGTGGGGCGG - Intronic
1073037294 10:100572960-100572982 GTGTGTGCACACGCATGGGGGGG + Intergenic
1073061307 10:100735442-100735464 GCGTGTGCACGCGTGTGCGCGGG + Intergenic
1073488413 10:103836639-103836661 GTGTGTGCACTCGTGTGTTGGGG - Intronic
1076874497 10:133209198-133209220 GCGTGTACACGTGTGTGGTTGGG + Intronic
1081488147 11:43547525-43547547 GCGTGTGCTCGGGGGTGGGGCGG - Intergenic
1083753616 11:64777796-64777818 GAGTGCGCACGCGCGCTGTGGGG - Intronic
1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG + Intronic
1085926178 11:81024662-81024684 TTGTGTGCATGCGTGTGGTGGGG + Intergenic
1087969975 11:104468493-104468515 GCGTTTGCAGGTGGGTGGTGAGG + Intergenic
1088566745 11:111180602-111180624 GTGCGCGCACGCGTGTGGTGGGG - Intergenic
1090806371 11:130204874-130204896 GGGTGGGCACGCGAGTGATGTGG + Intronic
1091225154 11:133952522-133952544 TTGTGTGCACGTGCGTGGAGTGG - Intronic
1092255326 12:6923972-6923994 GTGTGTGCACGCGCATTTTGGGG + Intergenic
1092908992 12:13128506-13128528 GCGTGTGCATGTGCGTGCTCAGG + Intronic
1105323263 13:19347223-19347245 GTGTGTGCGCGCACTTGGTGGGG - Intergenic
1105969910 13:25419083-25419105 GTGTGTGCACGCACGTGTTGAGG + Intronic
1110596483 13:77326401-77326423 GCGGGTGCACGCGCGGCATGGGG + Intronic
1114612754 14:24053047-24053069 GTGTGTGCACGCGCGTGTGCTGG - Intronic
1117252984 14:53953904-53953926 GTGTGTACACGCGCGTGGGCAGG - Intronic
1120497409 14:85254067-85254089 GTGTGTGTGCGCGCGTTGTGGGG - Intergenic
1122550171 14:102545110-102545132 AGGTGCGCACGCGCGGGGTGGGG - Intergenic
1122630449 14:103105148-103105170 GGGAGTGCGCGCGCGTGGAGGGG + Intronic
1123054746 14:105563989-105564011 GTGTGTGCACGTGTGGGGTGTGG + Intergenic
1123079186 14:105683548-105683570 GTGTGTGCACGTGTGGGGTGTGG + Intergenic
1129741243 15:77990656-77990678 GTGTGTGCGCGCGCATGTTGGGG - Intronic
1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG + Intronic
1132318633 15:100909038-100909060 GGGTTTGCACGCGCATGGAGGGG - Intronic
1132548307 16:543732-543754 GCCTGTGCATGCACGTGGTGGGG - Intronic
1135031935 16:19045468-19045490 GTGTGTGCATGTGTGTGGTGGGG - Intronic
1136623123 16:31443099-31443121 GTGTGTGCATGCGCATGGCGCGG - Intronic
1138383131 16:56617426-56617448 GCGGGTGCAAGCGCGGGGCGGGG + Intergenic
1138431808 16:56973564-56973586 GTGTGTGCACACGCATGGGGAGG + Intronic
1138940078 16:61779457-61779479 GTGTGTGTGCGCGCATGGTGAGG + Intronic
1142591562 17:1008436-1008458 CCGTGTGCGCGCGTGTGGTGAGG - Intronic
1143111940 17:4557914-4557936 GAGTGTGCACCCGCAGGGTGTGG - Exonic
1144126693 17:12209461-12209483 ACGTGGGCAAGCGGGTGGTGAGG + Intergenic
1144757148 17:17686603-17686625 GTGTGTGCACGCGCGCGCCGGGG + Intronic
1144816597 17:18039597-18039619 GGGCGCGCACGCGCGGGGTGGGG - Exonic
1148020854 17:44552530-44552552 TTGTGTGCAAGGGCGTGGTGGGG - Intergenic
1148550256 17:48545987-48546009 GTGTGTGCATGAGTGTGGTGGGG + Intergenic
1150282808 17:63939230-63939252 GCGTGTGAACGCATGTGGTAAGG - Exonic
1151227005 17:72655212-72655234 GCGTGTGCACGGGTGTGTGGAGG - Intronic
1152191879 17:78893071-78893093 GTGTGTGCACGCGTGTGCAGGGG + Intronic
1152245726 17:79183717-79183739 GCGTGTGCGCGCGTGTGTAGCGG + Intronic
1152530792 17:80917925-80917947 GGGTGTGCACGCCCGTGGCTTGG - Intronic
1152737852 17:82006077-82006099 GCGTGTGCACGTGTGTGCTTGGG + Intronic
1152737880 17:82006277-82006299 GCGGGTGCACGTGCGTGTTTGGG + Intronic
1153565670 18:6414926-6414948 GAGGGTGCACGCGCGGGGTGGGG + Intronic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1161614712 19:5263694-5263716 GCGTGGGGACACACGTGGTGGGG - Intronic
1161967683 19:7557325-7557347 GCGTGTGCGTGTGTGTGGTGCGG - Intronic
1163167594 19:15508582-15508604 GGGTGAGTGCGCGCGTGGTGAGG + Exonic
1165196515 19:34108214-34108236 GTGTGTCCACACGTGTGGTGGGG + Intergenic
1166799989 19:45450899-45450921 GCGTCTGCGCGGGCGTGGGGGGG - Intronic
925319678 2:2952454-2952476 GTGTGTGCATGTGCGTGTTGGGG - Intergenic
927000873 2:18792942-18792964 GTGTGTGCACGCGCGCGCAGTGG - Intergenic
929581802 2:43086054-43086076 GTGTGTGCACGTGTGTGGTGGGG - Intergenic
932355930 2:71068533-71068555 GCGTGCGCATGCGCGGGGCGGGG - Exonic
932625163 2:73291624-73291646 GGGTGCGCACGTGCGTGGTGAGG + Exonic
934685940 2:96321796-96321818 GCCTGTGCACGCGCCTGCGGAGG - Intergenic
936865340 2:117071576-117071598 AGGAGTGCACGCCCGTGGTGTGG - Intergenic
946865900 2:224040280-224040302 GAGTGTGCACGTGTGTGTTGGGG + Intergenic
947000693 2:225452780-225452802 ACGTGTGCATGTGTGTGGTGGGG - Intronic
948304739 2:236938265-236938287 GTGTGTGCATGTGTGTGGTGTGG + Intergenic
1172408022 20:34703909-34703931 GCAGGTGCACGGACGTGGTGTGG + Intronic
1172702799 20:36863280-36863302 GCGGGTGCAGGCGCGGGCTGGGG + Exonic
1172894128 20:38287317-38287339 GCCTGTGCACCCCCGGGGTGAGG - Intronic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175776347 20:61656235-61656257 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776353 20:61656255-61656277 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776359 20:61656275-61656297 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1179950827 21:44707992-44708014 GTGTGTGCACGCGCGGGGCGGGG - Intronic
1182149508 22:28018291-28018313 GCGTGTGTGCGCGCGCGGGGGGG + Intronic
1182149510 22:28018293-28018315 GTGTGTGCGCGCGCGGGGGGGGG + Intronic
1183343673 22:37295363-37295385 GTGTGTGCATGTGTGTGGTGGGG - Intronic
1184457172 22:44617226-44617248 CTGTGTGTACGCGTGTGGTGTGG - Intergenic
1184842332 22:47059271-47059293 GGGTGCGCACGCGTCTGGTGTGG + Intronic
1185105643 22:48868095-48868117 CCTGGTGCACGCGAGTGGTGGGG - Intergenic
1185188549 22:49418059-49418081 GCGGGTGCACGTGTGGGGTGTGG - Intronic
949522375 3:4868679-4868701 GCGTGCGCGTGCGCATGGTGGGG + Intronic
950316144 3:12003974-12003996 GCGTGTGTGCGCGCGTGATTGGG + Intergenic
953743181 3:45554348-45554370 ACGTGTGCATGTGTGTGGTGTGG - Intergenic
956369196 3:68539704-68539726 GTGTGTGCATGTGTGTGGTGGGG + Intronic
956438886 3:69260628-69260650 AGGAGTGCAGGCGCGTGGTGCGG + Intronic
960281247 3:115783980-115784002 CCGTGTGCGCGCGCGTGTCGGGG + Intergenic
964376416 3:156052346-156052368 AGGTGTGCAGGTGCGTGGTGTGG + Intronic
968637754 4:1690803-1690825 GTGTGTGCATGTGTGTGGTGGGG - Intergenic
968833191 4:2943901-2943923 GCGTGTGCACGCGCCACATGGGG - Intronic
968959330 4:3734975-3734997 GTGTGTGAAGGCGCGTGGTGTGG + Intergenic
971196299 4:24473464-24473486 GCGTGGACACGCGCGCGGGGGGG - Intergenic
974147774 4:57967567-57967589 AGGAGTGCAAGCGCGTGGTGTGG + Intergenic
980013735 4:127623901-127623923 GCGCATGCGCGCGCGTGTTGGGG - Intronic
982769002 4:159378468-159378490 AGGAGTGCAGGCGCGTGGTGTGG + Intergenic
982901097 4:161003610-161003632 GGGTGTGCACACGCTTGGGGTGG - Intergenic
1000665421 5:163989213-163989235 GTGTGTGCGCGCGCGTGTGGGGG + Intergenic
1000895230 5:166847275-166847297 GTGTGTGCACGTGTGTGTTGGGG + Intergenic
1002515252 5:179753225-179753247 GCGCGCGCGCGCGCGTGCTGGGG + Intronic
1011172763 6:84524307-84524329 GCATGTGCACGTGTGTGATGGGG + Intergenic
1012399523 6:98832711-98832733 GCGCGGGTGCGCGCGTGGTGGGG + Intergenic
1015002773 6:128239910-128239932 GCGTGTGCACACGCATGTAGTGG - Intronic
1021107625 7:16656540-16656562 GTGTGTGCGCGCGCGCGCTGGGG - Intronic
1022335087 7:29414668-29414690 ACGTGTGCATGCGTGTGTTGGGG - Intronic
1029715021 7:102321092-102321114 GGGCGTGCACACGCGTGGTTAGG + Intronic
1032709605 7:134450414-134450436 GTGTGTGCACGTGCCTGGAGGGG + Intronic
1036201532 8:6774715-6774737 GCGTGTGCACCTGTGTGCTGAGG - Intergenic
1036208894 8:6826337-6826359 GTGTGTGCACGCATGTAGTGTGG + Intronic
1038644714 8:29351930-29351952 GTTTGTGCACGCACGCGGTGGGG + Intergenic
1048293014 8:133194645-133194667 GCGTGTGTGCGTGTGTGGTGGGG + Intronic
1049366174 8:142237966-142237988 GCGTGGGCAGGCGGGTGGCGTGG - Intronic
1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG + Intronic
1050042078 9:1506611-1506633 GTGTGTGCACGTGTGTGGTGTGG + Intergenic
1051170258 9:14314134-14314156 GCGAGTGCGCGCGGGTGGCGGGG + Intronic
1053217987 9:36288687-36288709 ATGTGTGCAAGTGCGTGGTGTGG + Intronic
1058424541 9:104864972-104864994 GGCTGTGCACGTGCATGGTGTGG + Intronic
1058937114 9:109779943-109779965 GCGTGGACACGCGCTTGCTGGGG - Intronic
1062119923 9:134828983-134829005 GTGTGTGCGCGTGCATGGTGTGG - Intronic
1062325558 9:136010915-136010937 GTGTGTGCAGGGGTGTGGTGAGG - Exonic
1196653535 X:118193486-118193508 GCGTGGTGATGCGCGTGGTGAGG + Intergenic
1197655141 X:129108646-129108668 GTGTGTGCGCGCGCGCGGCGGGG + Intergenic
1202368195 Y:24180820-24180842 GCGTGTGCATGCGGGCCGTGGGG - Intergenic
1202372502 Y:24208362-24208384 GCGTGTGCATGCGGGCCGTGGGG + Intergenic
1202498283 Y:25461758-25461780 GCGTGTGCATGCGGGCCGTGGGG - Intergenic
1202502590 Y:25489297-25489319 GCGTGTGCATGCGGGCCGTGGGG + Intergenic