ID: 1049745715

View in Genome Browser
Species Human (GRCh38)
Location 8:144262452-144262474
Sequence GAGTGGGTACCGCGGGTGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 113}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049745705_1049745715 26 Left 1049745705 8:144262403-144262425 CCATGCCATGGCAGACGATGACA 0: 1
1: 0
2: 2
3: 8
4: 89
Right 1049745715 8:144262452-144262474 GAGTGGGTACCGCGGGTGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 113
1049745706_1049745715 21 Left 1049745706 8:144262408-144262430 CCATGGCAGACGATGACACTGCC 0: 1
1: 0
2: 1
3: 8
4: 103
Right 1049745715 8:144262452-144262474 GAGTGGGTACCGCGGGTGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 113
1049745707_1049745715 0 Left 1049745707 8:144262429-144262451 CCGTCGTCCGAGCCTGACGCAAA 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1049745715 8:144262452-144262474 GAGTGGGTACCGCGGGTGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 113
1049745709_1049745715 -7 Left 1049745709 8:144262436-144262458 CCGAGCCTGACGCAAAGAGTGGG 0: 1
1: 0
2: 1
3: 6
4: 120
Right 1049745715 8:144262452-144262474 GAGTGGGTACCGCGGGTGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049745715 Original CRISPR GAGTGGGTACCGCGGGTGGA AGG Exonic
900103570 1:972933-972955 GAGTGGCTGGTGCGGGTGGAGGG - Exonic
902063657 1:13666094-13666116 AAGTGGGAACCGCTGGTGAATGG + Intergenic
904648494 1:31986718-31986740 GAGTGGGTGCAGGAGGTGGAGGG - Intergenic
907310442 1:53535925-53535947 GTGTGGGTACGGGGGTTGGAGGG - Intronic
915572034 1:156750086-156750108 GAGTGGGTACAGAGCGAGGAAGG + Intronic
915607079 1:156959173-156959195 GATGGGGTACTGGGGGTGGAGGG + Intronic
1063365033 10:5485473-5485495 GGGTGGGAAGCGTGGGTGGATGG + Intergenic
1065563724 10:26988673-26988695 GAGTGGGTACAGCTGATAGAAGG + Intergenic
1065564597 10:26996076-26996098 GAGTGGGTACAGCTGATAGAAGG + Intronic
1069634661 10:69917956-69917978 GAGGGGGTCCCTGGGGTGGAAGG - Intronic
1077216199 11:1396192-1396214 GAGTGGGGGACGTGGGTGGAAGG - Intronic
1077216212 11:1396228-1396250 GAGTGGGGGACGTGGGTGGAAGG - Intronic
1077216225 11:1396264-1396286 GAGTGGGGGACGTGGGTGGAAGG - Intronic
1077248880 11:1551919-1551941 GAGTGGGGTGGGCGGGTGGATGG - Intergenic
1083033386 11:59615088-59615110 GAGTGGGTAACCCGAGGGGAGGG + Intronic
1083799599 11:65038832-65038854 GAGTAGGGACTGAGGGTGGAGGG + Intronic
1084114155 11:67032050-67032072 GAATGGGTAACGACGGTGGAAGG - Intronic
1084774149 11:71364499-71364521 GAGTGGGTAGGGTGGATGGATGG + Intergenic
1089660563 11:119982665-119982687 GGGTGGGAGCCGTGGGTGGATGG + Intergenic
1089905270 11:122031724-122031746 GAGTGGGGAGGGTGGGTGGAGGG + Intergenic
1091912016 12:4240382-4240404 GCATGGGTACTGGGGGTGGAAGG + Intergenic
1092776056 12:11946103-11946125 GAGTGGGTACAGAGGAAGGATGG + Intergenic
1102960709 12:117091679-117091701 GAGTGGGGACCACGGCTGGGAGG - Intronic
1105746030 13:23377659-23377681 GAGTGGGTACCGGGGAAGGAAGG - Intronic
1108519471 13:51233536-51233558 GAGTGGGTACCGGGGTGGGGCGG + Intronic
1109062467 13:57634614-57634636 GAGGGGGTACCACGGGTGAATGG + Exonic
1113851426 13:113420874-113420896 GAGCGGGTCCCGGGGGTGGGCGG - Intergenic
1113865256 13:113517796-113517818 AAGTGGGGACTGTGGGTGGAGGG + Intronic
1118707810 14:68496054-68496076 GAGTGGTTACTGCTGGGGGAAGG - Intronic
1122892157 14:104737253-104737275 GAGTGGCTGCCGAGGGTTGAGGG - Intronic
1123827913 15:24101656-24101678 GCGTGAGGGCCGCGGGTGGAGGG + Intergenic
1123842372 15:24261067-24261089 GCGTGAGGGCCGCGGGTGGAGGG + Intergenic
1123862032 15:24477658-24477680 GCGTGAGGGCCGCGGGTGGAGGG + Intergenic
1124249432 15:28097246-28097268 GCGCGGGTCCCGCGGGTGGCCGG + Intronic
1126640827 15:50824950-50824972 GAGTGGGTATCTCGGGTAGAGGG + Intergenic
1129351516 15:74958366-74958388 GACTGCGTAGGGCGGGTGGAAGG - Intronic
1135288428 16:21214007-21214029 GAGTGAGTAGCGCGGTGGGAAGG - Intronic
1141489540 16:84362884-84362906 CTGTGGGTACGGCGGGAGGACGG - Intergenic
1141610637 16:85179170-85179192 GAGTGGGTGCCAGGGGTGGGTGG - Intronic
1142959635 17:3544540-3544562 GGGTGGGCACAGTGGGTGGAGGG + Intronic
1143409970 17:6702914-6702936 AAGTGGGTACCGGGGCTGGAGGG - Intronic
1145029235 17:19492017-19492039 CAGTGGATCCTGCGGGTGGAAGG - Intergenic
1147333342 17:39712035-39712057 GAGTGGGTACCTCGGGCACAGGG - Exonic
1147907709 17:43833422-43833444 GGGTGGGTTGCGCGGGCGGAAGG - Intergenic
1152742261 17:82023491-82023513 GAGTGGGCTCCGCGGGCGGGAGG - Exonic
1157417768 18:47520374-47520396 GAGTGGGCACTGCGGGGGGGGGG - Intergenic
1159895486 18:73991781-73991803 GGGTGGCTACAGCAGGTGGAGGG - Intergenic
1160505057 18:79422451-79422473 GAGTGGGTGACGGGGGTGGTGGG + Intronic
1161400434 19:4064744-4064766 AGGTGGGTGCCGCGGGTGGCAGG + Intronic
1162044780 19:7991289-7991311 GATTGGGTCCCACGTGTGGAAGG - Intronic
1163005991 19:14397003-14397025 GAGTGGGTGCAGTGAGTGGAGGG + Intronic
1163061755 19:14766433-14766455 GAGTGGGTGCAGTGAGTGGAGGG - Intronic
1168267031 19:55228780-55228802 GAGTGGCTTCAGGGGGTGGAGGG + Exonic
1168307518 19:55443367-55443389 GAGTGGGGACCGCGGAGGGAGGG + Intergenic
945094092 2:206202857-206202879 GAGTGGGTACAGTGGATGGAGGG - Intronic
947821352 2:233073175-233073197 GAGTGGGTCTCGCTGGGGGAGGG + Intronic
948380144 2:237545039-237545061 GAGTGGGGACAGTGGGTGGAGGG + Intronic
948765735 2:240217758-240217780 GAGTGGGTACAGCTGATGGTGGG - Intergenic
1169248769 20:4044677-4044699 GGGTGGGTCCCGGGGATGGAGGG - Intergenic
1174834373 20:53842131-53842153 GAGTGGGTACCGGGGGATTAGGG + Intergenic
1175772497 20:61632593-61632615 GAGTGGGTGGAGTGGGTGGAGGG - Intronic
1176040855 20:63065120-63065142 GGGTGGGTGCCGCGTGTGGACGG - Intergenic
1179027739 21:37693811-37693833 AAGTGGGTACCGCTGGAGGGAGG - Intronic
1179714871 21:43281470-43281492 GAGTGGGGACCCCCGGGGGATGG + Intergenic
1181057634 22:20267672-20267694 ACGTGGGTACCGAGGGTGGGTGG - Intronic
1182866103 22:33606029-33606051 GAGTGGGGGCCGGGGGCGGAGGG + Intronic
1184731087 22:46371555-46371577 GGGTGGGTGCAGTGGGTGGATGG - Intronic
949154919 3:816326-816348 GAGTGGGTACAGCCCGTGGAGGG + Intergenic
950451640 3:13068728-13068750 GAGTGGGGGCCCCGGGTGCAGGG - Intronic
950719749 3:14874538-14874560 TAGTGGTTGCCGGGGGTGGAGGG + Intronic
953958167 3:47247252-47247274 GAATGGGTGCAGTGGGTGGAGGG - Intronic
957251380 3:77775158-77775180 GAGTGTTTAACGCAGGTGGATGG + Intergenic
958641563 3:96813576-96813598 GAGTGGGTGCCGCGAGGGGGCGG + Intergenic
959518020 3:107291382-107291404 GTTTGGGTCACGCGGGTGGATGG - Intergenic
961604520 3:128083693-128083715 CAGTGGTGGCCGCGGGTGGAGGG - Intronic
962379983 3:134890133-134890155 CAGTGGGTACCCCTGGTGGAAGG - Intronic
973907321 4:55545846-55545868 GAACGGGAAGCGCGGGTGGACGG + Intronic
976602715 4:86952947-86952969 GGGTGGGTAGTGGGGGTGGAGGG - Intronic
979675313 4:123402905-123402927 GATTGGGTACCGTGGGAGCAGGG + Exonic
981812238 4:148789188-148789210 GAGTGGGTACAGATAGTGGAAGG + Intergenic
985367954 4:189253397-189253419 GAGTGGGTAGGGTGGGAGGAGGG + Intergenic
985478810 5:94469-94491 GAGTGGGTGGCGGGGCTGGAGGG + Intergenic
985747752 5:1656730-1656752 AGGTGGGGACCGCAGGTGGAAGG - Intergenic
985907623 5:2853223-2853245 GAGTGGGCCCCCTGGGTGGAAGG + Intergenic
994438155 5:99764085-99764107 CAGTGGGTACAGCCTGTGGAAGG - Intergenic
997187730 5:131898916-131898938 CAGTGGGTACAGCCCGTGGAAGG - Intronic
998152468 5:139765146-139765168 GAGTGGGAACCAGGGGTGGGAGG - Intergenic
998287490 5:140877207-140877229 GAGTTGGTACCGCGGTCGGTGGG + Exonic
998607390 5:143648964-143648986 GAGTGGGTAGAGAGGGTGGCTGG + Intergenic
998928418 5:147153729-147153751 CAGTGGTTACCAGGGGTGGAAGG + Intergenic
1003139435 6:3457699-3457721 GAGTGGGTGCGGCGGGTCGCAGG - Intergenic
1003476577 6:6489153-6489175 GGGTGTGTCCCGCAGGTGGAGGG - Intergenic
1004513582 6:16303011-16303033 GAGTGGTGACCGTGGGTGGCAGG + Exonic
1006773948 6:36577496-36577518 GACTGGGTGCCGGGGGTGGGTGG - Intergenic
1009946620 6:70347985-70348007 GAGTGGGTGCCGCTGCTGGCTGG - Intergenic
1012700889 6:102455865-102455887 AGGTGGCTACCGGGGGTGGAAGG - Intergenic
1013117696 6:107115171-107115193 GAGTGGGGGCCGCGCGCGGAGGG + Intronic
1016630977 6:146230982-146231004 GAGTGGGTACCAAGGGTTGAAGG + Intronic
1017091030 6:150759271-150759293 CAGTGGGTACCGCATGTGAATGG + Intronic
1017739071 6:157389768-157389790 CAGTGGGTACAAAGGGTGGAAGG - Intronic
1017765757 6:157605792-157605814 GCGTGGGCACAGCGGGTGGGGGG + Intronic
1018788998 6:167131636-167131658 GAGTGGGCAGTGTGGGTGGAAGG - Intronic
1019618106 7:1975732-1975754 GAGTGGGGACCTCGGGTGAGTGG + Intronic
1027053151 7:75032219-75032241 GAGTGGGGACGGTGGGGGGAAGG + Intronic
1027953536 7:84850805-84850827 GAGAGGGTACATGGGGTGGAAGG + Intergenic
1032013602 7:128361764-128361786 GTGGGGGGACCGCGGGTGGCGGG - Intergenic
1033654279 7:143362555-143362577 GGGTGGGTACCGCGGCCGGGCGG - Exonic
1033681640 7:143601096-143601118 GGGTGGGTAGCGGGGGTGGATGG + Intergenic
1033703252 7:143860717-143860739 GGGTGGGTAGCGGGGGTGGATGG - Intronic
1035202030 7:157273745-157273767 GAGTGGGCACTGCGTGTGGAAGG + Intergenic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035652234 8:1276431-1276453 GAGTGGGTGCCGGGGAGGGAAGG + Intergenic
1035814757 8:2527372-2527394 CAGTGTGTAGCGCGGATGGATGG + Intergenic
1043080835 8:75763159-75763181 GAGTGGGTGTCGCCCGTGGAGGG + Intergenic
1047206935 8:122809938-122809960 GATTGGGTAGGGGGGGTGGAGGG + Intronic
1049310500 8:141931416-141931438 GAGGGGGTGCCTAGGGTGGATGG + Intergenic
1049593435 8:143472778-143472800 CCGTGGGTCCCGCGGGTGCACGG + Intronic
1049698804 8:143997264-143997286 AAGTGGGTCCAGAGGGTGGAGGG - Intronic
1049745715 8:144262452-144262474 GAGTGGGTACCGCGGGTGGAAGG + Exonic
1056071695 9:82993805-82993827 CAGTGGGTCCAGCTGGTGGAGGG - Intronic
1059435210 9:114271852-114271874 GAGGGGGTAACGAGGGTGGGCGG - Intronic
1062342126 9:136098410-136098432 CAGTGGGAACAGCGGGTGCAAGG - Intergenic
1187660754 X:21544716-21544738 CAGTGGGTACAGCCCGTGGAGGG + Intronic
1189324069 X:40102572-40102594 GAGTGGGAACCGCCGGGAGAGGG + Intronic
1192507345 X:71696819-71696841 GAGTGGGTGTCGGGGGTGCACGG + Intergenic
1192519351 X:71784733-71784755 GAGTGGGTGTCGGGGGTGCACGG - Intergenic