ID: 1049746928

View in Genome Browser
Species Human (GRCh38)
Location 8:144266933-144266955
Sequence AATCTTGGAGAGCTTGCGGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049746928_1049746931 -7 Left 1049746928 8:144266933-144266955 CCGACCGCAAGCTCTCCAAGATT 0: 1
1: 0
2: 1
3: 9
4: 94
Right 1049746931 8:144266949-144266971 CAAGATTGAGACGCTGCGCCTGG 0: 1
1: 2
2: 4
3: 114
4: 2823
1049746928_1049746934 17 Left 1049746928 8:144266933-144266955 CCGACCGCAAGCTCTCCAAGATT 0: 1
1: 0
2: 1
3: 9
4: 94
Right 1049746934 8:144266973-144266995 CTCCAGCTACATCTCGCACCTGG 0: 1
1: 0
2: 1
3: 18
4: 122
1049746928_1049746935 18 Left 1049746928 8:144266933-144266955 CCGACCGCAAGCTCTCCAAGATT 0: 1
1: 0
2: 1
3: 9
4: 94
Right 1049746935 8:144266974-144266996 TCCAGCTACATCTCGCACCTGGG 0: 1
1: 0
2: 0
3: 3
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049746928 Original CRISPR AATCTTGGAGAGCTTGCGGT CGG (reversed) Exonic
904106645 1:28090322-28090344 AATCTTGCAGAACTTGCTGATGG - Intergenic
909156469 1:72083926-72083948 ATTCTTGGTGAGCATTCGGTGGG + Intronic
910789074 1:91031949-91031971 AATCTTTGTGAGCTTGGGCTAGG + Intergenic
915973651 1:160371051-160371073 AATCTTGGAGAGCTTCTTGTCGG - Exonic
918670791 1:187213033-187213055 AATTTTGAAGAGCTAGCTGTTGG + Intergenic
919496593 1:198278998-198279020 AAACTTGGAGATCTTGGGCTTGG + Exonic
919569842 1:199234197-199234219 AATCTTGAAGTGCTTGAGGATGG - Intergenic
922112328 1:222572843-222572865 AATCTTTGCGACCTTGCAGTAGG + Intronic
924216836 1:241831421-241831443 AATCTTGGGGAGAATGTGGTGGG + Intergenic
1068190134 10:53640968-53640990 AATCTAGGAGACCTTGGGATTGG + Intergenic
1070465334 10:76717024-76717046 CATCTTGAAAAGCTTGTGGTGGG + Intergenic
1073564542 10:104523953-104523975 GATCTTGGATAGCTTGCCCTTGG + Intergenic
1074057996 10:109940018-109940040 AATCTTTAAGATCTTGAGGTAGG + Intergenic
1074199544 10:111222696-111222718 AAACTAGGAGGGCTTGGGGTGGG - Intergenic
1075548191 10:123372014-123372036 AATCTTTGTGATCTTGAGGTAGG - Intergenic
1075653739 10:124147489-124147511 GAGCTTGGGGAGCTTGGGGTGGG - Intergenic
1077833439 11:5901044-5901066 AATCTTGGAGAGATTGCATTTGG + Exonic
1080735318 11:35008439-35008461 GATCTTGGAGAGCTTGGAGAAGG + Intronic
1084642513 11:70434260-70434282 GGTCTTGGAGACCATGCGGTGGG + Intronic
1085257889 11:75186766-75186788 AATCTTGGAGAAGTTGCTATGGG - Intronic
1087035084 11:93747427-93747449 AGTCTTGAAGAGCTTGCTGGAGG + Exonic
1088306560 11:108416039-108416061 AATCTAGGTGAGCTTGGGTTTGG + Intronic
1092079601 12:5704485-5704507 AATCCTGGGGAGATGGCGGTGGG + Intronic
1094620711 12:32077874-32077896 AATGTTAGAGAGCTTGCGTAAGG + Intergenic
1096685582 12:53286327-53286349 AAGCTTGGAGAGCTTGGGTGAGG - Exonic
1100244144 12:92739520-92739542 AAGCTTGGACAGCTTACAGTGGG - Intronic
1100460943 12:94798676-94798698 AATTTTGAAGAGCTTGCTGAAGG - Intergenic
1101103401 12:101417532-101417554 AATCTTTGTGAGCTTGGGTTAGG - Intergenic
1108194825 13:47982739-47982761 AAGCTTGGGGAGCTTTGGGTTGG + Intronic
1108274910 13:48797834-48797856 AATCTAGGAGATTTTGTGGTAGG + Intergenic
1117808459 14:59519392-59519414 AATATTGAAGAGCCTGGGGTAGG + Intronic
1122261557 14:100526193-100526215 ACACATGGAGAGCTTGCTGTGGG + Intronic
1125571521 15:40722765-40722787 AATCTTAGTGACCTTGGGGTAGG + Intronic
1126685830 15:51248043-51248065 AATCTTAGAGAGTTTGAGGTAGG - Intronic
1132755582 16:1482944-1482966 ATTCTTGGAGATCTTGTGTTTGG + Intergenic
1133483917 16:6199958-6199980 AACCTTGGATAGCTGGCTGTCGG - Intronic
1136297113 16:29309869-29309891 AGTCTGGGAGACCTTGCAGTGGG + Intergenic
1139356330 16:66368986-66369008 AATCATGGAGGGCTTGCTGGAGG + Intronic
1140175369 16:72653540-72653562 AATCTTTGTGACCTTGTGGTAGG + Intergenic
1140810223 16:78569976-78569998 CATCCTGAAGAGCTTGCAGTGGG + Intronic
1149505111 17:57187833-57187855 AATATAGGAGAGCTTCCTGTAGG + Intergenic
1151548648 17:74808609-74808631 AAGCTTGGAGAGCTTGGGAAGGG + Intronic
1152107410 17:78338762-78338784 AATCTTGGGGGGCTTCCAGTTGG - Intergenic
1157459138 18:47870430-47870452 AATCTTAGAGATCTTGTGGGAGG - Intronic
1161297614 19:3527660-3527682 GATCTTGGAGATCTTGCGGGTGG - Exonic
1164875285 19:31680660-31680682 AATCTCAGAGAGCTTGAGGCTGG + Intergenic
1165165853 19:33855412-33855434 AATCTTTGTGAGCTTGGGATAGG + Intergenic
927725029 2:25415543-25415565 AATCTTGGATAGCTTCAGGATGG + Intronic
927948253 2:27150223-27150245 CAACTTGGAGAGCTTGGTGTCGG - Exonic
928187684 2:29127393-29127415 AATTTTGGAGGGGTTGGGGTAGG + Intronic
929913056 2:46108770-46108792 AATCTTGGTGACCTTGGGTTTGG - Intronic
931166351 2:59753449-59753471 AATCTGGAATAGCTTGGGGTAGG - Intergenic
936807864 2:116358848-116358870 AATGTTGGTGACCTTTCGGTGGG - Intergenic
938604904 2:132882374-132882396 AATCCTGTAGGGCTTGGGGTGGG - Intronic
939818511 2:146926904-146926926 AGGGTTGGAGAGCTTGCAGTAGG - Intergenic
941425527 2:165340204-165340226 CATCTTTGAGACCTTGGGGTAGG + Intronic
942555156 2:177165262-177165284 AATCTTGGAGAGTCTGTGGTCGG - Intergenic
944146469 2:196512631-196512653 ACACTTTGAGAGGTTGCGGTAGG - Intronic
1176545650 21:8196847-8196869 CATCTTGGAAAGCCTGCTGTTGG - Intergenic
1176564601 21:8379892-8379914 CATCTTGGAAAGCCTGCTGTTGG - Intergenic
1178493789 21:33070677-33070699 TATCTTGGAGAGCTTGCGGCCGG - Exonic
1203250521 22_KI270733v1_random:113084-113106 CATCTTGGAAAGCCTGCTGTTGG - Intergenic
949689392 3:6618113-6618135 CATCGTGAAGAGCTTGCTGTTGG + Intergenic
956073751 3:65483149-65483171 ATTTTTGGAGAGCTTGCTTTCGG + Intronic
959131153 3:102357619-102357641 GATCTTTGAGAGCATGGGGTTGG + Intronic
961561070 3:127730589-127730611 AGTCATGGAGAGCTTAGGGTGGG + Intronic
961853713 3:129848229-129848251 AATCTTAGTGACCTTGGGGTAGG - Intronic
963769755 3:149378204-149378226 CATCCTGCAGAGCTTGCTGTAGG - Intergenic
965102556 3:164319454-164319476 AATCTTTGAGATGTTGAGGTAGG + Intergenic
972297498 4:37754183-37754205 AATCTTGGATAGCTATTGGTTGG + Intergenic
976989471 4:91347063-91347085 AATCTTGGTGACCTTGAGTTTGG - Intronic
979862730 4:125714698-125714720 AATCTTGGATTGCTTACTGTTGG + Intergenic
986455942 5:7918584-7918606 AATCTTAGAGACCTTGAGCTTGG - Intergenic
988088695 5:26506684-26506706 ACTTTTGGAGAGCCTGGGGTTGG - Intergenic
990174790 5:53095550-53095572 AATCTTGGAGAGCTGAATGTGGG + Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
999731152 5:154477610-154477632 GATCTTGGAGAGCTTGGTGTCGG + Exonic
1006010153 6:31035837-31035859 TATCTTGGTGACCTTGAGGTAGG + Intergenic
1009764429 6:68051893-68051915 AATCTAGGAGAACTTGAGTTTGG - Intergenic
1015496621 6:133889729-133889751 CAGCTTGGAGAGCTTGGTGTCGG - Exonic
1018047055 6:159974810-159974832 AATCTTTGAGACCTTGGGGTAGG - Intronic
1019820769 7:3241186-3241208 CATCTGCGAGAGCTTGCTGTGGG + Intergenic
1021770979 7:24000858-24000880 AATCTTGGAGAGCCTGAAGTTGG - Intergenic
1021883205 7:25113533-25113555 AGTCTTGCAGAGATTGCTGTTGG - Intergenic
1023407435 7:39849516-39849538 AATCTTTGAGACCTTGTGCTGGG - Intergenic
1024008803 7:45250313-45250335 AATCTTTGAGACCTTGGGTTAGG + Intergenic
1025145825 7:56502649-56502671 AATCCTGGAGAGCTGGTGTTAGG - Intergenic
1025710969 7:63909335-63909357 AATCCTGGAGAGCTGGTGTTAGG - Intergenic
1030499335 7:110339898-110339920 CATCTTGGACAGCTTTCGGGAGG - Intergenic
1031081386 7:117260359-117260381 ATTCTTGGATAGTTTGCAGTGGG + Intergenic
1036450916 8:8866562-8866584 AAACTTTGAGAGGTTGAGGTGGG - Intronic
1039632071 8:39122948-39122970 AATCTTTGTGAGCTTGGGTTAGG - Intronic
1043327215 8:79067479-79067501 AATCTAGGTGAGCTTGAGTTTGG + Intergenic
1046352233 8:113030589-113030611 AATCTTTGAGATCTTGAGTTAGG + Intronic
1047955596 8:129973105-129973127 AATCTTGGAGAGCTCCTGGGTGG - Intronic
1049746928 8:144266933-144266955 AATCTTGGAGAGCTTGCGGTCGG - Exonic
1051546035 9:18276412-18276434 AATCTTAGAGAACTTGAGTTAGG - Intergenic
1054871232 9:70048781-70048803 ATTCTTGGAGACCATGCGGTTGG + Intronic
1060155097 9:121313995-121314017 GAGCTTGGCCAGCTTGCGGTTGG - Exonic
1203466923 Un_GL000220v1:96356-96378 CATCTTGGAAAGCCTGCTGTTGG - Intergenic
1185974921 X:4709738-4709760 AAACTTTGAGAGGTTGAGGTAGG + Intergenic
1190598689 X:52068845-52068867 AATCTAGGAGTGGTTGGGGTGGG + Intronic
1190610135 X:52185228-52185250 AATCTAGGAGTGGTTGGGGTGGG - Intronic
1193527117 X:82605803-82605825 AATCTTTAAGGGCTTGAGGTAGG - Intergenic
1197992977 X:132338259-132338281 AATCTTTGTGACCTTGGGGTAGG + Intergenic