ID: 1049746949

View in Genome Browser
Species Human (GRCh38)
Location 8:144267042-144267064
Sequence GGAAGAAGGCGGGCCCGGAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 315}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049746949_1049746955 -7 Left 1049746949 8:144267042-144267064 CCACTCCGGGCCCGCCTTCTTCC 0: 1
1: 0
2: 2
3: 37
4: 315
Right 1049746955 8:144267058-144267080 TTCTTCCACGCGGCGCGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049746949 Original CRISPR GGAAGAAGGCGGGCCCGGAG TGG (reversed) Exonic
900050357 1:591442-591464 GGAATAAGACGGGCCGGGTGCGG + Intergenic
900399378 1:2466777-2466799 GGCAGAATGCTGGCTCGGAGAGG + Intronic
900459307 1:2793944-2793966 AGAAGAAGGAGGGCGAGGAGGGG - Intronic
900618911 1:3578058-3578080 GGCAGAAGGCCAGCCCTGAGGGG + Intronic
901791898 1:11658210-11658232 GGGAGAAGGCGGCCACTGAGGGG + Intronic
901815380 1:11790629-11790651 GGAGGAAGGCGGGACAGGAGTGG + Exonic
902380123 1:16048840-16048862 GGAGGAAGCCGGGCTCAGAGAGG - Intronic
903177133 1:21587860-21587882 GGAGGAAGGCGGCCCAGGAAGGG + Intergenic
903656884 1:24954969-24954991 GGAAGAAGGTGGGCCAGGCCTGG - Intronic
904611651 1:31729123-31729145 GGGACAAGGAGGGCCAGGAGAGG - Intronic
904813970 1:33181772-33181794 GGGAGAAGGGGATCCCGGAGCGG + Intronic
905580737 1:39081505-39081527 GGAAGAAGACGGGCCCGTGGCGG - Intronic
906411823 1:45584653-45584675 GGAAGGAGGCTGGACCTGAGGGG + Intronic
907179123 1:52553753-52553775 GGAGGAAGGCCGGCCTGGAATGG + Intergenic
911050902 1:93670373-93670395 GGCAGAAGGCAGGCCTGGAAGGG - Intronic
911053952 1:93695125-93695147 GGAAGAAGGAAGCCCAGGAGGGG - Intronic
913671051 1:121097652-121097674 GAGAGCAGGCGGGCCCGGGGCGG - Intergenic
914022814 1:143885073-143885095 GGGAGCAGGCGGGCCCGGGGCGG - Intergenic
914239770 1:145845836-145845858 GGCAGAAGGGGGCCCCAGAGCGG + Intronic
914661301 1:149793017-149793039 GGGAGCTGGCGGGCCCGGGGCGG - Intronic
914702760 1:150149758-150149780 GGAAGAAGGCGGCTTCGAAGCGG - Intronic
916694450 1:167221484-167221506 GGGAGGCGGCGGGGCCGGAGCGG + Intronic
919764058 1:201115117-201115139 GGATGAAGGCTGGCTCGAAGGGG + Exonic
919989976 1:202702899-202702921 GCAAGGAGGGGGGCCTGGAGAGG - Intronic
920854132 1:209649919-209649941 GGAGGAAGGCGGGATGGGAGGGG - Intronic
921007445 1:211108612-211108634 GGAAGAAGACAGGGCCTGAGAGG + Intronic
922695344 1:227728503-227728525 GGAAGGAGGCGGGACCGGGGCGG - Intergenic
922867121 1:228869563-228869585 GCAAGGAGGCAGGCCCGGGGGGG - Intergenic
923868844 1:237969327-237969349 GGAAGAAGTTGGGCCAGGATAGG - Intergenic
924732479 1:246724508-246724530 GGGAGCAGGTGGACCCGGAGCGG + Exonic
1062774703 10:135490-135512 GGAAGGAGGCGGCACCGGAGGGG + Intronic
1062893086 10:1080306-1080328 GGAAGAAAGGGGGCCCAGAAAGG - Intronic
1063931878 10:11036928-11036950 GGAAGAAAGGGGGCATGGAGGGG - Intronic
1066733220 10:38451524-38451546 GGATGGAGCTGGGCCCGGAGAGG - Intergenic
1067557534 10:47283242-47283264 GCAAGAAGCCGGCCCCAGAGAGG + Intergenic
1067731170 10:48812478-48812500 GGAAGAAAGGGGGCCGGGTGCGG - Intronic
1068094565 10:52474410-52474432 GCAAGAAGGGAGCCCCGGAGAGG + Intergenic
1069117704 10:64528481-64528503 GGAGGAAGGCGGGGTGGGAGGGG - Intergenic
1069818435 10:71212980-71213002 GGGAGCATGGGGGCCCGGAGCGG + Exonic
1070414391 10:76175998-76176020 GGAATGAGCCGGGCCTGGAGAGG + Intronic
1071527522 10:86366845-86366867 GGAGGGAGGCGGGCAGGGAGGGG - Intergenic
1071564275 10:86663571-86663593 GGATGAAGGAGGGCCTGGTGGGG + Intronic
1072118704 10:92387436-92387458 GCAAGAAGGAGGGGCCTGAGTGG - Intergenic
1072656762 10:97335005-97335027 CCCAGGAGGCGGGCCCGGAGTGG - Intergenic
1072903500 10:99430321-99430343 TGAAGAGGGCGGCGCCGGAGAGG - Intronic
1073100250 10:101002685-101002707 GGAAGAAGGTGGGCCCAGGAGGG - Exonic
1074531424 10:114301302-114301324 GGTAGGAGGAGGGCCTGGAGAGG + Intronic
1075631563 10:124003787-124003809 GGAAGAGGGTGAGCCCTGAGTGG - Intergenic
1075638680 10:124048934-124048956 GGAAGATGGGGTGCCCGGACCGG + Intronic
1075686350 10:124367658-124367680 GGAAGGAGGTGGGCATGGAGGGG - Intergenic
1077179552 11:1206156-1206178 GGACCAAGGTGGGCCAGGAGGGG + Intergenic
1077329594 11:1978184-1978206 GGCAGACGGCGGGCCTAGAGAGG + Intronic
1077799912 11:5527216-5527238 TGAAGAAGGTTGGCCCTGAGAGG - Intronic
1078753378 11:14186321-14186343 GGAAGAAGGAGGATCAGGAGAGG + Intronic
1079259459 11:18864276-18864298 GGAAGAAGTCGGCCCCGGCCAGG + Intergenic
1081694952 11:45103222-45103244 GGGAGGAGGCAGGCCCGGCGGGG - Intronic
1082001182 11:47394520-47394542 AGAGGAAGGCGGGCCTGGAGCGG + Intergenic
1083618032 11:64035991-64036013 GCACGGTGGCGGGCCCGGAGCGG - Intronic
1083998679 11:66284464-66284486 GGAAGAAGGTGGACCCAGGGAGG - Intronic
1084151244 11:67289004-67289026 AGAGGAAGGCGGGGCCGGAGGGG - Intronic
1084516737 11:69641729-69641751 GGGAGAAGGGGGTCCGGGAGGGG + Intronic
1085306813 11:75490912-75490934 GGAAGCAGAGGGGCCAGGAGAGG + Intronic
1088253906 11:107885059-107885081 GGAAGATGGGGCACCCGGAGAGG + Intronic
1088578637 11:111296849-111296871 GGAAGAAGGCATGCAGGGAGGGG + Intergenic
1089113111 11:116072530-116072552 GGAGGATGGCTGGCCCAGAGGGG + Intergenic
1090094429 11:123729561-123729583 GGCAGAAGGCAGGCAAGGAGGGG - Intronic
1090202272 11:124865401-124865423 GGAAGGAGGAGGGCACGAAGAGG + Exonic
1090932377 11:131309835-131309857 GGAAGACGGGGGGCCAGGATGGG - Intergenic
1091041414 11:132284774-132284796 GGGAGAAGGCGGGGCCGGCCAGG + Intronic
1091154415 11:133360579-133360601 GGAAGGAAGCGGGGACGGAGGGG + Intronic
1202812573 11_KI270721v1_random:33363-33385 GGCAGACGGCGGGCCTAGAGAGG + Intergenic
1092002606 12:5044438-5044460 GGAAGAAGGCGATCCCGGCCTGG + Exonic
1096078401 12:48818609-48818631 GGGAGAAGGCGGGGGCGGCGAGG - Intronic
1096466275 12:51848906-51848928 GGAAGAAGCCGGGGGTGGAGGGG - Intergenic
1096522453 12:52191916-52191938 GGAAGCAGGAGGGCCCAGGGGGG + Exonic
1096670240 12:53194156-53194178 GGCAGAAGGCGGGCAGGGGGAGG - Exonic
1097690613 12:62731244-62731266 GGAAGTAGGTGGGACTGGAGTGG + Intronic
1100527337 12:95432125-95432147 GTCAGAAGGCAGGCACGGAGAGG + Intergenic
1102079401 12:110085888-110085910 GGAGGAAGGAGGGTCCTGAGAGG + Intergenic
1102969000 12:117151224-117151246 AGAAGGAGGCGGGACAGGAGCGG + Intronic
1103366666 12:120389145-120389167 GGAAGGAGGCGAGGCTGGAGTGG + Intergenic
1103463496 12:121123537-121123559 GGAGGAAGGAGGGTCCTGAGAGG - Intergenic
1103800392 12:123533862-123533884 GGCAGAGCGCGGGGCCGGAGAGG + Intergenic
1104289632 12:127455804-127455826 GGGAGAAGCCGGGGCCGGAAAGG + Intergenic
1104606563 12:130193726-130193748 GGATGAAGACGGGCCAGGCGCGG - Intergenic
1104857470 12:131908830-131908852 GCAGGCAGGCGGGCCCGGCGGGG + Intronic
1105739662 13:23310374-23310396 GGAAGAATTCAGGCCCGGCGCGG - Intronic
1105899304 13:24742189-24742211 GGAAGAAGGAGGGGCAGGACAGG + Intergenic
1107881583 13:44836842-44836864 GCAAGGAGGCTGGTCCGGAGTGG - Intergenic
1108063395 13:46553859-46553881 GGAAGAAGCGGGCCCTGGAGAGG + Intronic
1109370359 13:61414181-61414203 GGGGGAAGGCGGGGGCGGAGGGG - Intronic
1112320555 13:98403303-98403325 GGGAGAAGGGGGGCCCTTAGAGG + Intronic
1114707400 14:24741203-24741225 GGAAGATGGCAGGCCCAGAGTGG - Intergenic
1116806105 14:49495271-49495293 GGAAGAAGGCAGGCTCAGAAAGG - Intergenic
1117685062 14:58244727-58244749 GGAAAAAAGCGGGCCGCGAGAGG - Intronic
1117758986 14:59006241-59006263 TGCAGAAGGAGGGCCCTGAGAGG + Intergenic
1119432228 14:74575906-74575928 GGAAGAGGGAGGGCTCAGAGGGG - Intronic
1119650772 14:76381324-76381346 GGAGGCAGGCTGGCCCGGTGAGG - Intronic
1119859495 14:77925970-77925992 GGAAGAGGCAGGGCCTGGAGGGG - Intronic
1120993622 14:90398331-90398353 GGGGGAAGGCGGCCCCCGAGCGG - Intronic
1121454653 14:94030446-94030468 GGGAGAGGTCAGGCCCGGAGAGG + Intronic
1121751779 14:96363482-96363504 GGAAGAAGGCGGGGAGGGAGGGG + Exonic
1122155364 14:99747342-99747364 GGAGAAAGGCAGGCCCGGGGTGG + Intronic
1122316490 14:100828506-100828528 GGAAGGAGGGGGGCAGGGAGAGG - Intergenic
1122446877 14:101776031-101776053 GGAGGAAGGCGGGGGTGGAGTGG - Intronic
1122738128 14:103855491-103855513 GGCAGAAGGGAGGCCCCGAGGGG - Intergenic
1124431689 15:29613925-29613947 GGAAGAAGGCAGTCCTGGTGGGG - Intergenic
1125513956 15:40307729-40307751 GGAAGGAGGCCAGCCAGGAGGGG + Exonic
1125536246 15:40442189-40442211 GGACAAAGGCGGCGCCGGAGCGG + Intronic
1127868250 15:63048763-63048785 GGAAGCAGGAGGGCCCTGCGGGG - Intronic
1128134873 15:65255443-65255465 GGAAGAAAGGGGGCCCAGAAAGG + Intronic
1129326505 15:74802716-74802738 GGAGGAAGGAGGCCACGGAGCGG + Exonic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1132631507 16:919873-919895 GGAGGAAGGGGGTCCCGGGGCGG - Intronic
1133417347 16:5616750-5616772 GGGAGAAGGGGGGACAGGAGAGG - Intergenic
1133552191 16:6867426-6867448 GGAAGAAAGGGGGCCGGGTGTGG + Intronic
1133659094 16:7897461-7897483 GAAAGAAGGAGGGCCCGGCATGG - Intergenic
1135115244 16:19718238-19718260 GGAAGAAGCCGGAACCCGAGAGG - Exonic
1137617365 16:49855833-49855855 GGGAGAAGGGCTGCCCGGAGCGG - Intronic
1137618434 16:49859729-49859751 CGAAGAAGGAGAGCCCAGAGGGG - Intergenic
1138586384 16:57972916-57972938 GGAAAAAGGCGGGCATTGAGGGG + Intergenic
1139818620 16:69700104-69700126 GGAAGAAGGGAGGCAGGGAGGGG - Intronic
1140222915 16:73057617-73057639 GGAAGAAGGCCGGCCGGGCGAGG + Intronic
1141546053 16:84769951-84769973 GAAAGAAGGCGGGCCAGGTGTGG + Intronic
1141665395 16:85462964-85462986 GGCAGAAGACGGGCCCGGAGGGG - Intergenic
1141752107 16:85965434-85965456 GAAAGAAGGGGGCCCCTGAGAGG + Intergenic
1142173574 16:88634909-88634931 GGAAGGAGGCGGGGGCGGAGCGG + Intergenic
1142191712 16:88721185-88721207 GGAAGAAGGAGGGCCCAGCACGG - Exonic
1142223564 16:88866619-88866641 GGAGGAAGGTGGGCCAGGCGAGG + Intronic
1142261705 16:89045518-89045540 GGAAGAGGACGTGCCAGGAGAGG - Intergenic
1142850243 17:2701271-2701293 GGGAGAGGGCGGGCACTGAGCGG + Intronic
1142933799 17:3310610-3310632 GGAAGAAGAAGAGCTCGGAGAGG - Intergenic
1143624831 17:8103769-8103791 GGAAGGAGGTGGCCCCAGAGTGG + Intronic
1144062869 17:11598981-11599003 GGACGGAGGCGGGGCCAGAGGGG + Intronic
1144586604 17:16491527-16491549 GGAGGAAGGCTGGCCGGGTGAGG - Intronic
1144853103 17:18254021-18254043 GGAAGCAAGAGGGCCCAGAGGGG + Intronic
1146532448 17:33620900-33620922 GGAAGGGGGCGGGCTCAGAGAGG - Intronic
1146936000 17:36813072-36813094 GGAAGAAGGGGGGCTGAGAGGGG + Intergenic
1147432426 17:40380628-40380650 GAAAGAAGGCTGGCCAGGTGTGG - Intergenic
1147620663 17:41864780-41864802 GGAGGGCGGCGGGCGCGGAGAGG - Intronic
1147661837 17:42121087-42121109 GGAAGTGGGGGGGCCGGGAGCGG - Exonic
1148108692 17:45132581-45132603 GGAAGGGGGCGGGGCCGGGGCGG + Exonic
1148128388 17:45248250-45248272 GGCAGAAGGCGAGCCCCGCGTGG + Intergenic
1148157477 17:45432189-45432211 GGGAAGAGGTGGGCCCGGAGCGG - Intronic
1148261036 17:46183658-46183680 GGAAGGAGTAGGGCCGGGAGAGG + Intronic
1148542628 17:48492618-48492640 GGACGAAGGCGCGCCCGGAGAGG + Intergenic
1148664266 17:49362470-49362492 GGGAGAAGGCGGGGGCGGCGCGG - Exonic
1149995982 17:61406087-61406109 GGAAGGAAGCAGGCCCAGAGAGG - Intronic
1151301819 17:73232387-73232409 GGGAAGAGGCGGGCTCGGAGCGG + Intronic
1151420086 17:73991308-73991330 GGAAGAAGGTGGTCTCGGAGGGG - Intergenic
1151573348 17:74938238-74938260 GGGAGAATGGGAGCCCGGAGAGG + Intronic
1151573566 17:74939530-74939552 GGAAGAAGGAGTGTCCGGTGGGG + Intronic
1152634997 17:81427231-81427253 GGAAACAGGGGGGCCAGGAGGGG + Intronic
1152663384 17:81553176-81553198 GGAGGGAGGCGGGCCGGGGGCGG - Intronic
1152742200 17:82023287-82023309 AGAACAAGGCGCGCCGGGAGAGG - Exonic
1153284606 18:3446554-3446576 GGAAAAAGGAGGGCCGGGAAGGG + Intronic
1153997408 18:10454446-10454468 GGGAGGAGGGGCGCCCGGAGTGG + Intergenic
1158590537 18:58775110-58775132 GAAAGAAGGCAGGCCAGGTGCGG + Intergenic
1160594508 18:79964580-79964602 GGGCGGAGGCGGGGCCGGAGCGG - Exonic
1160719315 19:590382-590404 GCGAGGAGGCGGGCCCGGCGGGG + Exonic
1160753806 19:747594-747616 GGAGGAAGGAGGGCCCAGTGGGG - Exonic
1160830701 19:1103852-1103874 GGAAGAAGGCGGGGAAGGGGGGG - Intergenic
1160869246 19:1269503-1269525 GGGAGGGGGCGGGCCCGGGGTGG + Intronic
1161014929 19:1978785-1978807 GGAAGAGGGTGGCCCTGGAGGGG + Intronic
1161104327 19:2435858-2435880 TGAAGAAAGCGGGCCAGGCGTGG + Intronic
1161582921 19:5090640-5090662 GGGGGAAGGGGGGGCCGGAGGGG - Intronic
1161933302 19:7355648-7355670 TGGAGAAGGCCGGCCAGGAGTGG - Intronic
1162021652 19:7870820-7870842 GGAAGAGGGCGTCTCCGGAGGGG + Exonic
1162124426 19:8491609-8491631 GGAAGAAGGTGGGCAGGGAGAGG - Intronic
1162789653 19:13056176-13056198 GGAAGCAGGCGGGCAGGGGGAGG + Intronic
1163779731 19:19239996-19240018 GGAAGAAGGAGGGGGAGGAGTGG - Intronic
1163783574 19:19262854-19262876 GGAGGAAGGCGGGCGAGGCGGGG + Intergenic
1164037635 19:21468226-21468248 GGAAGAATGAGGGACCTGAGAGG - Intronic
1165706533 19:37980215-37980237 GGAACAAGGTGGGCAGGGAGAGG - Intronic
1166301741 19:41915102-41915124 GGAAGGAGGGGGACCCTGAGAGG - Intronic
1166520112 19:43474627-43474649 GGAAGGAGGGGGGCCAGGCGTGG + Intergenic
1166981971 19:46636244-46636266 GGGAGGAGGCGGGTCCGTAGGGG - Intergenic
1167348587 19:48961871-48961893 AGCAGACGGCGGGCCCGGCGTGG - Intergenic
1167379052 19:49128160-49128182 GGAAGAAGGCGGTCCGGAAGGGG + Intronic
1167533444 19:50033357-50033379 GGGAGAAGGTGAGCCCTGAGTGG + Intronic
1167884904 19:52492687-52492709 GGCAGAGGGCGGGGCCGGGGCGG - Intronic
1167889351 19:52527526-52527548 GGCAGAGGGCGGGGCCGGGGCGG - Intergenic
1167894475 19:52570145-52570167 GGCAGAGGGCGGGGCCGGGGCGG - Intronic
1167898520 19:52601170-52601192 GGCAGAGGGCGGGGCCGGGGCGG - Intronic
1167909561 19:52690606-52690628 GGCAGAGGGCGGGGCCGGGGCGG + Intergenic
1167921588 19:52786874-52786896 GGCAGAGGGAGGGCCCGGGGCGG + Intronic
1167926075 19:52821753-52821775 CGCAGAGGGCGGGGCCGGAGCGG + Intronic
1167930259 19:52857739-52857761 CGCAGAGGGCGGGGCCGGAGCGG + Intergenic
1167972436 19:53197004-53197026 GGCAGGGGGCGGGGCCGGAGGGG - Intergenic
1167987804 19:53333607-53333629 GGCAGAAGGCGGGGCCGGGGTGG - Intergenic
925204683 2:1996052-1996074 GGAAGAGGGAAGGGCCGGAGAGG + Intronic
925376165 2:3387890-3387912 GGACGAAGCTGAGCCCGGAGGGG + Exonic
926142146 2:10374054-10374076 GGAAGCAGGCGGGCCGGGCCAGG - Intronic
927335761 2:21922433-21922455 GGAAGGAGGAGGGCTTGGAGGGG - Intergenic
927818839 2:26244788-26244810 GGGAGGACGGGGGCCCGGAGAGG + Intronic
928024407 2:27728232-27728254 GGAAGAAGGGGTGACCCGAGGGG + Intergenic
928409247 2:31041662-31041684 GGAAGAAGGTGAGCAGGGAGGGG + Intronic
929748580 2:44685604-44685626 GGAAGAAAGCAGGCACAGAGAGG + Intronic
932651905 2:73566989-73567011 GGAGGATGGCAGGCCCAGAGAGG - Intronic
932659519 2:73640294-73640316 GGAAGAAGGTGGCCTCAGAGGGG - Intergenic
932666083 2:73699965-73699987 GGAAGAAGGTGGCCTCAGAGGGG - Intergenic
936234623 2:110732518-110732540 GGGAGGAGACGGGCCGGGAGGGG + Intergenic
937127209 2:119482318-119482340 GGAAGTGGGAGGGCCCAGAGAGG + Intronic
937373066 2:121315846-121315868 GGAAAAAGGCAGGCCAGGTGAGG + Intergenic
938671168 2:133588323-133588345 GGAAGAAGGAGGGAAGGGAGGGG - Intergenic
939498571 2:142952145-142952167 GGAAGGTGGCGGGTCAGGAGAGG - Intronic
941823156 2:169863091-169863113 GGGAGAAGGAGGGCAAGGAGAGG - Intronic
942748711 2:179264594-179264616 GGAGGAAGGCGGGCTGGGGGCGG + Exonic
946325432 2:218982399-218982421 GGGAGAGGCCGGCCCCGGAGGGG + Intronic
946422234 2:219571371-219571393 GTAAGGAGGCGAGCCGGGAGCGG - Intronic
947705323 2:232270173-232270195 GGAAGAAGAGGGGACCGGAGAGG - Intronic
948768755 2:240236624-240236646 GGAAGAAGGCCTGCTTGGAGGGG + Intergenic
948806006 2:240453637-240453659 GGAAGGGGGCGGGCGGGGAGAGG - Intronic
1168828855 20:833535-833557 GGAAGAAGGTGGGGCCGGCTGGG + Intergenic
1169194823 20:3677437-3677459 AGAAGAGGGCGGGCCAGGGGAGG - Intronic
1169931034 20:10833194-10833216 GGAAGCAGGAGGGGCAGGAGAGG + Intergenic
1172320700 20:33993608-33993630 GGAGGAAGGCGGGGCCAGGGTGG - Intergenic
1172409347 20:34710132-34710154 TGGAGAAGGCGGGCCAGGTGCGG + Exonic
1174116536 20:48230279-48230301 AGAAGGAGGCGGGCCAGGGGAGG - Intergenic
1174518679 20:51113248-51113270 GGAGGAAGGCGGGCGGGCAGAGG - Intergenic
1175238079 20:57526588-57526610 GGAGGGAGGAGGGCCTGGAGAGG + Intergenic
1175821635 20:61913260-61913282 GGAAGAAGGCTGGCTCGATGTGG + Intronic
1175974616 20:62704322-62704344 GGGAGAAGGATGGCCTGGAGGGG - Intergenic
1176161686 20:63651941-63651963 GGCAGGAGGCGGCCCTGGAGAGG + Intronic
1176290048 21:5038843-5038865 GGATGAAGGCTGGCCCCCAGAGG - Intronic
1176548886 21:8213198-8213220 GGAGGAAGGCGGGTCCGGAAGGG + Intergenic
1176556781 21:8257411-8257433 GGAGGAAGGCGGGTCCGGAAGGG + Intergenic
1176567817 21:8396233-8396255 GGAGGAAGGCGGGTCCGGAAGGG + Intergenic
1176575720 21:8440452-8440474 GGAGGAAGGCGGGTCCGGAAGGG + Intergenic
1179867206 21:44224796-44224818 GGATGAAGGCTGGCCCCCAGAGG + Intronic
1180754368 22:18150118-18150140 AGACCAAGGCGGGCCCGGAGCGG + Exonic
1180792815 22:18585988-18586010 GGGAGAAGGCTGGCCTGGACAGG - Intergenic
1181228921 22:21409331-21409353 GGGAGAAGGCTGGCCTGGACAGG + Intergenic
1181249730 22:21525534-21525556 GGGAGAAGGCTGGCCTGGACAGG - Intergenic
1181669478 22:24419481-24419503 GGAAGCAGGTGTGCCCTGAGGGG + Intronic
1181811545 22:25406223-25406245 GGAGGAAGGAGTGCCCGGAGAGG - Intergenic
1182586382 22:31346275-31346297 GGGAGAAGGCGGCGGCGGAGCGG + Intergenic
1183528065 22:38336070-38336092 GGGAGGAGGAGGGCCCGGGGTGG - Intronic
1184352775 22:43955492-43955514 GGCAGAAGGCGGGTCCGCGGTGG - Exonic
1184358137 22:43996172-43996194 GGAAGCAGCCGGGGCCGGTGAGG + Intronic
1184573641 22:45343826-45343848 GGAACAAGACAGGCCTGGAGCGG - Intergenic
1185390883 22:50561282-50561304 GGATGGAGGCTGGGCCGGAGTGG + Intronic
1203253771 22_KI270733v1_random:129506-129528 GGAGGAAGGCGGGTCCGGAAGGG + Intergenic
1203261827 22_KI270733v1_random:174585-174607 GGAGGAAGGCGGGTCCGGAAGGG + Intergenic
950729671 3:14947150-14947172 GGAAGAAGCCGGGCCCTGACTGG - Intergenic
950841931 3:15976162-15976184 GGAAGAATGAGGGCCAGAAGAGG + Intergenic
953694247 3:45145754-45145776 GGTAGAGGGCGAGCCTGGAGAGG + Intronic
953910909 3:46892667-46892689 GGAAGAAGGCGGGTCGGGCATGG - Intronic
954082549 3:48221151-48221173 GGAAGCAGGAGAGCCCTGAGAGG + Intergenic
954142179 3:48613762-48613784 GGAAGCAGGCAGGCCGGGTGCGG - Intergenic
959668478 3:108947971-108947993 GGAAGAAGGGGGACCCTGGGAGG - Intronic
960536964 3:118825426-118825448 GGAAGAACGAGGGGCTGGAGAGG - Intergenic
960637177 3:119795306-119795328 GGAAGAGGGTGGGGCAGGAGAGG + Intronic
962311809 3:134332173-134332195 GGATGAAGGAGGGTCCTGAGAGG - Intergenic
962728768 3:138260227-138260249 GGAAGAAGGCGGGTGAGGAGAGG - Intronic
963534694 3:146513133-146513155 GGAAGAAGGAGGGGAGGGAGGGG - Intergenic
968235517 3:197028469-197028491 GGAAGACGGCAGGCACAGAGGGG + Intronic
968413294 4:407252-407274 AGAATAAGGCGGGCCGGGCGCGG + Intergenic
975622051 4:76306162-76306184 GGAGGACGGCGGGCGCGGTGCGG - Intronic
976115639 4:81722969-81722991 GGAGGCAGGTGGGCCCAGAGAGG - Intronic
976629184 4:87219995-87220017 GGAAGAGGGCAGGCGCGGTGCGG - Intronic
976885590 4:89979769-89979791 GGAAGAAGATGGGCCGGGTGCGG - Intergenic
977716005 4:100184742-100184764 GGAGGATGGTGGGCCTGGAGAGG - Intergenic
978491478 4:109315795-109315817 GGAAGAAGGGAGGCCTGGATTGG - Intergenic
980659027 4:135832092-135832114 GCAAGAAGGCAGACCAGGAGAGG + Intergenic
984814672 4:183825346-183825368 GGAGGAAGGTGGGCCGGGAGCGG + Intergenic
985872345 5:2567114-2567136 GGAAGAAGGGAGGCCCAGGGAGG + Intergenic
985982597 5:3483636-3483658 GGAAGCAGGTGGGCCAGGGGAGG - Intergenic
986018539 5:3779538-3779560 GGAGGAGGGCTGGCCCGGAGTGG + Intergenic
989370626 5:40703615-40703637 GGAAGAGGCCGGGCACGGTGTGG + Intergenic
993903459 5:93599290-93599312 GGAAGAAGGGGTGCCTGCAGGGG + Intergenic
997103585 5:130994598-130994620 GGAGGTAGGCGTGCCGGGAGGGG - Intergenic
997526940 5:134559693-134559715 GGAAGGAGGTGGGCCCTGTGTGG + Intronic
997602866 5:135152276-135152298 GGGAGAAGGAGGGCCAGGAGAGG + Intronic
998095450 5:139393575-139393597 GGAAGAAGGCCGGCGGGGACGGG + Exonic
999375013 5:151080857-151080879 GTAAGCCGGCCGGCCCGGAGCGG - Intronic
1000282330 5:159792984-159793006 ACAAGAAGGCGGGGCCGGGGCGG + Intergenic
1001083456 5:168683745-168683767 AGAGGAAGGCAGGCCCGCAGAGG - Intronic
1001191552 5:169637213-169637235 AGGAGAGGGCGGGCCCTGAGAGG + Intergenic
1002191898 5:177482717-177482739 AGAAGAAGGCAGGGCTGGAGAGG - Intergenic
1002718941 5:181246491-181246513 GAAAGAGGGCGGCCCCGGAGCGG - Intronic
1004743075 6:18482060-18482082 GGAAGAAGGAGGGCTCTGGGCGG - Intergenic
1005832399 6:29681162-29681184 GGAAGAGGGCGGGGCCGGGGTGG - Intergenic
1007327094 6:41071366-41071388 GGAGGAAGGGGTGCCGGGAGAGG - Intronic
1007902508 6:45423749-45423771 GGAGGAAGGCGGGGCCGCTGGGG + Intronic
1008988845 6:57578964-57578986 GGAAGGAGGTGGGCCGGGCGCGG - Intronic
1009436226 6:63621295-63621317 GGAAGATGGTGTGCCTGGAGAGG - Intergenic
1009450983 6:63800512-63800534 GGAAGAGGCTGGGCGCGGAGTGG + Intronic
1010932500 6:81819585-81819607 GGAAGAAGGCTGGGGCAGAGTGG - Intergenic
1012415207 6:99005601-99005623 GGAAGGAGGTGAGCCCAGAGGGG - Intergenic
1014553106 6:122811930-122811952 GGAAAAAAGGGGGCCGGGAGCGG + Intergenic
1016940902 6:149482232-149482254 GGAAGAAGCGGGGACAGGAGTGG + Intronic
1017834901 6:158168274-158168296 GGCGGGAGGCGGGCCCAGAGCGG - Intergenic
1018219095 6:161560831-161560853 GAAGGAAGGTGGGCCTGGAGAGG - Intronic
1018422348 6:163650308-163650330 GGAAGGAGGTGGGCCAGCAGGGG + Intergenic
1018669745 6:166168334-166168356 GGAGGGAGGCGCGCCTGGAGCGG - Exonic
1019249147 6:170731235-170731257 GGAATAAGACGGGCCGGGTGCGG - Intergenic
1019695611 7:2444506-2444528 GGAACAAGGCAGGCCAGGAGGGG - Intergenic
1019828088 7:3300799-3300821 GGAATAGGGCGCGCCCCGAGAGG - Intergenic
1022504327 7:30901035-30901057 GGCAGAAAGAGGGCCAGGAGGGG - Intergenic
1025976980 7:66377426-66377448 GGCAGGAGCCGGGCCTGGAGCGG + Intronic
1026045669 7:66904065-66904087 GCAAGGAGCTGGGCCCGGAGAGG - Intergenic
1026046025 7:66905744-66905766 GGGAGAAGCCGGGCCTGGTGAGG - Intergenic
1026185457 7:68079568-68079590 GGAAGAAGGCAAGACTGGAGGGG + Intergenic
1026923818 7:74174825-74174847 GAAAGAGGCCGGGACCGGAGCGG - Intronic
1027202493 7:76072597-76072619 GGCACGAGCCGGGCCCGGAGAGG + Intergenic
1030538450 7:110798646-110798668 GGAAGAAAGCGGGGGTGGAGGGG + Intronic
1030984799 7:116229167-116229189 GGAGGAAGGTGAGCCCAGAGAGG - Intronic
1031604094 7:123748517-123748539 GGAAGGAGGCGGGAGCGGCGCGG - Intronic
1032172901 7:129600562-129600584 GGAAGAAGGAAGGACAGGAGAGG - Intergenic
1033148353 7:138890969-138890991 AGATGAAGGCGGGCCCAGTGGGG - Intronic
1034419741 7:150983389-150983411 AGAAGAAGGAGGGCTCTGAGTGG + Intergenic
1034425807 7:151013533-151013555 GGGAGGAGGCGGGCCTAGAGGGG - Intronic
1035285876 7:157806988-157807010 AGAAGGAGGTGGGCCCTGAGGGG - Intronic
1037336534 8:17797666-17797688 GGAAGAAGGCAGGCCCCGGAGGG - Intronic
1039559774 8:38503794-38503816 GGAAGCGGGCAGGGCCGGAGTGG - Intergenic
1040517231 8:48144988-48145010 GGAAGAAAGAGGGCCGGGCGCGG - Intergenic
1041751491 8:61265787-61265809 GAAAGAAGGCAGGACCTGAGTGG - Intronic
1042905277 8:73766173-73766195 GGAGGAAGGCGGGAAGGGAGAGG + Intronic
1043515556 8:80991745-80991767 GGAAGAAGGGGTGCCAGGGGAGG - Intronic
1044070818 8:87757319-87757341 GGAAAAAAGCAGGCCAGGAGGGG + Intergenic
1045432335 8:102124905-102124927 GGAGGAAGGAGGGGCAGGAGAGG - Exonic
1045500359 8:102739938-102739960 GGAAGACTGTGGGCCCGGAGGGG - Intergenic
1049032654 8:140048998-140049020 GAAGGAAGGCGGGCCTGCAGGGG + Intronic
1049422275 8:142522248-142522270 GGAAGAACGAGGGCCCAGAGGGG - Intronic
1049654480 8:143791687-143791709 GGAAGAAGGCAGGGCCGCAAAGG + Exonic
1049709812 8:144058414-144058436 GGCAGCAGGCGGGCCATGAGGGG + Intronic
1049746949 8:144267042-144267064 GGAAGAAGGCGGGCCCGGAGTGG - Exonic
1049762087 8:144336349-144336371 GGAAGAAGAGGGATCCGGAGGGG - Intergenic
1050151368 9:2622085-2622107 GGAAGAAGGTGGGGGCGGGGAGG - Exonic
1051140561 9:13974694-13974716 GGAAGAAGGGGGGTCAAGAGGGG - Intergenic
1051356518 9:16244107-16244129 GGAAGAAGGCGTGGCCGTGGAGG - Intronic
1052250845 9:26395355-26395377 GGAAGATGGCATGCCCTGAGAGG - Intergenic
1057572294 9:96213913-96213935 GGAAAAAGGCGGGGCAGGGGTGG - Intergenic
1060839983 9:126785502-126785524 GGAAGAAGGCTGGCAGGAAGCGG - Intergenic
1061802804 9:133121294-133121316 GGAAGAGGGTGGGGCCGGGGAGG + Intronic
1061852504 9:133424312-133424334 GGAAGGAGGGCGGCCTGGAGGGG - Exonic
1062011359 9:134268612-134268634 GGGAGCTGGCGGGGCCGGAGGGG + Intergenic
1062494994 9:136827458-136827480 GAAAGCAGGCGGGACTGGAGGGG - Intronic
1203470171 Un_GL000220v1:112654-112676 GGAGGAAGGCGGGTCCGGAAGGG + Intergenic
1203477992 Un_GL000220v1:156626-156648 GGAGGAAGGCGGGTCCGGAAGGG + Intergenic
1187454683 X:19430890-19430912 GGATAAAGGAGGGCTCGGAGGGG - Intronic
1189234445 X:39476741-39476763 GGAAGAAGCCGGCTGCGGAGGGG + Intergenic
1189284457 X:39841460-39841482 GGAAGAAGGAGGACCAGGAAGGG + Intergenic
1189724542 X:43954991-43955013 GGAGGAAGGAGGGGCTGGAGGGG - Intronic
1190213823 X:48467434-48467456 GGAGAAAGGCAGGCCGGGAGGGG + Intronic
1190570681 X:51778694-51778716 GGAAGAAGTTGGTCCCGGTGAGG + Intergenic
1192033869 X:67543954-67543976 GCAAGGAGGCCGGCCCGGTGGGG + Intergenic
1195235214 X:102890210-102890232 GGAAGAAGCCAGGCATGGAGAGG + Intergenic
1195323871 X:103742592-103742614 GAAAGAATGGGGGCCTGGAGTGG - Intergenic
1196765152 X:119236226-119236248 GGGAGGAGGCGGGGCCTGAGGGG - Intronic
1198051395 X:132956362-132956384 GGAAGAATGCGGGCGCCGAAAGG + Intronic
1199972381 X:152870841-152870863 GGATGGTGTCGGGCCCGGAGTGG + Intergenic
1200147818 X:153935458-153935480 GGGAGAGGGCGGGGCCGCAGGGG - Intronic
1200866266 Y:8047003-8047025 GGAAGAAGGCCAGACAGGAGAGG - Intergenic