ID: 1049747506

View in Genome Browser
Species Human (GRCh38)
Location 8:144269231-144269253
Sequence CAGTGGGCACAGAGAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049747503_1049747506 -4 Left 1049747503 8:144269212-144269234 CCATTGAGTGGTGTGAGATCAGT 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG No data
1049747499_1049747506 23 Left 1049747499 8:144269185-144269207 CCATTAAAACCCTGCAGGTGACA 0: 1
1: 0
2: 1
3: 12
4: 188
Right 1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG No data
1049747500_1049747506 14 Left 1049747500 8:144269194-144269216 CCCTGCAGGTGACAATTACCATT 0: 1
1: 0
2: 1
3: 17
4: 121
Right 1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG No data
1049747501_1049747506 13 Left 1049747501 8:144269195-144269217 CCTGCAGGTGACAATTACCATTG 0: 1
1: 0
2: 0
3: 16
4: 82
Right 1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049747506 Original CRISPR CAGTGGGCACAGAGAGAAGA AGG Intronic
No off target data available for this crispr