ID: 1049748295

View in Genome Browser
Species Human (GRCh38)
Location 8:144272225-144272247
Sequence CAGAGCTACAACTTCCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049748282_1049748295 22 Left 1049748282 8:144272180-144272202 CCACCAGTGCTCACCCCTCCTCG 0: 1
1: 0
2: 2
3: 52
4: 1436
Right 1049748295 8:144272225-144272247 CAGAGCTACAACTTCCAGGTGGG No data
1049748281_1049748295 23 Left 1049748281 8:144272179-144272201 CCCACCAGTGCTCACCCCTCCTC 0: 1
1: 0
2: 4
3: 29
4: 354
Right 1049748295 8:144272225-144272247 CAGAGCTACAACTTCCAGGTGGG No data
1049748289_1049748295 -2 Left 1049748289 8:144272204-144272226 CCTGCTCTGAGCCCCACAACTCA 0: 1
1: 0
2: 3
3: 23
4: 254
Right 1049748295 8:144272225-144272247 CAGAGCTACAACTTCCAGGTGGG No data
1049748288_1049748295 4 Left 1049748288 8:144272198-144272220 CCTCGGCCTGCTCTGAGCCCCAC 0: 1
1: 0
2: 4
3: 49
4: 413
Right 1049748295 8:144272225-144272247 CAGAGCTACAACTTCCAGGTGGG No data
1049748280_1049748295 29 Left 1049748280 8:144272173-144272195 CCGACACCCACCAGTGCTCACCC 0: 1
1: 0
2: 3
3: 33
4: 352
Right 1049748295 8:144272225-144272247 CAGAGCTACAACTTCCAGGTGGG No data
1049748285_1049748295 9 Left 1049748285 8:144272193-144272215 CCCCTCCTCGGCCTGCTCTGAGC 0: 1
1: 0
2: 3
3: 46
4: 404
Right 1049748295 8:144272225-144272247 CAGAGCTACAACTTCCAGGTGGG No data
1049748287_1049748295 7 Left 1049748287 8:144272195-144272217 CCTCCTCGGCCTGCTCTGAGCCC 0: 1
1: 0
2: 5
3: 36
4: 398
Right 1049748295 8:144272225-144272247 CAGAGCTACAACTTCCAGGTGGG No data
1049748284_1049748295 19 Left 1049748284 8:144272183-144272205 CCAGTGCTCACCCCTCCTCGGCC 0: 1
1: 0
2: 4
3: 90
4: 1329
Right 1049748295 8:144272225-144272247 CAGAGCTACAACTTCCAGGTGGG No data
1049748286_1049748295 8 Left 1049748286 8:144272194-144272216 CCCTCCTCGGCCTGCTCTGAGCC 0: 1
1: 0
2: 4
3: 33
4: 426
Right 1049748295 8:144272225-144272247 CAGAGCTACAACTTCCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049748295 Original CRISPR CAGAGCTACAACTTCCAGGT GGG Intronic
No off target data available for this crispr