ID: 1049748530

View in Genome Browser
Species Human (GRCh38)
Location 8:144273053-144273075
Sequence CGCTGCTTGTGGAGGGCGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049748530_1049748539 1 Left 1049748530 8:144273053-144273075 CCGGGCGCCCTCCACAAGCAGCG 0: 1
1: 0
2: 1
3: 19
4: 123
Right 1049748539 8:144273077-144273099 GGGGAGGGCCGTTCGCTCGCCGG No data
1049748530_1049748542 17 Left 1049748530 8:144273053-144273075 CCGGGCGCCCTCCACAAGCAGCG 0: 1
1: 0
2: 1
3: 19
4: 123
Right 1049748542 8:144273093-144273115 TCGCCGGGAAACCTGAGCCGAGG No data
1049748530_1049748540 2 Left 1049748530 8:144273053-144273075 CCGGGCGCCCTCCACAAGCAGCG 0: 1
1: 0
2: 1
3: 19
4: 123
Right 1049748540 8:144273078-144273100 GGGAGGGCCGTTCGCTCGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049748530 Original CRISPR CGCTGCTTGTGGAGGGCGCC CGG (reversed) Intronic
900090737 1:919339-919361 GGCTGCCTGTGCAGGGCCCCCGG + Intergenic
900523593 1:3117652-3117674 CCCTACTTCTGGAGGGGGCCCGG + Intronic
900744069 1:4349116-4349138 TGCTGCTTCTGTAGGGGGCCGGG + Intergenic
904941036 1:34164999-34165021 CGGCGCTTGTGCCGGGCGCCGGG - Exonic
905959878 1:42035251-42035273 GGCTGCTGCTGCAGGGCGCCCGG - Intronic
907306721 1:53517394-53517416 CGGTGTTTGTGGAGGGAGCCTGG + Intronic
910429021 1:87143031-87143053 CGCTGTGTGAGGAGGGCGGCAGG - Intronic
914490878 1:148149460-148149482 CGCTGTGGGTGGAGGGCGCCGGG + Intronic
921389656 1:214605758-214605780 CGCTGTGGGTGGAGGGCACCAGG - Intronic
923469718 1:234279687-234279709 GGCTGCCTGTGGAGTGGGCCTGG + Intronic
1067111663 10:43405872-43405894 CGGTTCTTGTGGAGGGCAACAGG - Intronic
1071336970 10:84608264-84608286 CGCTGATTCAGGAGGGTGCCCGG + Intergenic
1075644774 10:124090378-124090400 CCCTGCTAGTGGAGGGGGCTGGG - Intronic
1076393594 10:130121894-130121916 CCCTGCCTGTGCCGGGCGCCGGG - Intergenic
1076674028 10:132138420-132138442 CGGTGTATGTGGAGGGCGCTGGG + Intronic
1076798479 10:132810017-132810039 CCTTGCTTGGGGAGGGGGCCAGG + Intronic
1077198547 11:1293642-1293664 GGCTGCCTGTGGTGGGCTCCAGG + Intronic
1078526688 11:12106813-12106835 TGCTGCTTGTGGAGGTTGTCTGG - Intronic
1081484183 11:43515361-43515383 CGCTGACTGTGGAGGGGGCAAGG + Intergenic
1090385391 11:126355397-126355419 CACTGCCTGTGAATGGCGCCAGG - Intergenic
1097245329 12:57604868-57604890 CGGTGGGTGTGGGGGGCGCCGGG - Intronic
1104774994 12:131385763-131385785 CGGTGCTTGTGGAGGACATCTGG - Intergenic
1106584758 13:31047329-31047351 AGCTGCTTGCGCAGGGCCCCTGG - Intergenic
1108396768 13:49997322-49997344 AGCGGCCTGCGGAGGGCGCCGGG + Intronic
1109821491 13:67662652-67662674 CGGTGATTGTGAAGGGTGCCAGG + Intergenic
1110899558 13:80803336-80803358 TTCTGCTGGTGGAGGGGGCCTGG - Intergenic
1112506660 13:99980194-99980216 CGCTCCTTGTGGCGCGCTCCCGG + Intergenic
1113654803 13:112061401-112061423 CGGTGCTTGGAGGGGGCGCCGGG - Intergenic
1113905563 13:113817653-113817675 GCCTGGTTGTGGAGGGTGCCAGG + Intergenic
1114235204 14:20817413-20817435 CCCAGCTTGTGGAGGGGGCTGGG - Intergenic
1114409641 14:22488669-22488691 TGCTGCCTGTGGAGTGCGCTGGG + Intergenic
1114654716 14:24309375-24309397 GGTTGCTTGGGGAGGGCACCAGG - Intronic
1123076478 14:105669794-105669816 CGCTCCTGGAGGAGGGCACCAGG + Intergenic
1123739818 15:23225954-23225976 CGCTGTGGGTGGAGGGCGCCGGG - Intergenic
1124291043 15:28454927-28454949 CGCTGTGGGTGGAGGGCGCCGGG - Intergenic
1125506304 15:40269732-40269754 CTCTGCTTGTGCTGGGCTCCTGG + Intronic
1127117437 15:55742617-55742639 CGCTGCTTGGGCAGGGCTGCGGG - Intronic
1127488173 15:59438190-59438212 CGCTGGCTGAGCAGGGCGCCCGG - Exonic
1132785916 16:1656918-1656940 CGCTGCTTGTGGAGGGCGGTGGG - Exonic
1136707719 16:32202716-32202738 CGCTGTGGGTGGAGGGCGCCGGG + Intergenic
1136760190 16:32726694-32726716 CGCTGTGGGTGGAGGGCGCCGGG - Intergenic
1136807914 16:33143692-33143714 CGCTGTGGGTGGAGGGCGCCGGG + Intergenic
1137434975 16:48447603-48447625 CTCTGCTGGTGTTGGGCGCCTGG - Intronic
1139392258 16:66612420-66612442 TGCTGCCTGTGGAGGGCCTCAGG + Intronic
1141038934 16:80655048-80655070 AGCTGCTTTTGGTGGGCGCAGGG + Intronic
1142236333 16:88924317-88924339 CGGAGCTTGTGCAGGGCGACTGG - Intronic
1203062345 16_KI270728v1_random:987016-987038 CGCTGTGGGTGGAGGGCGCCGGG - Intergenic
1143874216 17:9979580-9979602 TGCTGCCTGTGGAGGGTCCCAGG + Intronic
1145191499 17:20844155-20844177 CGCTGTGGGTGGAGGGCGCCGGG + Intronic
1145898241 17:28473339-28473361 GGCTGCCTGTGGAGGGTGGCTGG + Exonic
1146063131 17:29617419-29617441 CCCTGCGGGTGGGGGGCGCCTGG + Intronic
1149460584 17:56826972-56826994 CACAGCTTGTGCAGAGCGCCAGG - Intronic
1151605326 17:75131776-75131798 CGCTGCTTCCGGAGTCCGCCGGG + Exonic
1152770250 17:82163137-82163159 CGCTGCTGGGGGAGAGCGCGTGG - Intronic
1154198142 18:12280944-12280966 CTCTGCTGCTGGAGGGGGCCTGG - Intergenic
1156368578 18:36451994-36452016 TGCTGCTTGTGGAGGGCAAAGGG - Intronic
1160394484 18:78561848-78561870 GGCTGCTTGTGGAAGGGTCCAGG - Intergenic
1160535790 18:79590641-79590663 AGCTGCTTCTGGAGCACGCCCGG + Intergenic
1160994708 19:1877284-1877306 CGCTGTGGGTGGAGGGCGCCGGG - Exonic
1161108077 19:2454585-2454607 AGCTGCTTGTTGAGGGGGTCGGG - Intronic
1162015384 19:7844013-7844035 CTCTGCTGGTGGACGGCTCCCGG + Intronic
1166334389 19:42096367-42096389 CGGTGCTTGTGGAGGAAGGCGGG - Intronic
1167095418 19:47372803-47372825 CGCTGCGGGTGAAGGGCGACTGG - Exonic
1167171636 19:47836239-47836261 CGCTGCTTCCTGGGGGCGCCTGG - Exonic
1167744044 19:51340633-51340655 CGCTGCCTGGGGTGGGGGCCAGG - Exonic
925104428 2:1278389-1278411 TGCTGTTTATGGAGGGCACCAGG + Intronic
925844056 2:8020049-8020071 CACTGTCTGTGGAGGGCTCCCGG + Intergenic
926663626 2:15495617-15495639 GGCTGCTTGTGGAGGGAGGGCGG + Intronic
927050257 2:19321234-19321256 CTCTGCTTGAGGAGGGCACCGGG + Intergenic
927256355 2:21043868-21043890 TGCTGCTGCTGGCGGGCGCCAGG - Exonic
928666846 2:33558275-33558297 CACTGCTCAAGGAGGGCGCCCGG - Exonic
930057750 2:47265057-47265079 CTCTGCTTGTGAAAGGAGCCTGG + Intergenic
933807799 2:86012541-86012563 CGCTGCTGGTGGAGGAAGCTTGG + Intergenic
934054523 2:88240747-88240769 TGCTGCTGGTGGAGGGCTCAGGG - Intergenic
935349712 2:102142768-102142790 CGCAGCTTGTGGCCGGCGGCCGG + Exonic
937314147 2:120920331-120920353 GGCTGCTGATGGAGGCCGCCTGG + Intronic
938305725 2:130252981-130253003 CGCTGCCTCTGGAGGGAGCCCGG + Intergenic
938386003 2:130867885-130867907 CGCTGCGTGTGGTGGGAGCAAGG + Intronic
938448421 2:131394803-131394825 CGCTGCCTCTGGAGGGAGCCCGG - Intergenic
941012828 2:160320711-160320733 TGCTGCTTGTTGAGGGCCTCAGG - Intronic
943470981 2:188292823-188292845 AGCTTCTTCTGGAGGGCGCAAGG + Exonic
946366906 2:219254058-219254080 CGCAGCTTGGGGAGGGTACCAGG - Intronic
946397133 2:219448817-219448839 CGCTGCTCGGAGAGGGCGGCTGG - Exonic
948195300 2:236091241-236091263 CGCTGCTAGTCCAGGTCGCCTGG + Intronic
1174340783 20:49893629-49893651 CCCTGCCTGGGGAGGCCGCCTGG + Intergenic
1175961710 20:62640611-62640633 TGCTGCCTGTGGAGGGCTCCCGG - Intergenic
1176310167 21:5145168-5145190 CCCTGCCTGTGGAGGGAGCCAGG - Intronic
1177773145 21:25539450-25539472 CACTGCTTGTGGAGGGCAGAGGG - Intergenic
1179038252 21:37778874-37778896 GGCTGCGTGTGGATGGCCCCAGG - Intronic
1179846889 21:44116868-44116890 CCCTGCCTGTGGAGGGAGCCAGG + Intronic
1181120796 22:20667902-20667924 CGCTGTGGGTGGAGGGCGCCGGG - Intergenic
1181333758 22:22114928-22114950 CGCTGTGGGTGGAGGGCGCCGGG - Intergenic
1182585604 22:31342801-31342823 CGCTGCGTGTGCCGGGGGCCCGG - Intronic
1183098753 22:35570573-35570595 GGCTGTTAGTGGAGGGCCCCTGG + Intergenic
1183714934 22:39528081-39528103 CCCTGCTGATGGAGGTCGCCTGG + Intergenic
1184863570 22:47190506-47190528 CGCTGGGTGGGGAGGGCTCCTGG - Intergenic
950421223 3:12901018-12901040 TGCTGCTGGTGGGGGGCGGCGGG + Intronic
954957032 3:54530274-54530296 CGCTGCTGGTGGAGCTCTCCTGG + Intronic
960914276 3:122680906-122680928 CGCTGCTGGTCGAGGGCTCCTGG + Exonic
961995634 3:131239045-131239067 GGCTGCTTGTGGACAGTGCCTGG + Intronic
968600390 4:1505990-1506012 CCCTGCTTCTGGAGGGCACAGGG - Intergenic
969426535 4:7127753-7127775 TGCTGCTGGGGGAGGGTGCCGGG + Intergenic
970136419 4:12929476-12929498 GGCTTCTTGTGGAGGCTGCCTGG + Intergenic
971351881 4:25862829-25862851 CGCTGCATGGCGAGGCCGCCCGG + Exonic
971405549 4:26319190-26319212 CCAGGCTTGTGGAGGGCGACAGG + Intronic
973820316 4:54657480-54657502 CGCTGCTCGTGGAGGTGGCATGG - Intergenic
975177062 4:71300711-71300733 AGCAGCTTCTGGAGGGGGCCTGG + Intronic
976704643 4:88007860-88007882 CGCTGCTCGCAGAGGCCGCCCGG - Exonic
985697022 5:1346406-1346428 CGCTGCTGGTGTGGGACGCCTGG - Intergenic
987095100 5:14542599-14542621 CGCTGGTTGTGGCAGGTGCCAGG + Intergenic
987975166 5:25006060-25006082 CTCTGCTTGTGGAGGGCTTGAGG + Intergenic
997663658 5:135609299-135609321 GGCAGCATGTGGAGGGTGCCAGG + Intergenic
1003307243 6:4940764-4940786 CACTGCTTGGGCAGGGCCCCCGG - Intronic
1003516779 6:6824707-6824729 CACTGCTTTTGGAAGGGGCCAGG + Intergenic
1007367696 6:41406435-41406457 CGCGGCTGGAGGAGGGGGCCGGG + Intergenic
1007426119 6:41747238-41747260 GGCTGCTGGTGCAGGGAGCCTGG - Intronic
1012400051 6:98835234-98835256 TGCTGCTGCTGCAGGGCGCCTGG - Exonic
1013235600 6:108195412-108195434 CGCTGCATGTGGAAGGAGCATGG - Intergenic
1016990718 6:149925965-149925987 GGCTGCTGCGGGAGGGCGCCCGG + Intergenic
1018849083 6:167574909-167574931 CCCTGGCTGTGGAGGGCGGCGGG - Intergenic
1019291909 7:254766-254788 CGCTGCTCGTCGAGGGCTGCGGG - Intronic
1020110640 7:5446102-5446124 GGCTGCTTCTGGAGGCCGTCGGG - Intronic
1021874176 7:25033044-25033066 TGCTGAGTGTGGAGGGCGCAGGG + Intergenic
1033390729 7:140924846-140924868 CGCCGCGGGCGGAGGGCGCCTGG + Intergenic
1034223017 7:149460235-149460257 CGCCGCCTGCGGAGAGCGCCGGG - Intronic
1034272221 7:149808884-149808906 ACCTGCTTGTGGGGGGCTCCAGG - Intergenic
1035642441 8:1194318-1194340 CCCGGCTGGTGGAGGGAGCCCGG + Intergenic
1036648681 8:10628076-10628098 AGCTGCTTCTGGAGGTCTCCAGG + Intronic
1043640484 8:82443693-82443715 GGCTACTTGTGGAGTGCGCAAGG + Intergenic
1047732426 8:127737912-127737934 CGCGGCTTCTTAAGGGCGCCAGG + Intronic
1049254046 8:141604616-141604638 CCCTGCTTGGGGAGGGCTCATGG + Intergenic
1049748530 8:144273053-144273075 CGCTGCTTGTGGAGGGCGCCCGG - Intronic
1053010308 9:34629063-34629085 CGCTGCTTGCGGCGGCCGCGGGG + Intergenic
1053185482 9:36012785-36012807 TGCAGCTTCTGGAGGGAGCCAGG - Intergenic
1058704936 9:107630256-107630278 CTCTGCCTGTGGAGGGAGGCTGG + Intergenic
1059423475 9:114206687-114206709 CACTCTTTGTGGAGGGCACCTGG + Intronic
1059749252 9:117232429-117232451 GGCTGCTTTTGGAGGGCAGCTGG - Intronic
1060294934 9:122336988-122337010 GGCTGATTGTGGTGGGTGCCGGG + Intergenic
1061302334 9:129712695-129712717 AGCTGCTTTTGTAGGGGGCCTGG - Intronic
1062231692 9:135485481-135485503 TGCTGCTTCTGAAGGGCGGCAGG - Exonic
1187123237 X:16429453-16429475 AGCTGATTGTAGAGGTCGCCTGG + Intergenic
1197886140 X:131220196-131220218 AGCTGCTTGTGGAGGGAACTGGG + Intergenic
1200057269 X:153468261-153468283 TGCTGCTTGAGGAAGGGGCCTGG - Intronic
1200139239 X:153890196-153890218 CGTTGCTTGTGGGGGGCGGGGGG + Intronic