ID: 1049749471

View in Genome Browser
Species Human (GRCh38)
Location 8:144276502-144276524
Sequence CCTCACAGAGGACAGGGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 342}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049749471_1049749488 23 Left 1049749471 8:144276502-144276524 CCACGGCCCTGTCCTCTGTGAGG 0: 1
1: 0
2: 3
3: 39
4: 342
Right 1049749488 8:144276548-144276570 CTCTGTCCCTGGGCTGACACGGG No data
1049749471_1049749479 -2 Left 1049749471 8:144276502-144276524 CCACGGCCCTGTCCTCTGTGAGG 0: 1
1: 0
2: 3
3: 39
4: 342
Right 1049749479 8:144276523-144276545 GGGCTGGACTGCAGCCTCCCGGG No data
1049749471_1049749487 22 Left 1049749471 8:144276502-144276524 CCACGGCCCTGTCCTCTGTGAGG 0: 1
1: 0
2: 3
3: 39
4: 342
Right 1049749487 8:144276547-144276569 CCTCTGTCCCTGGGCTGACACGG No data
1049749471_1049749483 13 Left 1049749471 8:144276502-144276524 CCACGGCCCTGTCCTCTGTGAGG 0: 1
1: 0
2: 3
3: 39
4: 342
Right 1049749483 8:144276538-144276560 CTCCCGGGGCCTCTGTCCCTGGG No data
1049749471_1049749480 -1 Left 1049749471 8:144276502-144276524 CCACGGCCCTGTCCTCTGTGAGG 0: 1
1: 0
2: 3
3: 39
4: 342
Right 1049749480 8:144276524-144276546 GGCTGGACTGCAGCCTCCCGGGG No data
1049749471_1049749491 30 Left 1049749471 8:144276502-144276524 CCACGGCCCTGTCCTCTGTGAGG 0: 1
1: 0
2: 3
3: 39
4: 342
Right 1049749491 8:144276555-144276577 CCTGGGCTGACACGGGTGTCAGG No data
1049749471_1049749478 -3 Left 1049749471 8:144276502-144276524 CCACGGCCCTGTCCTCTGTGAGG 0: 1
1: 0
2: 3
3: 39
4: 342
Right 1049749478 8:144276522-144276544 AGGGCTGGACTGCAGCCTCCCGG No data
1049749471_1049749482 12 Left 1049749471 8:144276502-144276524 CCACGGCCCTGTCCTCTGTGAGG 0: 1
1: 0
2: 3
3: 39
4: 342
Right 1049749482 8:144276537-144276559 CCTCCCGGGGCCTCTGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049749471 Original CRISPR CCTCACAGAGGACAGGGCCG TGG (reversed) Intronic
900218754 1:1495923-1495945 CCTCACAGTGGCCTGGGCAGGGG - Exonic
900226111 1:1534364-1534386 CCTCACAGTGGCCTGGGCAGGGG - Exonic
900641149 1:3688633-3688655 CCTTGCAGAGGACAGGGACAGGG - Intronic
900673252 1:3868828-3868850 CCACAGAGAGGAGTGGGCCGAGG - Intronic
900810819 1:4800289-4800311 AGTTACAGAGGACAGGGCCTGGG + Intergenic
900899231 1:5505504-5505526 CCCCCGAGAGGACAGGGCCTTGG + Intergenic
902529461 1:17081206-17081228 GCTCACTAAGGACAGGGCCCGGG + Intronic
902599641 1:17532222-17532244 GCTGACAGCAGACAGGGCCGAGG - Intergenic
902747213 1:18482021-18482043 CCTCCCCGCAGACAGGGCCGTGG + Exonic
903162872 1:21502331-21502353 CCCCAGAGAGCACAGGGCTGGGG + Intergenic
903524972 1:23986831-23986853 CCCCAGAGAGCACAGGGCTGGGG + Intergenic
904462013 1:30685906-30685928 CCCCAGAGAAGACAGGGCAGGGG - Intergenic
904622166 1:31782131-31782153 CCTCCAGGAGGACAGGGCAGAGG + Intergenic
905361625 1:37424787-37424809 CCTCACTGAGGACACAGCCATGG - Intergenic
906126019 1:43427411-43427433 TCACACTGAGGACAGGGACGTGG - Exonic
906291119 1:44619770-44619792 CCTCATAGAAGACAGGTCTGAGG - Intronic
906522001 1:46472858-46472880 CCTCTCAGAGTACAGGGCCTAGG + Intergenic
906729544 1:48069462-48069484 GCTCATAGAGAACAGGACCGGGG + Intergenic
906791221 1:48660138-48660160 CCTCACAGAGGTCATGGGCAGGG + Intronic
911806286 1:102211871-102211893 CTACACAGAGGACAGGACAGAGG + Intergenic
912500945 1:110121527-110121549 CATCAGAGAGGACAGGGCAGAGG + Intergenic
913156719 1:116106862-116106884 CCTCACACAGCTCAGGGCAGAGG + Intergenic
914958883 1:152188976-152188998 CCTAACAGAGAACGGGGCCTCGG - Intergenic
915240798 1:154520116-154520138 CTTCACTGAAGACAGGGCTGTGG + Intronic
915602658 1:156932069-156932091 CCTCAGGCAGGACAGGGCCCGGG - Intronic
916311024 1:163399045-163399067 CCTCCCAGAGCACAGGGACTTGG + Intergenic
917290444 1:173467113-173467135 CCTGTCAGAGGACAGGGCATGGG + Intergenic
918177425 1:182058201-182058223 CCTCACTGAGGACAGAGGCCTGG + Intronic
919775996 1:201194324-201194346 CCTCCCAGGGGAGAGGGCTGGGG + Intronic
920141860 1:203821684-203821706 CCTCTCAGTGGACAGAGCTGAGG + Intronic
920710153 1:208287277-208287299 CTTCACAGAGGTCAGGTCCTGGG - Intergenic
920903141 1:210132337-210132359 CCTCACAGAGGAGTGGCACGTGG - Intronic
923604669 1:235432423-235432445 CCTCACAGAGGAGGGGCCCTAGG - Intronic
1063161434 10:3421634-3421656 CCTCACAGAGAGCGTGGCCGTGG + Intergenic
1063545847 10:6980766-6980788 CCTCACAGAGGACACAGGGGAGG - Intergenic
1065189789 10:23198828-23198850 CCGAACAAAGGCCAGGGCCGGGG + Intergenic
1065424219 10:25582240-25582262 CCTCTCAGAGCACAGGGTCCAGG - Intronic
1065855406 10:29826267-29826289 GCTTACAGAGGACAGGGACCGGG - Intergenic
1066249336 10:33617926-33617948 CCACAGAGGGGACAGGGCGGCGG - Intergenic
1067066933 10:43109402-43109424 GCTCACAGTGGGCAGGGCTGGGG + Intronic
1067745279 10:48931146-48931168 CCTCTTAGAGGACAGGGTGGTGG + Intronic
1069775982 10:70927500-70927522 CCACCCAGAGGACTGGGCCATGG + Intergenic
1070593233 10:77815162-77815184 CCTCTCTGTGGCCAGGGCCGGGG + Intronic
1070798164 10:79229245-79229267 CCTCACTGGGGACAGGGCGGTGG + Intronic
1071507415 10:86241095-86241117 CCTCACAGAGCACTGGGCAGTGG - Intronic
1072141596 10:92593323-92593345 CCTCACAGCGCCCAGGTCCGCGG + Exonic
1073238370 10:102036574-102036596 CCCCAGAGAGCACAGGGCTGGGG - Intronic
1075103890 10:119524553-119524575 CAGCACCGAGGACAGGGCCTGGG - Intronic
1075216762 10:120543166-120543188 CATCACAGGGGATAGAGCCGGGG + Intronic
1075646940 10:124102840-124102862 CCTCAAAGAGCACAGGGTCTAGG + Intergenic
1075711087 10:124530805-124530827 CACCACAGCGCACAGGGCCGAGG + Intronic
1075932768 10:126313368-126313390 CCTCACAAAGGAGAGGGCCTTGG + Intronic
1076623624 10:131808565-131808587 CCTCAGAGAGCAAAGGGCCAGGG + Intergenic
1076797287 10:132804274-132804296 CCTGTGAGGGGACAGGGCCGAGG - Intergenic
1076825399 10:132964788-132964810 GCTCACAGAGGGCAGGGCCTAGG - Intergenic
1076886740 10:133266581-133266603 CCTCAGAGAGGGCAGGACGGTGG - Intronic
1077058326 11:606613-606635 GCCCACAGAGGAAGGGGCCGTGG - Intronic
1077115154 11:880737-880759 CCTCACGGAGGGCAGGCCTGTGG + Intronic
1077162375 11:1119640-1119662 GCTCACAGAGGGCAGGGCTGTGG + Intergenic
1077236038 11:1482420-1482442 CCTCAGAGAGGGCTGGGCAGGGG + Intronic
1077390526 11:2298863-2298885 CCTCACTGAGGGCAGAGCCTAGG + Intronic
1078427289 11:11262069-11262091 TCTCCCAGAGGGCAGGTCCGAGG + Intergenic
1078549750 11:12271995-12272017 CCTCTCAGAGCACAGAGCCAGGG - Intergenic
1081580613 11:44349044-44349066 CCTCAAAGATGGCAGGGCCTTGG - Intergenic
1084492762 11:69487508-69487530 CCTTCCTGAGGACAGGGCGGAGG - Intergenic
1085278588 11:75315541-75315563 ACTCACAGAGGGGAGGGCAGCGG - Intronic
1086075110 11:82842384-82842406 CCTCACAGAGCACAGTGCCTGGG - Intronic
1086965679 11:93025692-93025714 CCTTGCAGAGAACAGGGACGTGG - Intergenic
1088390805 11:109312815-109312837 GCTCTCAGAGGAGAAGGCCGAGG + Intergenic
1091239477 11:134042881-134042903 CTTCACAGAGAACAGGACAGGGG + Intergenic
1091408522 12:223979-224001 GCTCACAGAGGTGAGGGCCTGGG - Exonic
1091713514 12:2759979-2760001 CGACACAGAGGACAAGGCCTGGG - Intergenic
1092185359 12:6475101-6475123 CCGCAGAGAGCACAGGGCTGGGG + Intergenic
1096242063 12:49964905-49964927 CCCCACAGAGGACAGACCCACGG - Intronic
1096847084 12:54413284-54413306 CAGCAGAGAGGACAGGTCCGAGG + Intronic
1099133467 12:78864539-78864561 CCCCACAGCGGACAGGGACCTGG - Intronic
1100841203 12:98613162-98613184 CCCCTCAGGGGACAGGGCTGCGG - Intergenic
1101328528 12:103738295-103738317 CCTCACACAGTGCAGGGCCTGGG - Intronic
1101824221 12:108208160-108208182 CCCCCCTGAGGACAGGGCTGTGG - Intronic
1102456438 12:113073650-113073672 TCTAACAGAGGAGAGGGCAGAGG + Intronic
1102573022 12:113839100-113839122 CCTGGCAGAGTTCAGGGCCGAGG + Intronic
1103315753 12:120053795-120053817 CCTCTCAGAGGACAGAGCTAGGG + Intronic
1103911567 12:124355096-124355118 CTTCACAGGGGAGGGGGCCGAGG - Intronic
1104934589 12:132357780-132357802 CCTCACTGAGCGCAGGGCGGGGG - Intergenic
1105546119 13:21352213-21352235 TCTCACAGGGGACAGGGTCTAGG + Intergenic
1106554094 13:30795464-30795486 CCTCACAGAGGACAAGAGTGTGG - Intergenic
1106868571 13:33994506-33994528 CCTCACAGAGGAAAGGGCAATGG - Intergenic
1107559553 13:41547257-41547279 CTTCAGAGAGGACAGGGCCATGG - Intergenic
1108434370 13:50387225-50387247 CCTCCCAGTGGCCAGGGCCAGGG + Intronic
1112398952 13:99059016-99059038 CCTCACAGGAGACTGGGCCAAGG - Intronic
1113353983 13:109560419-109560441 CCTCACAGAGTTCAGGACCCAGG - Intergenic
1113467708 13:110524000-110524022 CCTCACTGAGGAGGGGGCCTTGG - Exonic
1113762314 13:112858078-112858100 CCACACACAGGGCAGGGACGGGG - Intronic
1116409240 14:44601932-44601954 CCCCAGAGAGCACAGGGCTGGGG - Intergenic
1119379185 14:74217963-74217985 CCTCCTAGAGGTCGGGGCCGCGG - Intergenic
1121567610 14:94922622-94922644 TCTCACAGAGGAAAGAGCCCTGG + Intergenic
1122720854 14:103721487-103721509 CCCCAGAGAGGCCTGGGCCGAGG + Intronic
1122896201 14:104758374-104758396 CCCCAAACACGACAGGGCCGTGG - Intronic
1123499233 15:20865721-20865743 CCTCAGAGATGTCAGGGCCCAGG - Intronic
1123556468 15:21439340-21439362 CCTCAGAGATGTCAGGGCCCAGG - Intronic
1123592709 15:21876686-21876708 CCTCAGAGATGTCAGGGCCCAGG - Intergenic
1124121176 15:26890539-26890561 CCAGACAGAGGAAAGGGCAGTGG - Intronic
1124254658 15:28130961-28130983 CCTCTCAGAGCAGAGGCCCGCGG + Intronic
1124577909 15:30925874-30925896 CTCCACAGAGCACAGGACCGTGG - Exonic
1128382157 15:67121148-67121170 CCTCAGCCAGGACAGGGCGGGGG - Intronic
1128868662 15:71135891-71135913 AATGACAGAGGACAGGACCGGGG - Intronic
1128978947 15:72172899-72172921 CCTCTCACAGGACAGGCCTGGGG + Intronic
1129604422 15:77017912-77017934 CCACCCAGCTGACAGGGCCGGGG - Intronic
1131046417 15:89319283-89319305 CCTCCCAGTGGACAGGACTGAGG - Exonic
1131660200 15:94505823-94505845 CTTCTCAGTGGACTGGGCCGTGG - Intergenic
1132069276 15:98761460-98761482 AGTCACAGAGGACAGGGCCAGGG + Intronic
1202964810 15_KI270727v1_random:166529-166551 CCTCAGAGATGTCAGGGCCCAGG - Intergenic
1132679461 16:1133815-1133837 GCCCAGAGAGGCCAGGGCCGGGG + Intergenic
1132935041 16:2475672-2475694 CCCCCCACTGGACAGGGCCGGGG - Intronic
1133140057 16:3737036-3737058 GCACACACAGGGCAGGGCCGAGG + Intronic
1133287818 16:4698660-4698682 CCACACACAGGACAGGGCCGTGG - Intronic
1133557304 16:6917808-6917830 CCTCTTAGAGAACAGGGCCCTGG + Intronic
1134594681 16:15486331-15486353 TCTCACAGAACACAGGGCCATGG + Intronic
1134896258 16:17889482-17889504 CGTTACAGTGGACAGAGCCGAGG - Intergenic
1135187998 16:20331626-20331648 CCTGACAGTGGACAGGGGCTGGG + Intergenic
1135623338 16:23974789-23974811 CCTCAGAGAGTACAGGGCCCAGG + Intronic
1135758648 16:25118648-25118670 CCTCACTGAGGTCAGTGCAGAGG + Intronic
1136222471 16:28836931-28836953 CCTCACAGAGGGCAGGGCCAGGG + Exonic
1137036080 16:35571068-35571090 CCCCACAGAAGGCAGGGCCAAGG + Intergenic
1137666279 16:50251503-50251525 CACCGCAGAGGCCAGGGCCGTGG + Intronic
1139029328 16:62860213-62860235 CCTCCCAGTGGACAGGCCAGTGG + Intergenic
1140699255 16:77566372-77566394 CCTAACAGAGGACAGGAGAGAGG - Intergenic
1140918232 16:79512832-79512854 TCTCGCAGAGCCCAGGGCCGTGG + Intergenic
1141435062 16:83995344-83995366 CCTCAGAGAGGACAAGTCCCTGG - Intronic
1141594102 16:85087015-85087037 CCTCCCAGGGGAAAGGGCCGGGG - Intronic
1141626969 16:85266522-85266544 CTTCACAGAGGGCAAGGCTGAGG + Intergenic
1141678566 16:85530691-85530713 CCTCACAGAGCACCCAGCCGGGG + Intergenic
1142159228 16:88548131-88548153 CCTTACAGGGGAAAGGGCAGTGG - Intergenic
1142343976 16:89542234-89542256 CCTTGCAGAGGCCAGGGCTGTGG - Intronic
1142512050 17:402226-402248 CCTCCCAGAGGACTGAGCTGTGG + Intergenic
1142760721 17:2040527-2040549 CCTCACAAAGGAAAGGCCCAAGG - Exonic
1143456426 17:7070889-7070911 CCACCCAGGGGACAGGCCCGGGG - Intergenic
1144597658 17:16584560-16584582 CCTCACAGAGGACGCGGCCCTGG - Intergenic
1146179111 17:30685980-30686002 CCCCAGAGAGGTCAGGGCCTGGG + Intergenic
1146619434 17:34386123-34386145 CCTGTCAGAGGACAGGGAGGGGG - Intergenic
1146731159 17:35194772-35194794 CCCCAGAGAGCACAGGGCTGGGG + Intergenic
1147156305 17:38546091-38546113 CCTCACCGAGGCCAGGGCCAGGG - Intronic
1147193660 17:38750933-38750955 ACTCGCAGAGGACAGGAACGCGG + Exonic
1147691204 17:42315869-42315891 CCCTTCAGAGGACAGGGCCCAGG + Intronic
1150314374 17:64156213-64156235 CCTCCCAGTGCACAGGGCTGGGG - Intronic
1152090216 17:78242314-78242336 CCTCACAGAGGTCAGGCCCCTGG - Intergenic
1152320800 17:79608127-79608149 CAGCACCAAGGACAGGGCCGGGG - Intergenic
1152647678 17:81477265-81477287 CCTCAGAGACCACAGGGCCCTGG - Intergenic
1152737391 17:82004227-82004249 CCTCACAGCAGACAGTGCTGGGG - Intronic
1153822453 18:8843977-8843999 CCTCACACAGGGCGGGGCCTTGG - Intergenic
1153894255 18:9544265-9544287 CCTCACAGGGGACAGGGAAGGGG - Intergenic
1154457275 18:14542475-14542497 CCTCAGAGAGGTCAGGGCCCAGG - Intronic
1157029066 18:43882493-43882515 CCCCGCAGAGGACAGGGAGGTGG - Intergenic
1159954161 18:74507662-74507684 CCTCACAGAGGACGAGGCAGCGG - Intronic
1160144291 18:76350817-76350839 CCTCCCAGAGCACCGGGCAGAGG + Intergenic
1160592973 18:79954183-79954205 CCACACAGAAGAGAGGGCCATGG + Intergenic
1161131640 19:2593157-2593179 CTTCAAAGAGGACAGGGCACCGG + Intronic
1161232325 19:3180438-3180460 CCTCACAGGGCACTGGCCCGTGG - Intergenic
1161239478 19:3214020-3214042 CCTCCCAGAGGCCAGGTCCAGGG + Intergenic
1161975631 19:7606555-7606577 CCTCACCGAGGGCTGCGCCGGGG - Exonic
1162908900 19:13839260-13839282 CTGCACAGAGCCCAGGGCCGGGG + Intergenic
1162956779 19:14103148-14103170 CCCCACAGAGGTCAGAGCCGTGG + Intronic
1162979511 19:14229594-14229616 CCCCAGAGAGGTCAGGGCCTGGG - Intergenic
1163441064 19:17322902-17322924 TCTCAAAGAGGACAGCGCGGTGG - Exonic
1163489356 19:17607768-17607790 CCTCACAGAGCACTGGGGCAGGG - Intronic
1163632358 19:18423973-18423995 CCTCCCAGAGGACTGCTCCGGGG - Intronic
1163765836 19:19162769-19162791 GCACAGAGAGGCCAGGGCCGGGG + Intronic
1164089371 19:21934457-21934479 CCCCACTGAGGGCAGGGCCCAGG - Intronic
1164193656 19:22934257-22934279 CCCCACTGAGGGCAGGGCCCAGG - Intergenic
1165127836 19:33613249-33613271 TCTCTCTGAGGACAGGGACGGGG + Intergenic
1165138809 19:33687176-33687198 CCTCACAGAGGGAAGGGCTTGGG + Intronic
1165820955 19:38675775-38675797 CCTCATAGAGCACAAGGCCTGGG + Intronic
1167118583 19:47502788-47502810 CTTCACAGAGGAGAGGGGTGGGG - Intronic
1167577483 19:50324819-50324841 ACCCAGAGAGGACAGGGCAGTGG + Intronic
1168118500 19:54239564-54239586 GCTCAGAGAGGACAGGGTCAGGG + Intronic
1168125028 19:54278230-54278252 GCTCAGAGAGGACAGGGTCAAGG + Intronic
1168176958 19:54633326-54633348 GCTCAGAGAGGACAGGGTCAAGG - Intronic
1168265823 19:55223566-55223588 GCTCACAGAGGCCACGGGCGAGG - Intergenic
925152391 2:1624173-1624195 CTTCACAGATGACACAGCCGTGG + Intergenic
925327474 2:3034941-3034963 CCCCACACAGCACAGGGCAGGGG - Intergenic
925922269 2:8645723-8645745 CCTCTCGGAGGCCATGGCCGTGG - Intergenic
926047010 2:9717286-9717308 ACTCACAGTGGACAAGGCCCTGG + Intergenic
926140450 2:10364946-10364968 CCCCACAGTGGACAGGGCTTGGG - Intronic
926400714 2:12493255-12493277 CCTCAGAGAGGAAAGGTCCCAGG - Intergenic
927096328 2:19750244-19750266 CTGCACAGAGGACAGGGATGGGG - Intergenic
927287424 2:21371220-21371242 CCTCACAGAGGACAACTTCGAGG + Intergenic
929760425 2:44802003-44802025 ACTCACAAAGGAAAGGGCGGTGG - Intergenic
934768896 2:96895620-96895642 CCTCACAGAGGCCAAGGGCTGGG - Intronic
936081847 2:109437604-109437626 CATCTCACAGGACAGGGCTGGGG + Intronic
936596765 2:113855493-113855515 CCGCTCAGAGGACAGTGCCCCGG - Intergenic
936815652 2:116457048-116457070 CCTCACAGAGGACCCTGCAGAGG - Intergenic
938336809 2:130508565-130508587 CCTCAGAGAGGTCAGGGCACAGG - Intronic
938353015 2:130612070-130612092 CCTCAGAGAGGTCAGGGCACAGG + Intronic
938994981 2:136668631-136668653 ACTCTCAGAGGACAGAGCCAGGG - Intergenic
939133576 2:138267335-138267357 CCTCACAGAGGACAGTGTGCAGG - Intergenic
940908144 2:159186978-159187000 CCTGAGAGAGGCCAGGGCGGCGG - Exonic
941439268 2:165513170-165513192 CCTGACAGAGCAAAGGGCCTGGG - Intronic
945975716 2:216268958-216268980 CATCTCAGAGGACAGGGGCCAGG + Intronic
946028541 2:216687397-216687419 CCTCACAGAGTAAGGGGCTGAGG + Intronic
946182488 2:217957014-217957036 GCTCAGAGAGGACAGGACCTTGG + Intronic
947025517 2:225733694-225733716 CCTCACAGAGGAGAGAGGCCGGG - Intergenic
948423577 2:237874923-237874945 CCTCTTGGAGGACAGGGCAGCGG + Intronic
948633639 2:239319024-239319046 CCTCACAGAAGACAGTGCTGGGG - Intronic
948721781 2:239905289-239905311 TCTCACAGAGGACAGAGGAGGGG + Intronic
948810094 2:240470393-240470415 CTTCACAGACGCCAGGGCTGTGG + Intergenic
948835617 2:240624704-240624726 CCTCAGGGTGGACAGGGCCCAGG + Intronic
948974625 2:241456859-241456881 CATCACTGAGGACAGGGCTCAGG - Exonic
949067695 2:242003351-242003373 CCCCACGGAGGGCAGTGCCGAGG - Intergenic
949067726 2:242003530-242003552 CCCCACAGAGGGCAGTGCCGAGG - Intergenic
949067741 2:242003617-242003639 CCCCACGGAGGGCAGTGCCGAGG - Intergenic
949067749 2:242003659-242003681 CCCCACGGAGGGCAGTGCCGAGG - Intergenic
949067765 2:242003744-242003766 CCCCACGGAGGGCAGTGCCGAGG - Intergenic
949067773 2:242003786-242003808 CCCCACGGAGGGCAGTGCCGAGG - Intergenic
949067789 2:242003876-242003898 CCCCACGGAGGGCAGTGCCGAGG - Intergenic
949067797 2:242003918-242003940 CCCCACGGAGGGCAGTGCCGAGG - Intergenic
949067805 2:242003962-242003984 CCCCACGGAGGGCAGTGCCGAGG - Intergenic
949067814 2:242004006-242004028 CCCCACGGAGGGCAGTGCCGAGG - Intergenic
949067822 2:242004048-242004070 CCCCACGGAGGGCAGTGCCGAGG - Intergenic
949067830 2:242004090-242004112 CCCCACGGAGGGCAGTGCCGAGG - Intergenic
949067846 2:242004176-242004198 CCCCACGGAGGGCAGTGCCGAGG - Intergenic
949067854 2:242004220-242004242 CCCCACGGAGGGCAGTGCCGAGG - Intergenic
949067862 2:242004262-242004284 CCCCACGGAGGGCAGTGCCGAGG - Intergenic
949067870 2:242004304-242004326 CCCCACGGAGGGCAGTGCCGAGG - Intergenic
949067878 2:242004348-242004370 CCCCACGGAGGGCAGTGCCGAGG - Intergenic
1169416024 20:5416892-5416914 CATGACAGAGGAGAGGGCCGAGG - Intergenic
1169725194 20:8721179-8721201 CTTCTCAGAGGACAGTGCAGTGG + Intronic
1172177160 20:32979531-32979553 CCTCACAGAGGCTAGGGTCAGGG - Intergenic
1172205969 20:33163104-33163126 CCCCACACAGGACAGGACCCAGG + Intronic
1173901174 20:46589964-46589986 CCTCTCAGAAGAAAGGGCAGTGG + Intronic
1174505404 20:51014651-51014673 CCTCCGTGAGGACAGGGCCTAGG - Intronic
1175495792 20:59413295-59413317 GCTCAAAGAGGGCAGGGCCAGGG - Intergenic
1175605923 20:60312148-60312170 CCTGAAAGAAGACAGGGCAGAGG - Intergenic
1175634540 20:60569469-60569491 CCACACAGAGGACAAGGCAATGG + Intergenic
1176019711 20:62956438-62956460 CCTCAAAGAGAACAGGGGAGAGG - Intronic
1176147196 20:63570852-63570874 ACTCACAGAGGTCAGGCCTGGGG + Exonic
1176457877 21:6929028-6929050 CCCCACAGAGCACTGGGACGGGG - Intergenic
1176816884 21:13610878-13610900 CCTCAGAGAGGTCAGGGCCCAGG + Intronic
1176836049 21:13794112-13794134 CCCCACAGAGCACTGGGACGGGG - Intergenic
1179522591 21:41954497-41954519 CCACACAGAAGGCAGGGCCTGGG - Intergenic
1180137943 21:45873264-45873286 GCTCACAGAGGAGTGGGCAGAGG - Intronic
1180704454 22:17800596-17800618 ACACACAGAGCACAGGGCAGGGG + Intronic
1180968131 22:19801083-19801105 CCTCACCAAGGACAGGGCCCGGG - Intronic
1180972804 22:19824395-19824417 CCTCCGGGAGGACAGGGCCGGGG - Intronic
1183045616 22:35217282-35217304 CCTGACTGAGGCCAGGGCGGTGG - Intergenic
1183255326 22:36758081-36758103 CCTCACAGAAGGGAGGGCCAGGG + Intergenic
1183407312 22:37636662-37636684 CCACACAGAGGGCAGCACCGAGG + Intronic
1183487721 22:38098239-38098261 CCTCCCAGAGATCAGGGCCCTGG + Intronic
1183524420 22:38315146-38315168 CCTCGCCGAGGACAGGGCTCCGG + Intronic
1183589036 22:38769363-38769385 GGTCAGAGAGGACAGGGCTGGGG + Intronic
1184373861 22:44099381-44099403 CGTCATGGAGGACAGTGCCGTGG - Intronic
1184427886 22:44423778-44423800 CTTCACAGAGGCCAAGGGCGTGG + Intergenic
1184446015 22:44547313-44547335 CCTCACAGCTGCCAGGGCAGAGG - Intergenic
1184489108 22:44799107-44799129 CCTCACAGAAGCCAGGGCCTGGG + Intronic
1184585653 22:45446298-45446320 GACCAGAGAGGACAGGGCCGTGG + Intergenic
1184902605 22:47457124-47457146 CCTCCCAGAGGAGAGGACCTGGG + Intergenic
1185126495 22:49013982-49014004 GCTCAGAAAGGACAGGCCCGCGG + Intergenic
1185129294 22:49028543-49028565 CTTCACAGAGGACAGAGCAGGGG + Intergenic
1185182625 22:49372081-49372103 CCCCACAGAAGACACGGCCCGGG + Intergenic
1185388888 22:50548510-50548532 CCTCGCAGAGGAGGAGGCCGCGG - Exonic
949414337 3:3799656-3799678 GCTCTCAGAGGCCAGGGCAGGGG - Exonic
949851617 3:8426378-8426400 CCTCACAGCAGCCAGGGCTGAGG - Intergenic
950107077 3:10395006-10395028 CCCCACAGAGGGCAGGGGCAGGG - Intronic
950154159 3:10709254-10709276 CCAGGGAGAGGACAGGGCCGCGG - Intergenic
950465181 3:13149283-13149305 CCACACAGAGGACAGAGCCTGGG + Intergenic
950474631 3:13207611-13207633 CCTCAGGGAGGCCAGGGCAGAGG - Intergenic
952749802 3:36816018-36816040 CCTCCCCGAGGACAGGGCTGGGG - Intergenic
952900660 3:38109737-38109759 CCACACAGAGGGCAGGGATGGGG - Intronic
952976270 3:38698984-38699006 CTTCACAGAGCACAGGACCAGGG - Intronic
953584400 3:44186694-44186716 CCTCAGAAAGGAAAGGGCTGTGG + Intergenic
954147070 3:48639799-48639821 TTGCACAGAGGAGAGGGCCGAGG + Exonic
956643068 3:71432560-71432582 CCTAACATAGGGCAGGGCCTGGG + Intronic
957472293 3:80674063-80674085 CCTCACACAGGACAAGGTGGTGG + Intergenic
958692152 3:97481691-97481713 CCTCACAGGGGGCGGGGCCGGGG - Intronic
963274062 3:143313276-143313298 ACTCACAGAGGGCAGGGACCCGG + Intronic
967995512 3:195163440-195163462 CCTGACAGAGTGCAGGGCCAAGG - Intronic
968577462 4:1374550-1374572 CCACAGAGATGACAGGGACGAGG - Intronic
968643446 4:1726699-1726721 CCACACAGAGGACTGGGGCCAGG + Intronic
968657450 4:1784864-1784886 CCTCTCAGAGGACATGCCCAGGG - Intergenic
968708157 4:2093268-2093290 CCCCACTGGGGACAAGGCCGGGG + Intronic
969073302 4:4557163-4557185 ACTCAAAGAGGACAGGACCCAGG - Intergenic
969604953 4:8197764-8197786 CCCCACTGAGGCCAGGGCCCGGG - Intronic
969622501 4:8285763-8285785 GTTCACAGAGGGCAGGGCCCAGG + Intronic
969689724 4:8697886-8697908 CCTCACAGAGGCCAGGGCAGTGG - Intergenic
970344496 4:15140471-15140493 CCTCACAGACAATAGGGCCAAGG - Intergenic
975213088 4:71723442-71723464 CCCCACATAGGACAGAGCAGAGG - Intergenic
976146636 4:82047839-82047861 CATCACAGAGGAGAGGGCATGGG - Intergenic
976199009 4:82561535-82561557 CCTGTCAAAGGACGGGGCCGGGG + Intronic
977730373 4:100343816-100343838 CTTAACAGAGGACATGGTCGTGG + Intergenic
978768784 4:112432235-112432257 CCTCGCTGAGGACAGGGAAGAGG - Exonic
982672843 4:158342806-158342828 CCTCCCGGGGGACAGGTCCGGGG + Intronic
983084344 4:163425837-163425859 CATCACAGTGGACATGGGCGAGG - Intergenic
983888738 4:173009303-173009325 CCTCCCAGAAGCCAGGGCAGTGG + Intronic
984206567 4:176793104-176793126 CCCCGCAGGGGACAGGGGCGGGG - Intergenic
985357323 4:189135579-189135601 CCTCAGAGAGGAAAGGGGCTTGG - Intergenic
986334918 5:6747252-6747274 CCACACAGAGGAGAAGGCCCAGG - Intronic
989566204 5:42903917-42903939 CCTCACAGAGCAAAGGGCATTGG - Intergenic
989631076 5:43483589-43483611 CCTCGCAGACCCCAGGGCCGCGG + Intronic
995607718 5:113875478-113875500 AGTCACAGAGGTCAGGGCAGGGG + Intergenic
997350799 5:133230169-133230191 CCTATCAGAGGCCAGGGCTGAGG - Intronic
998391923 5:141792725-141792747 CCTTACAGAGCCCAGGGCAGAGG + Intergenic
998583808 5:143405030-143405052 CCTGAGAAAGGAGAGGGCCGTGG + Intronic
1002067847 5:176661138-176661160 CCCCAGAGAAGACAGGGCAGAGG - Intergenic
1002343832 5:178534490-178534512 GCGCACAGAGGCCAGGGCGGTGG + Intronic
1002350145 5:178577497-178577519 ACTCACCGAGGACAGGACCCGGG + Intronic
1002596958 5:180329930-180329952 CATCCCAGAGGACAGGGCCCAGG - Intronic
1003405505 6:5824225-5824247 TCTCACAGGGGACAGGGTCTAGG - Intergenic
1004178943 6:13364675-13364697 CCACAGAGAGGGAAGGGCCGAGG - Exonic
1005381201 6:25236162-25236184 CCTCTCAGTGGACAGAGCTGAGG + Intergenic
1009049181 6:58258279-58258301 CCCCAGAGAGCACAGGGCTGGGG - Intergenic
1010241701 6:73621936-73621958 CTTCACAGAAGTCAGTGCCGTGG - Exonic
1010281202 6:74025621-74025643 CCTTCCAAAGGACAGGGCCTAGG - Intergenic
1013632170 6:111996231-111996253 CCTCACAGAAGCCACGGTCGTGG + Intergenic
1015258337 6:131205448-131205470 CCTACCAGAGGACAGGACCCCGG - Intronic
1015707497 6:136104040-136104062 CCTCCCTGAGGACAGGGCTCCGG - Intronic
1017775256 6:157675580-157675602 AGCCACAGAGGACAGGGCTGTGG - Exonic
1019217880 6:170455193-170455215 CCTCACAGAGGACATGCCCCAGG - Intergenic
1019422700 7:958449-958471 CGTCGCAGAGGACAGGGTGGAGG - Intronic
1019685929 7:2382195-2382217 CCTCCTAGAGGACAGGGATGTGG + Intergenic
1020140342 7:5608184-5608206 CCCCCCAGAGGGCAGGGCCTGGG - Intergenic
1022468840 7:30669391-30669413 GCTCCCTGAGGACAGGGCCTTGG + Intronic
1023888116 7:44375157-44375179 CCTCAGAGGGGAGAGGGCCCTGG - Intergenic
1024317574 7:48035676-48035698 CCGCACAGTGGACAAGGCCCGGG - Intronic
1025078772 7:55964786-55964808 CCGCGCTGGGGACAGGGCCGGGG - Intronic
1026086985 7:67270778-67270800 CCCCACATAGGACAGTGCAGTGG - Intergenic
1026690117 7:72543920-72543942 CCCCACATAGGACAGTGCAGTGG + Intergenic
1026975207 7:74493696-74493718 CCTCAGAGGGGACAGAGCCGAGG - Intronic
1029422156 7:100477388-100477410 CCTCAGAGAGGGCAGGGGCGTGG + Exonic
1033259336 7:139829038-139829060 CCTCTCAGAGTACAAGTCCGTGG + Intronic
1034266241 7:149782431-149782453 CTTCAGAGATGAGAGGGCCGGGG - Intergenic
1034498470 7:151435638-151435660 CCTCCCAGAGGCCAGGGTGGTGG + Intronic
1035027227 7:155833990-155834012 CCCCAAAGAGGACAGGGTGGAGG - Intergenic
1035571343 8:675097-675119 CCTCAGTGAGGACAGAGACGTGG + Intronic
1035912110 8:3578701-3578723 CCTCACACAGGAGACAGCCGAGG + Intronic
1036737376 8:11330617-11330639 CCCCAGAGAGCACAGGGCTGGGG - Intergenic
1036988712 8:13567128-13567150 GCTCCCAGAGGTCAGGGGCGAGG - Exonic
1037821813 8:22138779-22138801 CCACACAGGGTACCGGGCCGGGG - Exonic
1040803576 8:51370040-51370062 GCGCACAGAGGAAAGAGCCGAGG + Intronic
1040905303 8:52463681-52463703 CCTGACAGGGGACAGAGCCCAGG + Intergenic
1046831444 8:118751111-118751133 CTTCACAGAGCAAAGGGCCCTGG - Intergenic
1047496182 8:125410723-125410745 CTTCACAGAAGACATGGCAGAGG - Intergenic
1048032028 8:130641829-130641851 CCCCACAGATCACAAGGCCGAGG + Intergenic
1049245342 8:141559481-141559503 GCACACAGAGGCCAGGGCCTGGG - Intergenic
1049446590 8:142634290-142634312 CCTCACGGGGGACAGGGAGGAGG - Intergenic
1049605837 8:143528816-143528838 CCTCCCAGAGGACTGGACCTGGG - Intronic
1049749471 8:144276502-144276524 CCTCACAGAGGACAGGGCCGTGG - Intronic
1050351884 9:4747960-4747982 CCTCTCAGAGGACAGGGCTAAGG + Intergenic
1055361080 9:75490970-75490992 ACTCACAGAGGATAGGGACAAGG - Intergenic
1056815715 9:89799415-89799437 CTTCTCAGAGGTCAGGGCCTAGG + Intergenic
1056969560 9:91191087-91191109 CATCAAAAAGGACAAGGCCGAGG - Intergenic
1057146003 9:92760010-92760032 GCTCACAGAGCACTGGGCCAAGG + Intronic
1057781792 9:98056549-98056571 CCTCGCACAGGAGAGGGCCGCGG + Intergenic
1058903629 9:109462737-109462759 CCTCACAGATGGCAGGGCTTGGG - Intronic
1059383885 9:113949385-113949407 CCACACAGAGGACAGGGGTCTGG - Intronic
1059742985 9:117171258-117171280 CCTCACAGAGTACAGGTACAGGG + Intronic
1060823371 9:126673885-126673907 CCGCAGAGAGGACAGGGCAGCGG - Intronic
1060989739 9:127841577-127841599 CCTCGTAGAGGGCAGGGCGGTGG + Intronic
1061045375 9:128162192-128162214 CCTCACAGACGACAGCGTCCTGG - Intronic
1061299752 9:129697723-129697745 CCTCCCCCGGGACAGGGCCGAGG - Intronic
1061956953 9:133968730-133968752 GCTGACAGAGGACAGTGCCATGG - Intronic
1062186588 9:135221695-135221717 GCTCAGAGAGGTCAGGGACGTGG - Intergenic
1062387425 9:136318480-136318502 CATCACAGAGGTCAGGGGCCAGG - Intergenic
1062449337 9:136609029-136609051 CCCCGCAGAGGGCAGGGGCGGGG - Intergenic
1062623393 9:137432705-137432727 CCACACAGAGGCCGGGGCCCAGG + Intronic
1203530479 Un_GL000213v1:138616-138638 CCTCAGAGAGGTCAGGGCCCAGG - Intergenic
1186495863 X:10012816-10012838 GCTCAAAGAGGCCAGCGCCGAGG - Intergenic
1186505939 X:10092212-10092234 CCTCAGAGAGGCCAAGGCAGGGG + Intronic
1187098492 X:16169719-16169741 GCTCAGAGTGGACAGGGCCTGGG + Intronic
1187149343 X:16667884-16667906 CCTGACAGAGAGCAGGGCAGGGG + Intronic
1187224484 X:17362321-17362343 CCACCCAGGGGACAGGGCAGAGG - Intergenic
1187695039 X:21911154-21911176 CCTCCCAGAGGGCAGGACCAAGG + Intergenic
1187927028 X:24260113-24260135 CCTCACATAGTAGAGGGCAGAGG + Intergenic
1188911303 X:35851268-35851290 CCTCACAGAAGAGAGGGAAGTGG + Intergenic
1189293742 X:39904283-39904305 CCTCAAAGAGGACGGTGCAGAGG - Intergenic
1190597754 X:52064529-52064551 CCTCCCAGAGGACAGCTGCGAGG + Exonic
1190611070 X:52189544-52189566 CCTCCCAGAGGACAGCTGCGAGG - Exonic
1199557659 X:149126603-149126625 CCTCACTGAGGACCAGGCTGTGG + Intergenic
1200051723 X:153435654-153435676 CCTCAGAGAGGAAGGGGCGGTGG + Intergenic
1200865133 Y:8035422-8035444 TCTCACACAGAACAGGGCCTAGG + Intergenic
1200902087 Y:8443059-8443081 TCTCACACAGAACAGGGCCTAGG - Intergenic
1200952807 Y:8917780-8917802 CCCCAGAGAGCACAGGGCTGGGG + Intergenic
1201979164 Y:19889137-19889159 CCTCTCATAGGGCAGGGCTGGGG + Intergenic
1202072381 Y:21005624-21005646 CCTGACTGTGGACAGGGCCAAGG + Intergenic
1202253044 Y:22892739-22892761 TCTCACACAGAACAGGGCCTAGG - Intergenic
1202406034 Y:24526488-24526510 TCTCACACAGAACAGGGCCTAGG - Intergenic
1202464746 Y:25143593-25143615 TCTCACACAGAACAGGGCCTAGG + Intergenic