ID: 1049749475

View in Genome Browser
Species Human (GRCh38)
Location 8:144276508-144276530
Sequence TCCAGCCCTCACAGAGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 1, 2: 3, 3: 47, 4: 382}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049749475_1049749480 -7 Left 1049749475 8:144276508-144276530 CCCTGTCCTCTGTGAGGGCTGGA 0: 1
1: 1
2: 3
3: 47
4: 382
Right 1049749480 8:144276524-144276546 GGCTGGACTGCAGCCTCCCGGGG No data
1049749475_1049749487 16 Left 1049749475 8:144276508-144276530 CCCTGTCCTCTGTGAGGGCTGGA 0: 1
1: 1
2: 3
3: 47
4: 382
Right 1049749487 8:144276547-144276569 CCTCTGTCCCTGGGCTGACACGG No data
1049749475_1049749483 7 Left 1049749475 8:144276508-144276530 CCCTGTCCTCTGTGAGGGCTGGA 0: 1
1: 1
2: 3
3: 47
4: 382
Right 1049749483 8:144276538-144276560 CTCCCGGGGCCTCTGTCCCTGGG No data
1049749475_1049749491 24 Left 1049749475 8:144276508-144276530 CCCTGTCCTCTGTGAGGGCTGGA 0: 1
1: 1
2: 3
3: 47
4: 382
Right 1049749491 8:144276555-144276577 CCTGGGCTGACACGGGTGTCAGG No data
1049749475_1049749479 -8 Left 1049749475 8:144276508-144276530 CCCTGTCCTCTGTGAGGGCTGGA 0: 1
1: 1
2: 3
3: 47
4: 382
Right 1049749479 8:144276523-144276545 GGGCTGGACTGCAGCCTCCCGGG No data
1049749475_1049749488 17 Left 1049749475 8:144276508-144276530 CCCTGTCCTCTGTGAGGGCTGGA 0: 1
1: 1
2: 3
3: 47
4: 382
Right 1049749488 8:144276548-144276570 CTCTGTCCCTGGGCTGACACGGG No data
1049749475_1049749482 6 Left 1049749475 8:144276508-144276530 CCCTGTCCTCTGTGAGGGCTGGA 0: 1
1: 1
2: 3
3: 47
4: 382
Right 1049749482 8:144276537-144276559 CCTCCCGGGGCCTCTGTCCCTGG No data
1049749475_1049749478 -9 Left 1049749475 8:144276508-144276530 CCCTGTCCTCTGTGAGGGCTGGA 0: 1
1: 1
2: 3
3: 47
4: 382
Right 1049749478 8:144276522-144276544 AGGGCTGGACTGCAGCCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049749475 Original CRISPR TCCAGCCCTCACAGAGGACA GGG (reversed) Intronic
900519792 1:3100044-3100066 TCCACGCCCCTCAGAGGACAGGG - Intronic
900585248 1:3429512-3429534 TCCCGTCCTCAGAGTGGACAGGG + Intronic
900618921 1:3578097-3578119 CCCTCCCCTCCCAGAGGACACGG + Intronic
900657870 1:3768924-3768946 TCCACTCCTCACACAGGCCAGGG + Intronic
900665895 1:3815364-3815386 TCCATCCCTCACAGAGACCAAGG + Exonic
900927230 1:5713271-5713293 TACCGCACTCCCAGAGGACATGG + Intergenic
901033053 1:6319742-6319764 TCCAGCCCTTCCAGAGCAGATGG + Intronic
901226605 1:7616667-7616689 TCCAGCTCACACAGGGGACTTGG - Intronic
901228465 1:7628791-7628813 TCCAGCCATCCAGGAGGACATGG + Intronic
901490524 1:9594298-9594320 CCAAGCCCTCACAGAGGACAAGG - Intronic
902335712 1:15753507-15753529 CCCAGCCTTCACAGGGGCCATGG + Intergenic
902701581 1:18175883-18175905 TCCAGCCCTCTTGGAGGAGAGGG + Intronic
902982516 1:20135735-20135757 TCCAGCACTTTCAGAGGCCAGGG - Intergenic
904369965 1:30042171-30042193 TCCAGCCCCCCAAGAGCACAGGG - Intergenic
904464418 1:30699396-30699418 TCCATCCGGCACAGAGTACAGGG + Intergenic
905933711 1:41807317-41807339 TCAAGGCCTAACAGATGACAGGG - Intronic
907050306 1:51325807-51325829 TCCATCCCCCACCGAGGAAAAGG + Intronic
907238834 1:53069602-53069624 TGCAGACCTGCCAGAGGACAGGG + Intronic
907288647 1:53398225-53398247 TCCAGCCCTCACAGTCCAGAGGG + Intergenic
907407447 1:54262397-54262419 TTCTGCCCTGACAGATGACACGG - Intronic
907430456 1:54408137-54408159 CCCAGCGCTCACAGGGGAAAGGG + Intronic
907554998 1:55335674-55335696 TCAAGCCCCCACAGAGATCATGG - Intergenic
907576100 1:55527164-55527186 TCCTGCCCTCACAGAGTTCAGGG - Intergenic
909735688 1:78958464-78958486 TCCAACCCTCATAGATGACTTGG + Intronic
911531858 1:99052288-99052310 TCCAGCCTGCACAGAGCCCACGG - Intergenic
912722845 1:112034643-112034665 CCCAGCAGTCACAGTGGACATGG + Intergenic
914407510 1:147390378-147390400 ACCAGCCCTCTCAGATGAGAAGG + Intergenic
915254475 1:154615662-154615684 TCCAGCACTCAGGGAGGCCAAGG - Intronic
915834619 1:159166056-159166078 TCCTGCCCTCAAAGAGCACATGG + Intergenic
918285392 1:183049712-183049734 CCCAGCACTCTCAGAGGCCAAGG - Intronic
918724149 1:187895845-187895867 CCCAGCACTCTCAGAGGCCAAGG - Intergenic
919032294 1:192258263-192258285 TCCATACCTCACACAAGACAGGG + Intergenic
919428491 1:197464074-197464096 TCCACCCCACAAAGAGGACCTGG + Intronic
919747509 1:201017763-201017785 CCCAGCCTTCATAAAGGACAGGG + Intronic
921079013 1:211724138-211724160 TCCTGGCCAGACAGAGGACATGG - Intergenic
922067349 1:222157157-222157179 TCAAGCCCTGAGAGAGGAGAGGG - Intergenic
923896235 1:238273128-238273150 TACAGCTCTCACAGAGAAGAGGG - Intergenic
1063435674 10:6027947-6027969 TCCAGCCATCACAGAGTAACTGG + Intronic
1063492957 10:6482039-6482061 TCCATCACTCACAGATGACAAGG - Intronic
1066659133 10:37722454-37722476 TCCAGCACTTTCAGAGGCCAAGG + Intergenic
1068968066 10:62933669-62933691 GCCAGCCCTCAAGGAGGTCATGG + Intergenic
1069548170 10:69343571-69343593 TCCAACCCTCAAATATGACATGG - Intronic
1071290836 10:84187897-84187919 TACAGCCCTCACAGAGGCTGAGG - Intergenic
1071689267 10:87798119-87798141 TTGAGCCCTCTCAGAGGTCATGG + Intronic
1072078320 10:92001407-92001429 TCCAGACCTCACACAGGGCTGGG + Intronic
1072369750 10:94753699-94753721 TCCAACCCTCATAGATGACTAGG + Intronic
1072473863 10:95739648-95739670 TCCAGCCCTTATAGATGACTTGG - Intronic
1072600946 10:96928576-96928598 TCAAACCCTCACAGATGACTTGG - Intronic
1073175187 10:101551758-101551780 TCTTTCTCTCACAGAGGACACGG + Intronic
1073534438 10:104262826-104262848 TCCTGCGCTCACAGAGGTAATGG - Intronic
1073874416 10:107905574-107905596 TCCAGCCCTCAAAGAGGAAAAGG + Intergenic
1074123090 10:110507822-110507844 TCCAGGCAACACAGAGGACCTGG - Intronic
1075321767 10:121496878-121496900 CCCAGCCCTTACAGAGGCCGAGG + Intronic
1075327583 10:121546972-121546994 CCCAGCACTCGCAGAGGCCAAGG + Intronic
1075644824 10:124090704-124090726 TGCAGCCCTCACAGCAGCCACGG + Intronic
1075676437 10:124299121-124299143 AGCAGCCCTCACAGGGCACATGG + Intergenic
1076328904 10:129650792-129650814 TCCTGCCCTCACCAAGGACATGG - Intronic
1076458336 10:130620488-130620510 TGCCTCCTTCACAGAGGACATGG - Intergenic
1076516005 10:131044693-131044715 TCCATCCCCCGCAGAAGACATGG - Intergenic
1076682191 10:132178851-132178873 TCCAGCACACACAGACGGCAGGG + Intronic
1077350335 11:2090315-2090337 TCCAGTCCTCATAAAGGCCATGG + Intergenic
1077414632 11:2419084-2419106 TCACTCCCTCACAGAAGACAGGG - Intronic
1077440381 11:2566097-2566119 TCCAGCCCTGCCAGGGGACAGGG - Intronic
1078844557 11:15109572-15109594 TAGGGCCCTCACAGAGGACAAGG - Intergenic
1078896298 11:15600230-15600252 TCCAGCCCCCATCCAGGACATGG + Intergenic
1078991228 11:16648317-16648339 CCCAACCCTCACAGTGGCCATGG + Intronic
1079292508 11:19200897-19200919 TCCAGCCCTGACATAGGAGATGG + Intronic
1082746641 11:56969463-56969485 TCCAGCACTCACAGAGCGGAAGG - Intergenic
1082943221 11:58730222-58730244 TCCAGCACTTTCAGAGGCCAAGG + Intronic
1083499825 11:63094285-63094307 TCCAGTCCCTACAAAGGACATGG + Intronic
1083737529 11:64690285-64690307 CACAGGCCTCAGAGAGGACAAGG + Intronic
1083882627 11:65555942-65555964 GCCAGGCCTCACAGAGCAGAGGG + Intronic
1083984917 11:66207646-66207668 GCCAGCCCGCACACAGGCCAGGG - Intronic
1084266650 11:68008583-68008605 TCCATCCCACACAGAGGACAGGG + Intronic
1084331438 11:68432858-68432880 CCCAGCCCGCACTGAGGACGTGG + Intronic
1084519706 11:69655790-69655812 CCCAGCCCTGACACAGGACCTGG - Intronic
1084905192 11:72340650-72340672 GCCAGACCCTACAGAGGACAGGG + Intronic
1085500791 11:77021237-77021259 TCCAGTTCTCAGAGAGGTCATGG + Exonic
1086304390 11:85464311-85464333 ACCAGCCCTCACAGAAGAACTGG + Intronic
1087644949 11:100797950-100797972 TCCAGCCCTCATGGATGACTTGG + Intronic
1087946421 11:104165056-104165078 TCCAGCCCTTCCACAGGAAAGGG + Intergenic
1088298385 11:108327076-108327098 CCCAGCACTTTCAGAGGACAAGG - Intronic
1088865646 11:113845186-113845208 TCCAGCACTCAGGGAGGCCAAGG + Intronic
1089257196 11:117200233-117200255 TCCTGCCCTCTCAGAGGTCCAGG + Intronic
1089706448 11:120281400-120281422 TCCAGCAGTCACAGAGAAAAGGG - Intronic
1089844468 11:121447561-121447583 CCCAGCACTTACAGAGGCCAAGG - Intergenic
1090055985 11:123425577-123425599 AACAGCCCTCACAGGGGCCAGGG - Intergenic
1090962241 11:131567238-131567260 TCCAGCACTTAGAGAGGTCAAGG + Intronic
1092234971 12:6801154-6801176 TCCAGCACTCTGAGAGGCCAAGG - Intronic
1093384069 12:18529757-18529779 ACCAGCCCTCACAGTGGAAATGG - Intronic
1095402200 12:41827781-41827803 TCCAGCTCTCACAGGAAACAGGG - Intergenic
1096183847 12:49565829-49565851 TCCAGCCCTCTGAGATGACAGGG + Intronic
1096264002 12:50109772-50109794 TCCACCCCTCCCAGAGGATATGG - Exonic
1097193842 12:57233164-57233186 TCCACCTCTCACACAGGTCAGGG + Exonic
1097494238 12:60310101-60310123 TCCATGCCACACAGATGACAAGG - Intergenic
1099977130 12:89557830-89557852 TCCAGCACTCACAGAGGACATGG + Intergenic
1101377764 12:104185492-104185514 TTCAGGCATCACAGAGCACATGG - Intergenic
1102051099 12:109862469-109862491 TCCAACCCTCACAGGGGGCCAGG + Intronic
1102105383 12:110317044-110317066 TCCAGGCCTCACGGTGAACAGGG - Intronic
1105209593 13:18249990-18250012 CCCAGTCTGCACAGAGGACAGGG + Intergenic
1105613716 13:21992618-21992640 CCCAGCACTTACAGAGGAAAAGG - Intergenic
1105916883 13:24925225-24925247 TCCAGCACTTTCAGAGGCCAAGG - Intergenic
1106911496 13:34467981-34468003 TCCAGCACTTTCAGAGGCCAAGG + Intergenic
1108041739 13:46345633-46345655 ACCCACCCACACAGAGGACAGGG + Intronic
1110197727 13:72809837-72809859 TCCAGCACTTAGAGAGGCCAGGG - Intronic
1110316459 13:74113942-74113964 TCCAACCCTCACGGATGACTTGG + Intronic
1111245479 13:85533098-85533120 TCCAGCTGTCACAGAGGAAGTGG + Intergenic
1111842263 13:93464664-93464686 TCCAACCCTCATAGATGACTTGG - Intronic
1113882439 13:113635264-113635286 TCGAGCCCTCCCAGAGGGGACGG + Intronic
1115648294 14:35385165-35385187 CCCAGCCCTGGCAGAGGTCATGG + Intergenic
1115900366 14:38140530-38140552 TCCAATCCTCACAGAGTAGAGGG + Intergenic
1118683069 14:68263135-68263157 TTCAGCCCTCACAGAGCATCAGG - Intronic
1119198080 14:72732217-72732239 TCCAGCCATGACATCGGACAAGG + Intronic
1119276012 14:73356946-73356968 TCCAGCACTTAGAGAGGCCAAGG - Intronic
1121751885 14:96363820-96363842 TCCAGTCCTCCCAGCGGAGACGG - Exonic
1121955398 14:98208374-98208396 TCAAGTCCACAAAGAGGACAAGG - Intergenic
1122742774 14:103881598-103881620 TCCAGGCCACACAGAGGGCCAGG + Intergenic
1122994178 14:105253669-105253691 CCCAGCCCTCCCAGCGGGCAGGG - Intronic
1202880248 14_KI270722v1_random:51785-51807 TCCAGCCCTTTGAGAGGCCAAGG + Intergenic
1124239666 15:28019134-28019156 TCCTGGGCTCTCAGAGGACATGG - Intronic
1124589100 15:31037187-31037209 TCCAGCCCTCTCTGAGGCCCTGG - Intronic
1124613671 15:31225965-31225987 TACAGCTCTCAAAGAAGACAAGG + Intergenic
1124997455 15:34737504-34737526 TCCTGCCCTTAAAAAGGACAGGG - Intergenic
1125579140 15:40773543-40773565 TCTGGCCCTCAGAGAGGAAAAGG + Intronic
1126939447 15:53750741-53750763 TCCAACCCTCATAGATGACTTGG + Intronic
1128675516 15:69605548-69605570 TCCAACCCTAAGAGAAGACATGG - Intergenic
1129127562 15:73457258-73457280 CCCAGAGCTCACACAGGACAGGG - Intronic
1130553595 15:84907767-84907789 TCCACCCTGCACAGAGCACAGGG - Intronic
1131250762 15:90828502-90828524 TCCGGGCCTCACAGAAGAAATGG - Intergenic
1131652814 15:94420554-94420576 TGCAGCCTTCACAGATGACTTGG + Intronic
1133441023 16:5820966-5820988 TCCTGCCCTCCCAGAGGAGGTGG - Intergenic
1133776613 16:8900983-8901005 TCCAAACCTCATAGAGGATAAGG + Exonic
1134777299 16:16864273-16864295 TCCAGCCCTTAGGGAGGCCAAGG - Intergenic
1135028948 16:19022054-19022076 TCCAGAGCACACAGTGGACATGG - Intronic
1135270887 16:21068563-21068585 TCCAGCCCTCTGGGAGGCCAAGG - Intronic
1135623335 16:23974783-23974805 GCCAGGCCTCAGAGAGTACAGGG + Intronic
1137459427 16:48646519-48646541 CCCAGCACTCTCAGAGGCCAAGG - Intergenic
1137676145 16:50304746-50304768 TCCAGGCATCAAGGAGGACAGGG - Intronic
1139944891 16:70633716-70633738 TCAAGCCTTCACAGAGATCATGG - Intronic
1140199770 16:72885679-72885701 TCCAGAACTCAGAAAGGACAAGG + Intronic
1140230180 16:73111569-73111591 TCCCTCCCTCACAGAGAATATGG - Intergenic
1140873613 16:79129791-79129813 TCCATCCCTCAAAGAGCTCATGG + Intronic
1142104950 16:88297672-88297694 TCCGGCCCACAGAGAGGAGAGGG - Intergenic
1143449954 17:7030150-7030172 CCCAGCACACACACAGGACAGGG - Intronic
1144767893 17:17742827-17742849 TCCAGATCTCACTGGGGACAGGG - Intronic
1146091052 17:29878175-29878197 TCCAGCACTTTCAGAGGCCAAGG + Intronic
1146158487 17:30545067-30545089 TCCAGCTCTCATGGATGACAAGG + Intergenic
1147596066 17:41718373-41718395 CCCAGCCCTGAGAGGGGACAGGG - Intronic
1147678761 17:42225530-42225552 ACCAGCCCCCACAGATGCCAAGG - Intronic
1149249742 17:54754713-54754735 TCCAACTCTTACAGAGGGCACGG + Intergenic
1149933649 17:60781346-60781368 CCCAGCACTTACAGAGGACAAGG + Intronic
1150150557 17:62805659-62805681 CCCAGCACTTACAGAGGCCAAGG + Intronic
1150261478 17:63795580-63795602 TCCAGCACTCTGAGAGGCCAAGG - Intronic
1151030637 17:70733942-70733964 TCCAGGCCTCAGTGAGCACAGGG + Intergenic
1151736072 17:75941102-75941124 ACCCGCCCTCACAGAGGAGGTGG + Intronic
1151785916 17:76275023-76275045 TCCAGCCCTCAGTGAGGACCCGG - Intronic
1152702403 17:81825535-81825557 TGCAGCCCTCACAGAGGGCCAGG + Exonic
1153822456 18:8843983-8844005 TTCAGCCCTCACACAGGGCGGGG - Intergenic
1154945487 18:21157884-21157906 TACAGCCCTCTCGGTGGACATGG + Intergenic
1155468889 18:26169973-26169995 TTCCGCCCACACACAGGACAGGG + Intronic
1155645332 18:28070684-28070706 CCCAGCCCTCACAGAGCTCATGG + Intronic
1156242297 18:35266278-35266300 TCCAGCCATCACTGTGGCCATGG - Intronic
1156288660 18:35724356-35724378 ACCAGCCCTCACAGATGAGAGGG + Intergenic
1157094988 18:44679604-44679626 TCCAGCGCTCACCGGGGACGCGG + Intergenic
1157565530 18:48676730-48676752 TCCAGCCTTCACACGGGAGATGG + Intronic
1157747358 18:50147442-50147464 TCCAGCCGCCACAGGGTACATGG + Intronic
1159351894 18:67286240-67286262 ATCAGCCCTCACAGATGAGAAGG - Intergenic
1159954163 18:74507668-74507690 GGCAGGCCTCACAGAGGACGAGG - Intronic
1160338263 18:78062446-78062468 TCCAGTCCTCAAGGTGGACACGG + Intergenic
1161108363 19:2455599-2455621 TGCAGCCCTCACTCAGGACACGG + Intronic
1161141223 19:2649188-2649210 CCCAGCCCTTTCAGAGGACAAGG - Intronic
1161683113 19:5690373-5690395 TCCAACCTGCACAGAGGACCCGG - Intronic
1163779802 19:19240214-19240236 TCCAGCTCTTACAGAGGTTAGGG + Intronic
1164699590 19:30275163-30275185 TCCAGCTCCCCCAGAGGCCATGG - Intronic
1164712545 19:30367766-30367788 TCCTGGCCTCACAGATCACAGGG + Intronic
1164758502 19:30708974-30708996 CCCAGCACTCAGAGAGGTCAGGG - Intronic
1165085998 19:33347875-33347897 TCCAGCTTCCACAGAGGCCAGGG - Intergenic
1165243881 19:34486833-34486855 TCCTGCCGTCTGAGAGGACAAGG + Intronic
1165388874 19:35527249-35527271 TCCAGCCCTCACTGAGACCATGG + Exonic
1165388938 19:35527465-35527487 TCCAGCCCTCACTGAGACCATGG + Exonic
1165388983 19:35527627-35527649 TCCAGCCCTCACTGAGACCATGG + Exonic
1166731278 19:45060457-45060479 CCCAGACCTCACCGAGTACATGG - Exonic
1167066221 19:47188096-47188118 CCCAGCACTTTCAGAGGACAAGG + Intronic
925095179 2:1192914-1192936 CCCACTACTCACAGAGGACAGGG - Intronic
925538938 2:4945449-4945471 TACAGCCTTCAGAGAGCACATGG - Intergenic
925631943 2:5903475-5903497 TCCCACCCTCACAGAGGGAAAGG + Intergenic
925740244 2:6999344-6999366 TGCAGCCCACACAGAGGGGAAGG - Intronic
925844862 2:8026162-8026184 TCCTGCCCTTACACAGCACATGG + Intergenic
926047009 2:9717280-9717302 TTCAGCACTCACAGTGGACAAGG + Intergenic
926458432 2:13098149-13098171 TACAGCCCTCACAGAAAGCATGG - Intergenic
926792032 2:16583730-16583752 CCCAGACTTCAAAGAGGACATGG + Intronic
927711745 2:25330537-25330559 TACGGCCCTCACAGAGGAAGCGG + Intronic
927976826 2:27345031-27345053 TCCAGCACTTTGAGAGGACAAGG + Intronic
928607479 2:32956602-32956624 TCCAGCCCTCATGGATGACTTGG - Intronic
928820097 2:35351607-35351629 CCCAGCACTCTCAGAGGCCAAGG + Intergenic
930105096 2:47633112-47633134 TCCAGCCCTGCCTGAGGCCAGGG - Intergenic
930791141 2:55330245-55330267 ACCAGCACTTTCAGAGGACAAGG + Intronic
931383983 2:61780043-61780065 TCCAGCACTTTCAGAGGCCAAGG + Intergenic
932374253 2:71221478-71221500 CCCTGCCCTCACAGAGCTCACGG + Intronic
932518347 2:72378579-72378601 TACAGCCATCACAGAGTAAAAGG - Intronic
933266406 2:80185425-80185447 TCCAGCCCACACTCAGGAAAAGG + Intronic
933275851 2:80283722-80283744 TCCAGCTCTAAGAGAGCACAGGG - Intronic
935280209 2:101510905-101510927 GCCACCCCTCACACAGCACAGGG - Intergenic
936786036 2:116095049-116095071 TGCAGCCCTCCAAGTGGACATGG + Intergenic
937033322 2:118759395-118759417 TCCAGCCCGCACAGAGAGGATGG + Intergenic
937129170 2:119494386-119494408 TCCACCCCCAAGAGAGGACATGG + Intronic
937971131 2:127550313-127550335 CCCAGCACTTTCAGAGGACAAGG + Intronic
938013831 2:127850834-127850856 TCCAGCACTCTGAGAGGCCAAGG + Intronic
938083412 2:128382407-128382429 CCCAGCCCTCACCCAGCACATGG - Intergenic
941976739 2:171414165-171414187 TCCAGCCCTTTGAGAGGCCAAGG + Intronic
942295690 2:174514980-174515002 TCCAGCACTTTCAGAGGCCAAGG - Intergenic
942425644 2:175857693-175857715 TACAGCCCTTAAAGATGACATGG - Intergenic
943281814 2:185944325-185944347 TCCAGCCCACACACAAGACAAGG - Intergenic
945190484 2:207182482-207182504 CCCAGGCCCCACAGAGGAGAGGG + Intergenic
946014427 2:216592591-216592613 TCCAGTACTCAGAGAGGAGAGGG - Intergenic
946766918 2:223049516-223049538 CCCAGCCCTCACTCATGACAGGG - Intergenic
947048574 2:226017428-226017450 TCCAGCCCTTTGAGAGGCCAAGG - Intergenic
947510401 2:230747836-230747858 TCCACCTCTCTCAGAGAACAAGG - Intronic
947527334 2:230886647-230886669 TCCAGTCCCCACAGGGAACAGGG - Intergenic
948375075 2:237515901-237515923 CCGAGCCCTCACAGAGGAGCAGG + Intronic
948835613 2:240624698-240624720 TCCTGCCCTCAGGGTGGACAGGG + Intronic
948841264 2:240650634-240650656 TCCAACCCTCCCACAGGAAAGGG - Intergenic
949063249 2:241973822-241973844 TCCAGGCCACACAGAGCCCAGGG - Intergenic
1169206226 20:3741764-3741786 TCCAGCCCTGGCATAGGAGAAGG + Intronic
1169427651 20:5509269-5509291 TTCAGCCCTCAGAGAGGAGGTGG - Intergenic
1170359032 20:15524267-15524289 TCCAGCCCTTTCAGGGGCCAAGG + Intronic
1170971179 20:21117921-21117943 TCCAACTCTCCCTGAGGACAAGG - Intergenic
1170979095 20:21194254-21194276 GCCAGACCTCACAGAGAACAAGG + Intronic
1174098559 20:48108903-48108925 TCCCTCCCTCACAGAGCAGATGG - Intergenic
1174132101 20:48352456-48352478 TGCAGGACTCACAGAGGAAATGG + Intergenic
1174138802 20:48398635-48398657 CCCAGCCCCCAAAGAGCACAGGG + Intergenic
1174420501 20:50396308-50396330 TCCGGCCCTAAGAGAGGACAGGG + Intergenic
1175915883 20:62425570-62425592 GCCCGGCCTCCCAGAGGACAGGG - Intronic
1179146185 21:38769794-38769816 TCCACCCCTCACAGAGGCGCAGG + Intergenic
1179490366 21:41737207-41737229 TGCAGCCCTCCCAGTGGCCAGGG - Intergenic
1179551013 21:42144028-42144050 CCCTGCCCTCACAGAGCACACGG + Intergenic
1180239953 21:46495821-46495843 CCCAGCACTTACAGAGGCCAAGG + Intronic
1180297868 22:10961144-10961166 TCCAGCCCTGACAGGGGCCAGGG + Intergenic
1180410550 22:12602644-12602666 TCCAGCCCGGACAGGGGCCAGGG - Intergenic
1180766671 22:18349409-18349431 CCCAGTCTGCACAGAGGACAGGG - Intergenic
1180779642 22:18512969-18512991 TCCAGTCTGCACAGAGGACAGGG + Intergenic
1180812358 22:18770290-18770312 CCCAGTCTGCACAGAGGACAGGG + Intergenic
1180860182 22:19074509-19074531 GCAAGACCTCACAGAGCACAGGG + Intronic
1181172111 22:21015596-21015618 TCCAGCTCTCACAGATGTTAAGG - Intronic
1181177196 22:21044608-21044630 TCCAGCTCTCACAGATGTTAAGG + Intergenic
1181198517 22:21204537-21204559 CCCAGTCTGCACAGAGGACAGGG + Intergenic
1181401221 22:22651263-22651285 CCCAGTCTGCACAGAGGACAGGG - Intergenic
1181648309 22:24245628-24245650 CCCAGTCTGCACAGAGGACAGGG + Intergenic
1181703186 22:24632343-24632365 CCCAGTCTGCACAGAGGACAGGG - Intergenic
1182768494 22:32776077-32776099 TGGTGCCCTCACAGAGGACGAGG + Intronic
1183382812 22:37498879-37498901 CCCAGCACCCACAGAGGGCAAGG - Intronic
1184107951 22:42379370-42379392 TCCAGGCCTCACAGTGGGCGTGG + Intergenic
1184121426 22:42452914-42452936 TCCAGCCCACACACAGGGCCAGG - Intergenic
1185310545 22:50151873-50151895 CCCAGGCCCCACACAGGACAAGG - Intronic
1185372275 22:50466432-50466454 TGCCGCCCTCACGGAGCACAAGG - Exonic
1203228288 22_KI270731v1_random:90300-90322 CCCAGTCTGCACAGAGGACAGGG - Intergenic
949422208 3:3878108-3878130 TCCAGCCCTGTCTGAGGTCAAGG - Intronic
950224193 3:11220372-11220394 TACTGTTCTCACAGAGGACAGGG - Intronic
950500280 3:13359254-13359276 TACAGCCCTGAGAGGGGACAGGG + Intronic
952465849 3:33584853-33584875 ACCAGAGCTCACAGTGGACAGGG + Exonic
952970167 3:38645692-38645714 TGCAGCCCTCACTGAGGGAAAGG + Intronic
953828958 3:46278777-46278799 TTTAGCCCTCAGAGAGGACAAGG - Intergenic
954395047 3:50289064-50289086 TCCTGGCCTGACAGAGGCCAAGG - Intronic
954704756 3:52473470-52473492 GGCAGCCCTTACAGAGGAAATGG + Intronic
954787173 3:53102239-53102261 TCGAGCCTTCAGAGAGAACACGG + Intronic
955188372 3:56736840-56736862 TCCAGCACTTTCAGAGGATAAGG + Intronic
955402849 3:58605676-58605698 TCCAGCCATGATAGAGGACCTGG - Intronic
957625753 3:82650521-82650543 TCCAGCCCACCAAGAGCACAGGG - Intergenic
958432619 3:94060201-94060223 TTCTGCCCACACACAGGACAGGG + Exonic
958996430 3:100910623-100910645 TCCAGCACTTAGGGAGGACAAGG - Intronic
961578288 3:127856519-127856541 TCCAGACCTCACACAGCACGTGG - Intergenic
961782816 3:129331122-129331144 CCCAGGCCTCACAGAGGGCCTGG - Intergenic
962065092 3:131971351-131971373 TCCAGCTCTCACAGAAGGAACGG + Intronic
962293285 3:134155336-134155358 TCCAGTCTTCACAGAGGAGATGG + Intronic
962505983 3:136046641-136046663 ACCTGCCCTCACAGATGAGAAGG + Intronic
963083615 3:141416873-141416895 TGCAGCCCTCACAGAGAGCACGG + Intronic
964554557 3:157921969-157921991 TCCAGCCCTCACACTGGATGGGG + Intergenic
967174496 3:186851092-186851114 TCCATCCCTCACAGAGGAGTAGG + Intronic
967823981 3:193863977-193863999 TCCAGCCTTCACACAGGCCTCGG + Intergenic
967883876 3:194320322-194320344 TCCTGCCCTCTTTGAGGACAGGG - Intergenic
969235505 4:5862588-5862610 ACCAGCTCTAACAGAGGACAGGG + Intronic
969650722 4:8466379-8466401 TCCAGCCCCCACAGAGACCCGGG - Intronic
970123947 4:12788618-12788640 TCCAGCCCTTTGAGAGGTCAAGG + Intergenic
971752630 4:30670214-30670236 CCCAGCACTCATAAAGGACAAGG - Intergenic
971783798 4:31074530-31074552 CCCAGCACTCTCAGAGGCCAAGG + Intronic
971835379 4:31756371-31756393 TCCAGCACTTTCAGAGGCCAAGG - Intergenic
971838246 4:31797546-31797568 TCCAGCACTCTGAGAGGCCAAGG - Intergenic
972281871 4:37609679-37609701 TCCAACCCTCACAGATGACTTGG + Intronic
976398424 4:84582649-84582671 TCCAGCCCTCGCAGCGGCCCAGG + Intergenic
976431941 4:84972389-84972411 TCCAGCACTTTCAGAGGCCAAGG + Intergenic
977548222 4:98411363-98411385 TCCAGCACTTTCAGAGGCCAAGG + Intronic
977658012 4:99545979-99546001 TCAAGCCCTGACAGAGTAAATGG + Intergenic
978768786 4:112432241-112432263 TGCAGTCCTCGCTGAGGACAGGG - Exonic
979523901 4:121697321-121697343 TCCTGCGGTCACAGAGGGCAGGG - Intergenic
981541367 4:145849902-145849924 TCCAGAACTGAGAGAGGACACGG + Intronic
981928339 4:150164019-150164041 TCCAGCACTTTCAGAGGCCAAGG - Intronic
982450134 4:155543262-155543284 TCCAGCCCTTGCTGTGGACAGGG + Intergenic
983282233 4:165695391-165695413 GCCAGCCCAGACAGAGCACAAGG - Intergenic
983548281 4:168986690-168986712 TCCAGCACTTTCAGAGGCCAAGG + Intronic
984801630 4:183722126-183722148 CCCAGCACTCTGAGAGGACAAGG + Intergenic
985437168 4:189941188-189941210 TCCAGCCCGGACAGGGGCCAGGG - Intronic
985661859 5:1161370-1161392 AGCAGCATTCACAGAGGACAGGG - Intergenic
985721204 5:1490179-1490201 CCCAGTCTTCACAGAGGACAGGG + Intronic
985912670 5:2896036-2896058 TCCAGCCTTCACTGAGGCCAGGG - Intergenic
986050808 5:4088455-4088477 TCCAGTCCTTACCTAGGACATGG - Intergenic
986543760 5:8873382-8873404 TCCAGCCCTGTCAGAGATCAGGG + Intergenic
988427034 5:31075678-31075700 TGCAGGCCTCTCAGAGGACAAGG - Intergenic
988803046 5:34714862-34714884 TCTAGCCATCAAAGTGGACAAGG + Intronic
990540354 5:56766344-56766366 CCCAGCACTCAGAGAGGCCAAGG - Intergenic
991468443 5:66940692-66940714 TCCAACTCTCACAGATGACTGGG - Intronic
992364184 5:76074949-76074971 TCCAGCCCTAAAAGAGCACCTGG - Intergenic
992834669 5:80628337-80628359 TTCCGCCCACACACAGGACAGGG + Exonic
993668579 5:90731459-90731481 TCTACCCCTCACAGAGCAAATGG - Intronic
994157011 5:96514999-96515021 TCCAGCACTTAGGGAGGACAGGG - Intergenic
994927888 5:106142692-106142714 TCCAACCCTCACCAAGGATATGG + Intergenic
995931300 5:117449326-117449348 CCTTGCCGTCACAGAGGACATGG + Intergenic
997253199 5:132407286-132407308 CCTAGCTCCCACAGAGGACATGG + Intergenic
997528407 5:134567877-134567899 TCCAGCCAGGACAGAGGGCAAGG + Intronic
997594302 5:135095945-135095967 TCCACCACTGACAAAGGACAGGG - Intronic
997674655 5:135703742-135703764 TCCAGTCCTCACAGAGCCCACGG - Intergenic
998344705 5:141451629-141451651 TCCAGCACTCTGAGAGGCCAAGG + Intronic
998463018 5:142323489-142323511 TCCTGCCCTCACAGAGGCCTTGG + Intronic
999751823 5:154633167-154633189 TCCAGCACTCTGAGAGGCCAAGG - Intergenic
999879513 5:155845818-155845840 CCTAGACCTCACAGAGGACCAGG + Intergenic
1001039662 5:168325165-168325187 GCCTGCCATCTCAGAGGACAAGG - Intronic
1001343940 5:170873159-170873181 CCCAGCCCTTAGAGAGGCCAAGG - Intronic
1003097697 6:3155665-3155687 TCCAGACCTGACAGAGTCCATGG + Exonic
1003236822 6:4302305-4302327 TGCAATCCTCACAGAGGTCAAGG - Intergenic
1006053814 6:31365595-31365617 TTCTGCCCACACACAGGACAGGG + Intergenic
1006407691 6:33854857-33854879 TCCAGCCCAGACAGGGGAAATGG - Intergenic
1007366048 6:41393856-41393878 TCCAGACCCCACAGAGGAGGTGG - Intergenic
1007718061 6:43868886-43868908 TCCTGACCTCTCAGAGGACACGG - Intergenic
1009339135 6:62531816-62531838 TCCAGCACTTTCAGAGGCCAAGG - Intergenic
1009906007 6:69870414-69870436 CACAGACTTCACAGAGGACATGG + Intronic
1010432676 6:75796716-75796738 TCCAGCACTCTGAGAGGCCAAGG - Intronic
1011566819 6:88683762-88683784 CCCAGCACTCTGAGAGGACAAGG + Intronic
1011777249 6:90745398-90745420 TGCATCCCTAACAGAGGAAAAGG - Intergenic
1013009250 6:106105208-106105230 TCCAGCCCTCACAGCAGCCCTGG + Exonic
1013092735 6:106914830-106914852 TCCAGCACTCTCAGAGGCCAAGG + Intergenic
1014488071 6:122025628-122025650 TCCTGTCCTCAAAGAGGCCAAGG + Intergenic
1015632259 6:135243643-135243665 TCCAGCCCTCTGGGAGGCCAAGG + Intergenic
1017176216 6:151507120-151507142 TGGAGCCCACACAGAGGGCAGGG + Intronic
1019077009 6:169395879-169395901 TGCAGCCCTGTCAGAGAACACGG - Intergenic
1019396581 7:823215-823237 TCCTGCCGTCACAGAGTTCAAGG + Intronic
1019492821 7:1323092-1323114 TGCAGCCATCGCAGAGGGCAAGG + Intergenic
1019538442 7:1540693-1540715 GGCAGCCCCCACAGAGGACGCGG - Exonic
1019862839 7:3676267-3676289 TCCAGCACTTTCGGAGGACAAGG - Intronic
1020151283 7:5683895-5683917 TCCAGCCTGCACAGAGAATAGGG + Intronic
1020689799 7:11339926-11339948 TCCATCCCTCACAGGAAACAAGG - Intergenic
1021368087 7:19806624-19806646 TCCTGCCCTCAATGAGGAAAAGG - Intergenic
1023204092 7:37729354-37729376 GCCAGCTCTCTCAGGGGACAGGG - Intronic
1023868360 7:44249584-44249606 TCCAGCCCTCAGGGAGGTGATGG - Intronic
1023958403 7:44906403-44906425 TCCAGCACTTTCAGAGGCCAAGG - Intergenic
1024335912 7:48204705-48204727 TCCAGCCCTTACACAGCCCAAGG + Intronic
1024360224 7:48460342-48460364 TGGAGCCTTCAGAGAGGACATGG - Intronic
1024612566 7:51080121-51080143 TCAAGACCTTACAGAGGTCAGGG + Intronic
1024866421 7:53908966-53908988 TTCAGCCCTCAAAGATGAAAGGG - Intergenic
1025474198 7:60899809-60899831 CACAAACCTCACAGAGGACATGG + Intergenic
1025512804 7:61590065-61590087 CACAAACCTCACAGAGGACATGG - Intergenic
1026303388 7:69118933-69118955 TCCAGCACTTTAAGAGGACAAGG - Intergenic
1027027748 7:74866601-74866623 TCCAGCACTTACAGAGGCCAAGG + Intergenic
1027060005 7:75077494-75077516 TCCAGCACTTACAGAGGCCAAGG - Intergenic
1027109960 7:75429760-75429782 TCCAGCACTCAGAGAGGCCAAGG + Intronic
1027949095 7:84790094-84790116 TCCAGCACTTTCAGAGGCCAAGG + Intergenic
1029395287 7:100303989-100304011 TCCAGCACTCTGAGAGGCCAAGG + Intergenic
1029403096 7:100357424-100357446 TTCAGTCCTCAGAGAGGAGAAGG - Intronic
1029737327 7:102472105-102472127 TGCAGCCTTCACACAGGGCAGGG + Intronic
1030413756 7:109213856-109213878 TGCAGCTCTCACAGAGAAAAAGG - Intergenic
1031082369 7:117271258-117271280 CCCAGCACTTTCAGAGGACAAGG - Intergenic
1031541976 7:123005773-123005795 ACCAGCCCTCACAGATGCCTTGG + Intergenic
1032113897 7:129100786-129100808 TCTAACCCTCTCAGAGGCCAAGG - Intergenic
1032240211 7:130154062-130154084 TCCCTGCCTCACTGAGGACACGG - Intergenic
1032496792 7:132368775-132368797 CCCAGCCCTCCCAAAGCACATGG + Intronic
1032513340 7:132489375-132489397 TCCCGTCTTCACGGAGGACAGGG - Exonic
1032823888 7:135550697-135550719 TCCAGCACTCTGAGAGGCCAAGG - Intergenic
1033224096 7:139547188-139547210 TTCAGCCCACAAAGGGGACAGGG - Intergenic
1034092731 7:148379025-148379047 TCCAGCCCTGACACAGCATATGG - Intronic
1034361890 7:150506781-150506803 TCCAACCCTCATAGATGACTTGG + Intergenic
1036224927 8:6949639-6949661 TCCTCCCCTCCGAGAGGACAGGG - Intergenic
1037743238 8:21623693-21623715 TCCAGCCCTCAGAAAGGGCATGG - Intergenic
1037930259 8:22875632-22875654 TTCAGCCTTCGCAGACGACAGGG - Intronic
1038434333 8:27524383-27524405 TCCAGCCCTGAGAGACCACATGG - Intronic
1038615602 8:29090966-29090988 CCCAGCCCTCAGGGAGGCCAAGG - Intronic
1038844026 8:31212377-31212399 TCCAGCACTCTGGGAGGACAAGG - Intergenic
1039160038 8:34607904-34607926 TCCAGCACTTAGAGAGGCCAAGG - Intergenic
1039382498 8:37099434-37099456 TGCAGGCATCACAGAGGACCAGG + Intergenic
1039441849 8:37600483-37600505 TCCAGCACTCAGGGAGGCCAAGG + Intergenic
1040068269 8:43166945-43166967 TCCAGCCCTCATGGATGACTCGG + Intronic
1041583212 8:59486387-59486409 TCCAGCCCACACACAGGAGGAGG - Intergenic
1041886624 8:62816699-62816721 TTCAGCCCTCAGAGTGGATATGG + Intronic
1044705542 8:95004832-95004854 TCCTGCCCTCACAGAACAGATGG - Intronic
1045503198 8:102758897-102758919 TACTGCAATCACAGAGGACAAGG + Intergenic
1047803382 8:128333025-128333047 TCCTGCCCTCTAAGAGAACAGGG - Intergenic
1048657564 8:136558091-136558113 TCCTCCCCTCCCAGAGGAGATGG - Intergenic
1049749475 8:144276508-144276530 TCCAGCCCTCACAGAGGACAGGG - Intronic
1050173883 9:2850458-2850480 TCTACCCCTCACACAGCACAGGG + Intergenic
1050257185 9:3807360-3807382 TCCAGCACTGACAAAAGACAAGG - Intergenic
1050351881 9:4747954-4747976 TAAGGCCCTCTCAGAGGACAGGG + Intergenic
1052350368 9:27452328-27452350 GAAAGCCTTCACAGAGGACATGG + Intronic
1053015337 9:34658673-34658695 TCCAGGCCTCACCGTGGACCAGG - Exonic
1053841575 9:42191951-42191973 TCCAGGCCTCAGAGAGGACCTGG - Intergenic
1054768677 9:69064684-69064706 TGCAGACCTCACAGGGAACAGGG + Intronic
1054932900 9:70654449-70654471 TTGAGCCCTCTCAGAGGTCATGG + Intronic
1055130238 9:72766584-72766606 TCCTGCCTACACAGGGGACATGG - Intronic
1056578886 9:87876205-87876227 TCCAGCCATCCCGGAGGATAGGG + Intergenic
1056960455 9:91117997-91118019 TCCACGCCTCTCAGAGGGCAAGG + Intergenic
1057323970 9:94043093-94043115 TCCAGCCCTCATGGATGACTTGG - Intronic
1058039853 9:100291784-100291806 TCCAGCACTTAGAGATGACAAGG - Intronic
1058404192 9:104653273-104653295 TCCATCCCTCACAGATACCAAGG - Intergenic
1060250331 9:121981882-121981904 TCCAGGGCTCACACAGGGCACGG - Intronic
1060261962 9:122083559-122083581 TCCAGCACTTTGAGAGGACAAGG + Intronic
1060524946 9:124315220-124315242 GGCAGGCCTCACAGAGGGCAGGG + Intronic
1060996378 9:127876746-127876768 AGGAGGCCTCACAGAGGACAGGG + Intronic
1061527493 9:131178901-131178923 TCCAGCCCTCAAACATGGCATGG - Intronic
1061919343 9:133774197-133774219 TGAAGGCCTCACAGAGGACCAGG - Intronic
1062623390 9:137432699-137432721 TCGAGCCCACACAGAGGCCGGGG + Intronic
1203449510 Un_GL000219v1:99276-99298 TCCAGCCCGGACAGGGGCCAGGG + Intergenic
1185572434 X:1145327-1145349 TCCAGCCCTTCCAGAGGTGAAGG + Intergenic
1185861311 X:3582151-3582173 TCCATCACCCACAGAGGATAGGG + Intergenic
1186090615 X:6044015-6044037 TCCAGCACTCTGAGAGGCCAAGG + Intronic
1186488768 X:9954742-9954764 TCCAACACTCAAAGAGCACAGGG - Intergenic
1189517744 X:41732419-41732441 TCCCACCCTGACAGAGCACAAGG - Intronic
1190541713 X:51484236-51484258 TCCAGCCATCACACAGTGCAGGG + Intergenic
1190844569 X:54180434-54180456 TCCCGTCCTCAAGGAGGACAAGG - Intronic
1192024139 X:67430658-67430680 TTCAGGGCTCACAGATGACAAGG - Intergenic
1192169387 X:68844791-68844813 ACCAGCCCCCACCCAGGACAGGG + Intergenic
1192298722 X:69878435-69878457 AACAGCCATCTCAGAGGACAAGG + Intronic
1192410620 X:70929755-70929777 CCCAGCCAACACAGAAGACAGGG + Exonic
1197051595 X:122065455-122065477 TCCAGCTTCCAGAGAGGACAAGG + Intergenic
1198565073 X:137895890-137895912 TCCACCCTTCACAGAGGATGGGG - Intergenic
1198577570 X:138026659-138026681 TCTAGCCCTTTCAGATGACAAGG + Intergenic
1199107424 X:143886924-143886946 CCCAGCCCTGACAGAGGAAATGG - Intergenic
1199360130 X:146907635-146907657 CCCAGCCCCCAAAGAGCACAGGG + Intergenic
1201682845 Y:16667750-16667772 TCCAGCACTCGGAGAGGCCAAGG - Intergenic