ID: 1049749476

View in Genome Browser
Species Human (GRCh38)
Location 8:144276509-144276531
Sequence GTCCAGCCCTCACAGAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 208}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049749476_1049749483 6 Left 1049749476 8:144276509-144276531 CCTGTCCTCTGTGAGGGCTGGAC 0: 1
1: 0
2: 1
3: 12
4: 208
Right 1049749483 8:144276538-144276560 CTCCCGGGGCCTCTGTCCCTGGG No data
1049749476_1049749478 -10 Left 1049749476 8:144276509-144276531 CCTGTCCTCTGTGAGGGCTGGAC 0: 1
1: 0
2: 1
3: 12
4: 208
Right 1049749478 8:144276522-144276544 AGGGCTGGACTGCAGCCTCCCGG No data
1049749476_1049749482 5 Left 1049749476 8:144276509-144276531 CCTGTCCTCTGTGAGGGCTGGAC 0: 1
1: 0
2: 1
3: 12
4: 208
Right 1049749482 8:144276537-144276559 CCTCCCGGGGCCTCTGTCCCTGG No data
1049749476_1049749491 23 Left 1049749476 8:144276509-144276531 CCTGTCCTCTGTGAGGGCTGGAC 0: 1
1: 0
2: 1
3: 12
4: 208
Right 1049749491 8:144276555-144276577 CCTGGGCTGACACGGGTGTCAGG No data
1049749476_1049749488 16 Left 1049749476 8:144276509-144276531 CCTGTCCTCTGTGAGGGCTGGAC 0: 1
1: 0
2: 1
3: 12
4: 208
Right 1049749488 8:144276548-144276570 CTCTGTCCCTGGGCTGACACGGG No data
1049749476_1049749480 -8 Left 1049749476 8:144276509-144276531 CCTGTCCTCTGTGAGGGCTGGAC 0: 1
1: 0
2: 1
3: 12
4: 208
Right 1049749480 8:144276524-144276546 GGCTGGACTGCAGCCTCCCGGGG No data
1049749476_1049749479 -9 Left 1049749476 8:144276509-144276531 CCTGTCCTCTGTGAGGGCTGGAC 0: 1
1: 0
2: 1
3: 12
4: 208
Right 1049749479 8:144276523-144276545 GGGCTGGACTGCAGCCTCCCGGG No data
1049749476_1049749487 15 Left 1049749476 8:144276509-144276531 CCTGTCCTCTGTGAGGGCTGGAC 0: 1
1: 0
2: 1
3: 12
4: 208
Right 1049749487 8:144276547-144276569 CCTCTGTCCCTGGGCTGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049749476 Original CRISPR GTCCAGCCCTCACAGAGGAC AGG (reversed) Intronic
900178603 1:1301767-1301789 GTCCAGCCCCCACAGCAGAGAGG - Intronic
900421027 1:2556011-2556033 TTCCACCCCTCCCAGGGGACGGG + Intronic
900587459 1:3440070-3440092 GTCCACCCCTCCCAGTGGGCCGG + Intergenic
901029492 1:6298783-6298805 GCCCAGCCCTCACAGGGTAGAGG + Intronic
901158806 1:7159400-7159422 CTCCAGCCCAAACAGAAGACAGG + Intronic
902362073 1:15947374-15947396 GCCCACCCTGCACAGAGGACAGG + Intronic
906616451 1:47235812-47235834 GTCCAGTACTCAGAGAGGGCAGG - Intergenic
907535632 1:55153184-55153206 GATCAGCCCTCTCAGAGGAGAGG + Intronic
907576101 1:55527165-55527187 CTCCTGCCCTCACAGAGTTCAGG - Intergenic
912941583 1:114049774-114049796 CGGCAGCCCTCACTGAGGACTGG - Intergenic
914357465 1:146899071-146899093 GGCCAGCCCTGACAGTGGTCAGG + Intergenic
915217931 1:154352375-154352397 GTCCACCCCTCCCACAAGACAGG + Intergenic
915626362 1:157116301-157116323 CTCCAGCAGTGACAGAGGACAGG - Intergenic
918002171 1:180508451-180508473 TGGCAGCCCTCACAGAGGGCTGG + Intergenic
918151329 1:181799978-181800000 GTTCTGCCCTCTCAGAGGAGTGG - Intronic
918229674 1:182516117-182516139 GTCTACCCGTCACATAGGACCGG - Intronic
919747507 1:201017762-201017784 GCCCAGCCTTCATAAAGGACAGG + Intronic
922067350 1:222157158-222157180 GTCAAGCCCTGAGAGAGGAGAGG - Intergenic
922535296 1:226375461-226375483 TTCCAGCCCACGCACAGGACGGG + Intronic
924185352 1:241483683-241483705 GTCCAGCCTTCAGAGATAACTGG + Intergenic
1062896726 10:1108984-1109006 ATCCTGCCCTCAAAGGGGACAGG - Intronic
1065916861 10:30360055-30360077 GTCCAGCCCTGACAGCCAACAGG - Intronic
1066484323 10:35828679-35828701 GCCAAGCCCACACAGCGGACGGG + Intergenic
1067460384 10:46453915-46453937 GTCCAGCCCTCAGCAAGAACAGG - Intergenic
1067748263 10:48952780-48952802 GTCTTGCTCTCACAGAGGACGGG - Intronic
1067998416 10:51302736-51302758 ATCCAGCACTCACAATGGACAGG + Intronic
1069884235 10:71613504-71613526 GCCCAGCCCATACAGTGGACTGG + Intronic
1072078319 10:92001406-92001428 TTCCAGACCTCACACAGGGCTGG + Intronic
1074136187 10:110628628-110628650 GTTCAGCACTCACACAGGACCGG - Intergenic
1074409425 10:113212719-113212741 GTCCAGACCTCACAGATCAAGGG + Intergenic
1074430705 10:113391807-113391829 GTGGAGCCCTCATATAGGACAGG - Intergenic
1076137015 10:128052142-128052164 CTCCAGTGCTCTCAGAGGACGGG - Intronic
1077236034 11:1482415-1482437 GCCCAGCCCTCTCTGAGGACCGG - Intronic
1077440382 11:2566098-2566120 CTCCAGCCCTGCCAGGGGACAGG - Intronic
1077712504 11:4551209-4551231 GTCTAGCCATCACATGGGACTGG + Intergenic
1081041464 11:38219764-38219786 GGCCAGCCATCCCAGAGAACTGG - Intergenic
1083033625 11:59616013-59616035 TTCCAGCGCTCAGGGAGGACGGG + Exonic
1083439512 11:62666549-62666571 ATCCAGCACTCGCAGAGGACTGG - Exonic
1083720845 11:64602821-64602843 GTGCAGCGCACACAGAGGTCTGG + Intergenic
1083882626 11:65555941-65555963 GGCCAGGCCTCACAGAGCAGAGG + Intronic
1084266649 11:68008582-68008604 CTCCATCCCACACAGAGGACAGG + Intronic
1084427915 11:69095623-69095645 TTCCAGACCCCACAGAGGCCGGG - Intergenic
1085258220 11:75189233-75189255 GCCCAGCTCTTACAGAGCACTGG + Intronic
1089176592 11:116553013-116553035 GTCCAGCTCTCTCTGAGAACTGG + Intergenic
1091018876 11:132080655-132080677 GTCCAGCACTCATACAGAACAGG - Intronic
1091442424 12:521772-521794 GTACCGGCCTCACTGAGGACAGG + Intronic
1092821476 12:12357283-12357305 GTCCAGCCCACGCAGGGGCCTGG - Exonic
1096183846 12:49565828-49565850 CTCCAGCCCTCTGAGATGACAGG + Intronic
1103328091 12:120134830-120134852 GTCCAGCTCTCATACAGGGCTGG + Intronic
1103607555 12:122098388-122098410 GTGCTGCCCTCCCAGACGACTGG + Intronic
1104437906 12:128770451-128770473 CTCCAGTGCTGACAGAGGACGGG - Intergenic
1104761697 12:131300750-131300772 GTGCAGCCTTCACAGGGGATGGG + Intergenic
1104818076 12:131660035-131660057 GTGCAGCCTTCACAGGGGATGGG - Intergenic
1107249217 13:38338201-38338223 GGCCAGCACTCACAGAGAGCTGG - Intergenic
1112218763 13:97465192-97465214 GACCACCCCTAACAGAGGGCGGG - Exonic
1112397514 13:99046593-99046615 GTCCAGGACTCACAGATGAGGGG + Intronic
1112491007 13:99863825-99863847 CCCCAGCCCCCACAGAGGGCAGG + Intronic
1113957564 13:114107478-114107500 GCCCAGCCCTCAGACAGGACAGG - Intronic
1115479292 14:33845726-33845748 ATGCAGCCATCACTGAGGACAGG + Intergenic
1115757310 14:36542362-36542384 GTCCAGCCCACACTCAGGAGGGG - Intergenic
1116909167 14:50439816-50439838 GTGCAGCCCTAACTGAAGACAGG + Intronic
1119890123 14:78176112-78176134 GTCCACCCTTCCCAGAAGACAGG - Intergenic
1120782093 14:88494414-88494436 GTCCAGCCCTTTGAGAGGCCGGG + Intronic
1121568187 14:94926159-94926181 GTCCAGCTCTCCCTGAGGCCTGG + Intergenic
1122245850 14:100402955-100402977 GTCAACCCCTCAGAGAGGGCTGG - Intronic
1122357190 14:101130867-101130889 GTCCAGCCCACACACTGGAGGGG + Intergenic
1122994180 14:105253670-105253692 GCCCAGCCCTCCCAGCGGGCAGG - Intronic
1124490020 15:30149918-30149940 GTCCAGCCCTGACAGCCAACAGG + Intergenic
1124608089 15:31186101-31186123 GCCCTGGCCTCTCAGAGGACTGG - Intergenic
1124753512 15:32388409-32388431 GTCCAGCCCTGACAGCCAACAGG - Intergenic
1124975257 15:34524111-34524133 GTCCAGCCCTGACAGCCAACAGG - Intergenic
1125875854 15:43143635-43143657 CTCCAGCCACCACAGAGGCCAGG - Intronic
1127759257 15:62121872-62121894 GCCCAGACCACAGAGAGGACAGG + Intergenic
1127772237 15:62241518-62241540 GTCCAGCCCTGACAGCCAACAGG - Intergenic
1127822392 15:62670132-62670154 GTCAAGCCCTCTCAGAGCAATGG - Intronic
1129039147 15:72670764-72670786 GTCCAGCCCTGACAGCCAACAGG + Intergenic
1129399659 15:75274614-75274636 GTCCAGCCCTGACAGCCAACAGG + Intronic
1131507062 15:93028518-93028540 GTGCAGCCCAGACAGAGGAAGGG + Intergenic
1131905222 15:97135087-97135109 GTCCATCCCTGGCAGAGGCCTGG + Intergenic
1132546919 16:537489-537511 GTGCAGTCCTCACACAGAACGGG + Intronic
1134120163 16:11578225-11578247 GTCCAGCCCACACACAGGAGAGG - Intronic
1135704572 16:24663774-24663796 GTCCAGCCCCTCCAGAGGTCAGG + Intergenic
1135788449 16:25371794-25371816 GTCCAGTCCTCAGGGAGGAAGGG - Intergenic
1136696191 16:32084102-32084124 GTCCAGCCCTCACCTTGGGCAGG - Intergenic
1136868007 16:33771409-33771431 GTCCAGCCCTCACCTTGGGCAGG + Intergenic
1137676146 16:50304747-50304769 GTCCAGGCATCAAGGAGGACAGG - Intronic
1139559122 16:67730446-67730468 TTCCAGGCCTCACAGGGGAATGG + Intronic
1139976720 16:70818223-70818245 GGCCAGCCCTGACAGTGGTCAGG - Intronic
1140318352 16:73921834-73921856 GTCAAGCCAGCACAGAGCACAGG + Intergenic
1141256535 16:82407896-82407918 GTGCCTCCCTTACAGAGGACCGG - Intergenic
1203104170 16_KI270728v1_random:1344869-1344891 GTCCAGCCCTCACCTTGGGCAGG - Intergenic
1203129344 16_KI270728v1_random:1617499-1617521 GTCCAGCCCTCACCTTGGGCAGG + Intergenic
1142791789 17:2272343-2272365 GTCCAGCCCTGGCAGAGGCATGG - Intronic
1142997519 17:3769557-3769579 CACCAGCTCTGACAGAGGACTGG + Intronic
1144373760 17:14618708-14618730 GTGCAGCCCTCTCTCAGGACTGG + Intergenic
1144663860 17:17089011-17089033 GTCCAGCCCACACACAGGCACGG + Intronic
1147390002 17:40103296-40103318 GTCCAGCCCTGACAGACACCTGG - Intergenic
1152241638 17:79164165-79164187 GCCCACCCCTCCCAGAGGCCTGG - Intronic
1152845937 17:82599817-82599839 GGCCAGCCCTCTCAGACCACAGG - Intronic
1153822457 18:8843984-8844006 TTTCAGCCCTCACACAGGGCGGG - Intergenic
1155468888 18:26169972-26169994 GTTCCGCCCACACACAGGACAGG + Intronic
1156288659 18:35724355-35724377 CACCAGCCCTCACAGATGAGAGG + Intergenic
1159737284 18:72115267-72115289 GTCCAGAGATCACATAGGACTGG - Intergenic
1164141232 19:22466283-22466305 GTCCTGCCCTTCCAGAGGCCTGG - Intronic
1164224393 19:23229312-23229334 GTCCTGCCCTTCCAGAGGCCTGG + Intronic
1164297199 19:23922458-23922480 GTCCTGCCCTTCCAGAGGCCTGG - Intronic
1164543461 19:29139847-29139869 GTCCAGCCCTCACCAACTACAGG + Intergenic
1164625490 19:29724834-29724856 GTGCAGCCTTCCCAGAGGATGGG - Intergenic
1164630740 19:29760086-29760108 GGCCATCCCTCACACAGCACAGG - Intergenic
929390001 2:41458914-41458936 GGCCAGTTCTTACAGAGGACTGG - Intergenic
930070145 2:47359609-47359631 GACCAGCCCCGATAGAGGACTGG - Intronic
931769315 2:65484168-65484190 GTGCAGCACCAACAGAGGACGGG + Intergenic
937335482 2:121059781-121059803 GCCCAGCCCTGACAGTGGCCTGG + Intergenic
938117643 2:128612786-128612808 GTCCCTGCCTCACAGAGGCCTGG - Intergenic
941373228 2:164694326-164694348 CTCCAGCCAACACAGAGGAAGGG - Exonic
945190482 2:207182481-207182503 GCCCAGGCCCCACAGAGGAGAGG + Intergenic
946359405 2:219210105-219210127 CACCAGCCCACAGAGAGGACGGG + Intronic
947575818 2:231273413-231273435 GTGCAGCTCCCACAGGGGACTGG - Intronic
1169234864 20:3922720-3922742 ATTCACCCCTAACAGAGGACAGG - Intronic
1172555763 20:35839777-35839799 GTGTATTCCTCACAGAGGACTGG - Intronic
1172752023 20:37257877-37257899 GACCAACCCTCTCAGAGGGCAGG + Intronic
1174420500 20:50396307-50396329 CTCCGGCCCTAAGAGAGGACAGG + Intergenic
1175048411 20:56129013-56129035 GTTCAGACCTCATAGAGGAGTGG - Intergenic
1175915884 20:62425571-62425593 GGCCCGGCCTCCCAGAGGACAGG - Intronic
1175931254 20:62494854-62494876 GAACAGCACTCACAGGGGACAGG - Intergenic
1176102592 20:63371341-63371363 GTCCAGGCCTCCCTGAGAACGGG - Intronic
1177930846 21:27281380-27281402 TTCCAGCCTTCTCAGAGGACAGG + Intergenic
1180297867 22:10961143-10961165 ATCCAGCCCTGACAGGGGCCAGG + Intergenic
1180410551 22:12602645-12602667 GTCCAGCCCGGACAGGGGCCAGG - Intergenic
1180779641 22:18512968-18512990 TTCCAGTCTGCACAGAGGACAGG + Intergenic
1180860181 22:19074508-19074530 GGCAAGACCTCACAGAGCACAGG + Intronic
1181040217 22:20188511-20188533 GCCCAGGCCTCACAGAGAGCAGG + Intergenic
1183343577 22:37294989-37295011 GTCCAGCCCTGACCGATCACTGG + Intronic
1184103450 22:42353827-42353849 GTCCAGAGCTCAGAGAGGCCAGG + Intergenic
1184128409 22:42502980-42503002 GTCCAGCCATCACCAAGGTCTGG + Intergenic
1184137201 22:42556295-42556317 GTCCAGCCATCACCAAGGTCTGG + Intronic
1184240589 22:43209559-43209581 GTCCAGGGCTCACAGAGGGGTGG + Intronic
1184566151 22:45293321-45293343 GTCCAGCCCTCCCAGCAGGCAGG - Intronic
1185302632 22:50090383-50090405 GGAGAGACCTCACAGAGGACGGG - Intronic
950224194 3:11220373-11220395 GTACTGTTCTCACAGAGGACAGG - Intronic
954696707 3:52431291-52431313 TGCCAGCCCACAAAGAGGACAGG + Intergenic
955348802 3:58179579-58179601 GTCCAGCGCTCCCTGAGGCCGGG + Intergenic
958432618 3:94060200-94060222 GTTCTGCCCACACACAGGACAGG + Exonic
962271334 3:133980007-133980029 CTTCAGCCCTCACAGGGCACAGG - Intronic
962700295 3:137991879-137991901 TTCCAGGACTCAAAGAGGACTGG - Intergenic
963687242 3:148452004-148452026 GTACAACACTCATAGAGGACTGG - Intergenic
964075171 3:152684390-152684412 GTCCAGCTCTCAGAGAAGAGGGG + Intergenic
964554556 3:157921968-157921990 CTCCAGCCCTCACACTGGATGGG + Intergenic
964879091 3:161403836-161403858 TTTCAGACATCACAGAGGACCGG - Intergenic
968286644 3:197512943-197512965 GGACAGCCCTGAAAGAGGACAGG + Intronic
968671117 4:1852121-1852143 GTGCAGACCTCACAGGGTACGGG + Intronic
968944017 4:3654242-3654264 GTCCACCCCTCCCAGTGGCCTGG - Intergenic
969082152 4:4627160-4627182 GTCCAGCCCTCACTGAGCACAGG - Intergenic
969235504 4:5862587-5862609 AACCAGCTCTAACAGAGGACAGG + Intronic
969406582 4:6997160-6997182 GACCATCCCTGATAGAGGACCGG + Intronic
969650723 4:8466380-8466402 GTCCAGCCCCCACAGAGACCCGG - Intronic
974152953 4:58033076-58033098 GTCCAGCCCACAAACAGGAGTGG - Intergenic
978768787 4:112432242-112432264 GTGCAGTCCTCGCTGAGGACAGG - Exonic
985102614 4:186473707-186473729 GTCCCGGCCTCCCAGAGGGCTGG - Intronic
985437169 4:189941189-189941211 GTCCAGCCCGGACAGGGGCCAGG - Intronic
985661860 5:1161371-1161393 GAGCAGCATTCACAGAGGACAGG - Intergenic
985721202 5:1490178-1490200 ACCCAGTCTTCACAGAGGACAGG + Intronic
985912671 5:2896037-2896059 TTCCAGCCTTCACTGAGGCCAGG - Intergenic
991468444 5:66940693-66940715 TTCCAACTCTCACAGATGACTGG - Intronic
992606378 5:78461094-78461116 GATCAGCCCTCACAAAGTACTGG + Intronic
992834668 5:80628336-80628358 GTTCCGCCCACACACAGGACAGG + Exonic
994667399 5:102722481-102722503 GTCCAGCCCTCCCAAATGGCTGG - Intergenic
995387197 5:111601157-111601179 GTCTAGGGCTCACAGAGGAGAGG + Intergenic
1002081096 5:176737910-176737932 ATCCAAGCCTCACAGAGGACAGG + Intergenic
1002447853 5:179301028-179301050 GTCCAGGCTTCACTGAGGCCAGG - Intronic
1003037767 6:2659970-2659992 GCCCATCCCTTCCAGAGGACTGG - Intergenic
1005997153 6:30938492-30938514 TTCCAGCCCTCACGGAGCCCAGG + Intergenic
1006828704 6:36955883-36955905 GTTCAGCCCTCAGGGAGGGCAGG - Intronic
1007229534 6:40338628-40338650 GTCCAGACCTGACTCAGGACGGG + Intergenic
1008440935 6:51531238-51531260 GTCCAGCCCTCAAAGAAACCAGG + Intergenic
1009281522 6:61757894-61757916 GTCCAGCATTCGCACAGGACTGG - Intronic
1012960739 6:105619245-105619267 GCCCAGACCTCAAAGAGGGCAGG + Intergenic
1017804150 6:157928707-157928729 GTCCACTCCTCACAGTGCACTGG + Intronic
1017815023 6:158010382-158010404 CTCCAGCACTCCCAGAGGCCTGG - Intronic
1021257966 7:18417734-18417756 GACCAGCACTCACACAGGCCAGG - Intronic
1023851983 7:44155611-44155633 GTCCAGCCCTCACACCTGCCTGG + Intronic
1024612565 7:51080120-51080142 GTCAAGACCTTACAGAGGTCAGG + Intronic
1024629616 7:51236372-51236394 ATGAAGGCCTCACAGAGGACAGG + Intronic
1024776195 7:52789279-52789301 GACCAGCCCTTACAGAGGGAAGG - Intergenic
1029737326 7:102472104-102472126 GTGCAGCCTTCACACAGGGCAGG + Intronic
1032267472 7:130379606-130379628 GTGCAGTCCTCACAGGGGTCTGG + Intergenic
1032712481 7:134472794-134472816 CTCCACCCCTCCCAGAGAACTGG - Intergenic
1033224097 7:139547189-139547211 GTTCAGCCCACAAAGGGGACAGG - Intergenic
1037573601 8:20179885-20179907 GTCCAGCTCTCACACAGACCTGG + Intronic
1037683641 8:21119302-21119324 GTCCATCACTCACAGAGCAGTGG + Intergenic
1040530876 8:48265488-48265510 TGCCAGCCCTCACAGACAACAGG + Intergenic
1041539176 8:58963694-58963716 GCCCAGCCCTCACTAAGGAGAGG - Intronic
1042519029 8:69690519-69690541 GACCAGCCCTCCCAGTTGACTGG - Intronic
1044599641 8:93991071-93991093 AGCCAGCCCTCACTGAGGATGGG + Intergenic
1045347278 8:101304525-101304547 GTCCAGCCGTCACAGAAGGCAGG - Intergenic
1047803383 8:128333026-128333048 GTCCTGCCCTCTAAGAGAACAGG - Intergenic
1049197333 8:141322984-141323006 GACCTCCCCTCACAGAGGCCCGG + Intergenic
1049670575 8:143867827-143867849 CTCCATACTTCACAGAGGACAGG - Exonic
1049749476 8:144276509-144276531 GTCCAGCCCTCACAGAGGACAGG - Intronic
1050173882 9:2850457-2850479 GTCTACCCCTCACACAGCACAGG + Intergenic
1050325260 9:4491544-4491566 ATCCACCCCTCACAGATCACTGG + Intronic
1053431879 9:38047460-38047482 GGCCATTCCTCACACAGGACAGG - Intronic
1058991648 9:110259291-110259313 GTCCAGCCTCCACATGGGACTGG + Intergenic
1059446545 9:114341804-114341826 GTCCAGCTCTCATAGGGGAAGGG - Intronic
1060524945 9:124315219-124315241 GGGCAGGCCTCACAGAGGGCAGG + Intronic
1060996377 9:127876745-127876767 GAGGAGGCCTCACAGAGGACAGG + Intronic
1061242259 9:129381567-129381589 GTGCATGCCTCACACAGGACTGG - Intergenic
1061265891 9:129504897-129504919 GTCTTGCCCTCACAGAGCTCGGG - Intergenic
1062178711 9:135179188-135179210 GTCCTGGCCACACAGAGGTCAGG + Intergenic
1062623389 9:137432698-137432720 GTCGAGCCCACACAGAGGCCGGG + Intronic
1203449509 Un_GL000219v1:99275-99297 GTCCAGCCCGGACAGGGGCCAGG + Intergenic
1186203888 X:7181548-7181570 GTCCAGGTCTCACAGTGAACTGG + Intergenic
1187205161 X:17174986-17175008 CTCCAGCCTTCACAGTGAACTGG - Intergenic
1187391020 X:18886768-18886790 CTCCAGTCATCCCAGAGGACAGG + Intergenic
1192169386 X:68844790-68844812 GACCAGCCCCCACCCAGGACAGG + Intergenic
1192410618 X:70929754-70929776 GCCCAGCCAACACAGAAGACAGG + Exonic
1193485975 X:82085987-82086009 GTCTAGCCATCACATGGGACAGG - Intergenic
1198565074 X:137895891-137895913 CTCCACCCTTCACAGAGGATGGG - Intergenic
1200803684 Y:7410546-7410568 CTCCATCACCCACAGAGGACAGG - Intergenic
1201576805 Y:15469738-15469760 GTCCAGGTCTCACAGTGAACTGG + Intergenic
1202377137 Y:24247547-24247569 GTCCAGCCCTGACAGCCAACAGG - Intergenic
1202493643 Y:25422574-25422596 GTCCAGCCCTGACAGCCAACAGG + Intergenic