ID: 1049749477

View in Genome Browser
Species Human (GRCh38)
Location 8:144276514-144276536
Sequence CTGCAGTCCAGCCCTCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 275}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049749477_1049749488 11 Left 1049749477 8:144276514-144276536 CCTCTGTGAGGGCTGGACTGCAG 0: 1
1: 0
2: 1
3: 19
4: 275
Right 1049749488 8:144276548-144276570 CTCTGTCCCTGGGCTGACACGGG No data
1049749477_1049749487 10 Left 1049749477 8:144276514-144276536 CCTCTGTGAGGGCTGGACTGCAG 0: 1
1: 0
2: 1
3: 19
4: 275
Right 1049749487 8:144276547-144276569 CCTCTGTCCCTGGGCTGACACGG No data
1049749477_1049749483 1 Left 1049749477 8:144276514-144276536 CCTCTGTGAGGGCTGGACTGCAG 0: 1
1: 0
2: 1
3: 19
4: 275
Right 1049749483 8:144276538-144276560 CTCCCGGGGCCTCTGTCCCTGGG No data
1049749477_1049749492 28 Left 1049749477 8:144276514-144276536 CCTCTGTGAGGGCTGGACTGCAG 0: 1
1: 0
2: 1
3: 19
4: 275
Right 1049749492 8:144276565-144276587 CACGGGTGTCAGGCTAGACACGG No data
1049749477_1049749491 18 Left 1049749477 8:144276514-144276536 CCTCTGTGAGGGCTGGACTGCAG 0: 1
1: 0
2: 1
3: 19
4: 275
Right 1049749491 8:144276555-144276577 CCTGGGCTGACACGGGTGTCAGG No data
1049749477_1049749482 0 Left 1049749477 8:144276514-144276536 CCTCTGTGAGGGCTGGACTGCAG 0: 1
1: 0
2: 1
3: 19
4: 275
Right 1049749482 8:144276537-144276559 CCTCCCGGGGCCTCTGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049749477 Original CRISPR CTGCAGTCCAGCCCTCACAG AGG (reversed) Intronic
900179804 1:1306103-1306125 CTCCAGTCCATGCCCCACAGGGG + Intronic
900283564 1:1888453-1888475 CTGCAGTCCAGCCTTCCCCCAGG + Intronic
900587456 1:3440065-3440087 CTCCTGTCCACCCCTCCCAGTGG + Intergenic
901019272 1:6247793-6247815 CTGCAATCCAGCCCTGGCCGCGG - Exonic
902663283 1:17920331-17920353 CTGCAATGCAGACCTCTCAGGGG - Intergenic
903451872 1:23459131-23459153 CTGCACTCCAGCCTGCACAATGG + Intronic
904314490 1:29651496-29651518 CTGCAGCCCAGGCCCCACACAGG + Intergenic
904384679 1:30133484-30133506 CTGCAGCCCAGGCCCCACACAGG - Intergenic
904829258 1:33296197-33296219 GTGCAGGCCAGCGCCCACAGTGG - Intronic
904865789 1:33577873-33577895 CTGGAGCCCAGCCCTCACTAAGG - Intronic
905015050 1:34772182-34772204 CTGTAGTCCAGCTCTCAGGGGGG - Intronic
905095236 1:35464707-35464729 CTTCATAGCAGCCCTCACAGGGG + Intronic
907550472 1:55300723-55300745 CTTCAGTCCAGTCCTGACACAGG - Intergenic
908383726 1:63620531-63620553 ATTCAGGCCAGCCCTCACATGGG + Intronic
908776671 1:67647332-67647354 AGGCTGTCCAGGCCTCACAGTGG - Intergenic
909732484 1:78912063-78912085 CTAGAGTCCATCACTCACAGAGG + Intronic
909820093 1:80051011-80051033 CTTCAGGCCTGCACTCACAGCGG - Intergenic
911058692 1:93729563-93729585 CTGCAGTGCAGTTGTCACAGAGG + Intronic
911969229 1:104408568-104408590 CCACAGTGCAGCCCACACAGAGG + Intergenic
912461339 1:109833895-109833917 CTGCACTCCAGCCCTCGTAATGG - Intergenic
913354004 1:117898117-117898139 CTACTGTCCAGCACTCAAAGTGG + Intronic
915240686 1:154519521-154519543 CTGAAGTGAAGCCATCACAGTGG + Intronic
915526544 1:156479711-156479733 CTGCAGTTCAGCAATCCCAGCGG - Exonic
917282987 1:173396906-173396928 CTGTAGGCCACACCTCACAGTGG + Intergenic
917789727 1:178491886-178491908 CTGCAGCCCAGCTCTCACTCTGG - Intergenic
918880937 1:190119874-190119896 CTGCAGGCTACTCCTCACAGGGG + Intronic
922931803 1:229395956-229395978 CTGCAGTCCCACCTTCTCAGAGG + Intergenic
1065528100 10:26642962-26642984 CGGCAGCCCCGCCCCCACAGCGG - Intergenic
1065920820 10:30391421-30391443 TTTCAGTCCAGCCCTCCCGGGGG + Intergenic
1066406755 10:35126529-35126551 CTGCAGCCCAGCCTGGACAGAGG + Intergenic
1067285215 10:44902969-44902991 GCACAGCCCAGCCCTCACAGAGG + Intergenic
1067430104 10:46237166-46237188 CCACAGTCCCGGCCTCACAGAGG + Intergenic
1067443540 10:46326677-46326699 CCACAGTCCAGGCCTCACAGAGG - Intronic
1067704806 10:48598764-48598786 CTGCATTGCAGCCACCACAGGGG + Intronic
1070346931 10:75553432-75553454 CAGCAGTCTAGCCCTCAAAGAGG - Intronic
1070906993 10:80081629-80081651 CTGCACTCCAGCCCCAGCAGCGG + Intronic
1071088609 10:81893810-81893832 CTGCGGTGAAGCCCTCAGAGAGG - Intronic
1071524162 10:86348529-86348551 CTGCAGGCCAGCAGCCACAGGGG + Intronic
1071928730 10:90441075-90441097 CTGCACTGCAGCCCTGACACTGG - Intergenic
1072143923 10:92616239-92616261 CTGCACTCCAGCCAACAGAGAGG - Intronic
1073613045 10:104963645-104963667 CTGCAGGCCAGCCCTCTCCCCGG + Intronic
1074195019 10:111176073-111176095 CAGCTGTCCAGCCTTCCCAGAGG + Intergenic
1074693620 10:116028734-116028756 CTGCAGTACTGGCCTCACAGGGG + Intergenic
1076524806 10:131105664-131105686 CTGGAGTCCAGCCCTAGCATGGG - Intronic
1076790511 10:132774753-132774775 CTGCCGTGCAGCCTACACAGGGG + Intronic
1077243629 11:1525073-1525095 CTCCCGCCCCGCCCTCACAGAGG + Intergenic
1077409321 11:2396090-2396112 CAGCAGAGCAGCCCTGACAGGGG - Intronic
1081706384 11:45184217-45184239 CTGGAGTGCAGCACACACAGGGG + Intronic
1081872849 11:46391274-46391296 CTGTACTCCAGCCCTCCCACTGG - Intergenic
1083198436 11:61104864-61104886 CAGCATTCCTGCCTTCACAGAGG + Intronic
1084464172 11:69312647-69312669 CTGAGTTCCAGCCCTCATAGAGG - Intronic
1084522092 11:69669741-69669763 CTGCAGACCAGCGCGCACCGGGG - Intronic
1084890764 11:72235855-72235877 CCGCAAGCCAGCCTTCACAGAGG + Exonic
1084944720 11:72632456-72632478 CTGCAGTCAGCCCCTCATAGAGG - Intronic
1085054120 11:73394203-73394225 CTGCAGTCAGACCCTCACTGTGG - Intronic
1087989386 11:104729576-104729598 CTGCAGTCCAGTTCCCATAGAGG + Intergenic
1089554097 11:119305523-119305545 CTGCAGAGCGGCCCTCACACAGG - Exonic
1089620650 11:119720350-119720372 CTGCTGGCAGGCCCTCACAGGGG + Intronic
1091225122 11:133952363-133952385 CTGCAGTCTAGGCAGCACAGAGG - Intronic
1092975949 12:13745179-13745201 CTGTGGTCCAGCCCTCACTCAGG + Intronic
1093091591 12:14927527-14927549 TTGGAGTCCAGGCCTCACAAGGG - Intronic
1097035536 12:56121253-56121275 CTGCACTCCACCCCTCGCGGTGG - Exonic
1097676010 12:62603175-62603197 CCGCAGCCCAGCCCCCACCGGGG + Exonic
1098001329 12:65947009-65947031 CTGCAGTCTAGCCCTTAGAATGG - Intronic
1102471485 12:113162188-113162210 CTGCAGTCCAGGTCTCAAAAGGG + Intronic
1104254698 12:127125738-127125760 ATGCAGCCCAGGACTCACAGTGG - Intergenic
1104889306 12:132132653-132132675 CTGCAGTCCAGCCCTCCCCACGG - Intergenic
1106046458 13:26146437-26146459 CTGTAGGCCAGACCTTACAGTGG - Intronic
1113608642 13:111627838-111627860 CCTCAGTCCTGCCGTCACAGGGG - Intronic
1113708807 13:112450977-112450999 CTACAGTTCAGTTCTCACAGAGG - Intergenic
1113743168 13:112724957-112724979 CCACAGCCCAGCCCACACAGGGG - Intronic
1113926746 13:113945998-113946020 CTGCACTCCAGCCCACAGTGCGG - Intergenic
1115105772 14:29760390-29760412 CTGCACTCCAGCCTGCACAACGG - Intronic
1115428116 14:33284906-33284928 CTGCAGTCCTGCACTCACAGAGG + Intronic
1117001810 14:51377799-51377821 CTACAGTGCAGCCTTCACTGTGG + Intergenic
1117725355 14:58667817-58667839 CTGCCTGCCCGCCCTCACAGAGG - Intergenic
1118729508 14:68656548-68656570 CTGCTCTGCACCCCTCACAGAGG - Intronic
1120194801 14:81469707-81469729 CTGCAGTCGAGTCTTCACAGTGG - Intergenic
1122127450 14:99586928-99586950 CGGCACTCCCGCGCTCACAGAGG + Intronic
1122348407 14:101074239-101074261 CTGCAGCCCAGACCTCACCCTGG + Intergenic
1122671960 14:103379446-103379468 CTGCAGACCAGCCCCCAGGGTGG - Intergenic
1122837161 14:104435981-104436003 CTGCAGTCCATCCCACAAATCGG + Intergenic
1124393242 15:29278514-29278536 TTGGAGCCCAGGCCTCACAGGGG - Intronic
1124596526 15:31096225-31096247 CTGCACTCCTTCCCTCCCAGAGG - Intronic
1124703128 15:31934862-31934884 CTGCAGGCCGGACCTTACAGTGG + Intergenic
1127069667 15:55276531-55276553 CTGCACTCCAGCCCGGGCAGCGG + Intronic
1127145193 15:56016164-56016186 CTGCAGTGCTGCCATCTCAGTGG - Intergenic
1127325026 15:57886478-57886500 CTGGAACTCAGCCCTCACAGGGG - Intergenic
1127892534 15:63268085-63268107 CTGCACTCCAGCCTGCACAATGG + Intergenic
1128049058 15:64646595-64646617 CTGCACTCCAGCCTGCACAATGG + Intronic
1128146366 15:65334454-65334476 CTGCAGTCCTCCCCTCACCCTGG - Intronic
1129977100 15:79831514-79831536 CTCTTCTCCAGCCCTCACAGGGG - Intergenic
1130484016 15:84387464-84387486 CTGCATTCCACTCCTCCCAGGGG - Intergenic
1130574514 15:85079874-85079896 CTGCACTCCAGCCTGCACAGTGG + Intronic
1132392889 15:101451516-101451538 CTGCAGTCCATTCATCACTGAGG - Intronic
1134205304 16:12232769-12232791 CTCCTTTCCAGCCCTCTCAGGGG - Intronic
1135020819 16:18961681-18961703 CTCCAGTTCTGCCCACACAGTGG + Intergenic
1135061951 16:19278621-19278643 CTGTAGGCCAGACCTTACAGTGG - Intergenic
1135468444 16:22707645-22707667 CTGCAGACCCTCTCTCACAGTGG - Intergenic
1136617648 16:31408477-31408499 CTTCAGCACAGCCCTCACAATGG + Exonic
1137029556 16:35508847-35508869 CTGAAGCCCAGACCTCACCGTGG - Intergenic
1137409361 16:48214666-48214688 CTGCTGTCCAGCCCGCCCACAGG + Intronic
1138331379 16:56218570-56218592 TTGCTGTCAAGCTCTCACAGGGG - Intronic
1138482854 16:57315516-57315538 CTGCCTTCCAGCCCAAACAGGGG + Intergenic
1139214865 16:65117877-65117899 CTGCAGCCCAGCCCCCACCCCGG + Intronic
1139968917 16:70761671-70761693 CTGTACTCCAGCTCTCTCAGAGG + Intronic
1141591877 16:85074634-85074656 CTGAAGGCCAGACCTCAGAGGGG - Intronic
1142175952 16:88645488-88645510 CTGCAGGCCACCTCTCACTGCGG - Intronic
1142401290 16:89860092-89860114 CTGCAGTCCACACCTCACACTGG - Intronic
1143380053 17:6490418-6490440 CTGGAGGCTAGCACTCACAGAGG - Intronic
1144394419 17:14829722-14829744 CTGCAGTCCAGCTCTGAAAAAGG + Intergenic
1145064569 17:19753271-19753293 CTGCAGACCAGCCCACACCCCGG + Intergenic
1145084322 17:19923561-19923583 CTGCACTCCAGCCTGCGCAGTGG - Intronic
1146406870 17:32546210-32546232 CTACTGTTCAGCCCTCAAAGTGG - Intronic
1148088470 17:45008574-45008596 CTGCACTCCAGCCTTGACAAGGG - Intergenic
1148111185 17:45145295-45145317 CTGCAGTCCAGCCTTATCACAGG - Intergenic
1151396687 17:73827476-73827498 CTGATGTCCAGCCCTGACACTGG - Intergenic
1152417659 17:80173133-80173155 CTGCAATCCAGCACTTTCAGAGG - Exonic
1154493026 18:14935507-14935529 CTGCAGGCCACCACTGACAGGGG + Intergenic
1156476833 18:37410809-37410831 CAGCAGCCCAGCCCTGGCAGGGG - Intronic
1157085112 18:44572693-44572715 CTATAGTCCAGCCATCACAGTGG - Intergenic
1157434290 18:47655246-47655268 CTGAGGTCCAGGCCCCACAGTGG - Intergenic
1157576686 18:48748427-48748449 CTTCACTCCAGCCCTGAGAGTGG + Intronic
1159016979 18:63109256-63109278 CTGCAGGCCAGAATTCACAGAGG + Intergenic
1159030466 18:63225701-63225723 CTGCACTCCACCCCTCACGGAGG + Intronic
1160191905 18:76721820-76721842 CTGGAGTCCTGCCATCACAGAGG + Intergenic
1160985621 19:1837296-1837318 CTCCCCTCCAACCCTCACAGTGG + Intronic
1161271574 19:3392625-3392647 CTGCAGCCCAGCCATAACGGGGG - Intronic
1161561987 19:4978468-4978490 CTGCACTCCAGCCTGCACAATGG + Intronic
1161687002 19:5707874-5707896 CTGCAGTGCAGCCCCCAAACGGG + Intronic
1161993540 19:7698760-7698782 CAGCAGCCCAGCCCACAGAGCGG + Exonic
1163131963 19:15279813-15279835 CTGAAGTCCTGGCCTCCCAGCGG + Intronic
1163666423 19:18606083-18606105 CTGCAGCCCCGCCCTCCCCGTGG + Intronic
1165138803 19:33687164-33687186 GTGCAGTGCTGTCCTCACAGAGG + Intronic
1165401207 19:35601668-35601690 CTGCACTCCAGCCTGGACAGAGG - Intergenic
1165592858 19:36986126-36986148 CTACAAGCCAGCCCTCACACAGG - Intronic
1165711068 19:38011437-38011459 CTTCACTCCAGCCCGAACAGTGG + Intronic
1166808432 19:45500539-45500561 TTGCAGTCCAGCCCTCCCCCAGG - Exonic
926568161 2:14500990-14501012 CTGCACTCCAGCCTGCACAATGG - Intergenic
928282826 2:29964028-29964050 CATCAGTCCAGCCCTCCTAGTGG + Intergenic
930182686 2:48379757-48379779 CTGCACTCCAGCCTACACAACGG + Intergenic
930310350 2:49732161-49732183 CTTCTGTACTGCCCTCACAGAGG + Intergenic
932894976 2:75630787-75630809 CTGCACTCCAGCCTCCACAGAGG + Intergenic
933841266 2:86288057-86288079 CTGCACTCCAGCCTGCACAATGG - Intronic
934122294 2:88852160-88852182 CTGCAGCCCTTCCCTCACTGAGG - Intergenic
936149889 2:110010335-110010357 CTGGAGTTCAGGCCTCCCAGAGG + Intergenic
936194788 2:110361034-110361056 CTGGAGTTCAGGCCTCCCAGAGG - Intergenic
936591914 2:113812464-113812486 CTGCACTCCAGCCTGGACAGAGG + Intergenic
938166119 2:129028439-129028461 CTGCAAGCCAGTCCTGACAGAGG - Intergenic
938271641 2:129977466-129977488 CTGCACTCCAGCCCCAGCAGTGG - Intergenic
938413641 2:131086558-131086580 CTGCAGTCCAGCCTAGACAATGG + Intronic
938854795 2:135298552-135298574 CTGCAGTCCAGCTCTCAGGAAGG - Intronic
939781314 2:146451924-146451946 CTACTGTCCAGCAGTCACAGTGG - Intergenic
942091000 2:172491260-172491282 TTGCTGTCCAGCCCCCGCAGCGG - Exonic
942210056 2:173660950-173660972 TTGGAGTCCACCCCTCTCAGTGG - Intergenic
942806415 2:179936305-179936327 GTTCAGTACAGCTCTCACAGGGG + Intergenic
943037023 2:182759813-182759835 GTGCAGCTCAGGCCTCACAGTGG + Intronic
946227275 2:218270616-218270638 CTGCAGTCCTGCCCTCCCCGGGG - Intronic
946339072 2:219056969-219056991 CTGCAGGTCAGCCCTCCCTGGGG - Intronic
946983702 2:225248078-225248100 ATGCAGCCCAGCCCTCACCTTGG + Intergenic
946991712 2:225338418-225338440 CTGTAGACCAGACCTTACAGTGG + Intergenic
949043650 2:241860511-241860533 CTCCCCTCCAGCCCACACAGTGG - Intergenic
1170646783 20:18203635-18203657 CTGCAGTCCAGCCTGGACAATGG - Intergenic
1171429635 20:25073726-25073748 CTGAAGTTCAGACATCACAGTGG - Intronic
1171542909 20:25978215-25978237 CTTCATCCCAGGCCTCACAGGGG - Intergenic
1171776502 20:29373142-29373164 CTGAACCCCGGCCCTCACAGAGG - Intergenic
1173502700 20:43565597-43565619 CTGCAGCCCAGGCCCCACAGTGG + Intronic
1174176723 20:48650121-48650143 CAGAAGTCCAGGCCACACAGCGG + Exonic
1175836430 20:61998689-61998711 GTCCAGTCCAGCGCACACAGGGG + Intronic
1177834305 21:26171890-26171912 CTGCAGTGCAGCCCTCAGAAGGG - Intergenic
1178366916 21:31995999-31996021 CCGCTGTGTAGCCCTCACAGGGG + Intronic
1179274694 21:39881549-39881571 CTGCAGTTCTGACATCACAGCGG + Intronic
1179777009 21:43671302-43671324 CAGCAGGGCAGACCTCACAGAGG - Intronic
1179988934 21:44935854-44935876 CTCCTCTCCAGGCCTCACAGAGG - Exonic
1180582864 22:16858050-16858072 CTGGAGTACAGGCCTCCCAGAGG - Intergenic
1182122817 22:27798265-27798287 CGGCAGTCCACGCCGCACAGCGG - Exonic
1183687658 22:39370652-39370674 CTGCACTCCAGCCGACAGAGCGG - Intronic
1184128408 22:42502975-42502997 CTGGAGTCCAGCCATCACCAAGG + Intergenic
1184137200 22:42556290-42556312 CTGGAGTCCAGCCATCACCAAGG + Intronic
1184240586 22:43209554-43209576 CAGGAGTCCAGGGCTCACAGAGG + Intronic
1184340076 22:43881187-43881209 CTGCAGGCCAGACCACACACAGG + Intronic
1185091875 22:48780180-48780202 GTGCAGTTCAGCCCCAACAGTGG + Intronic
1185368908 22:50450079-50450101 CTGCAGGGCAGCCCACAGAGGGG + Intronic
949493391 3:4610074-4610096 TTGCATTCCAGCCAGCACAGTGG - Intronic
949751110 3:7353706-7353728 CTGCATTCCAGACCTTACGGTGG + Intronic
950206684 3:11086166-11086188 CTGCAGGCCAGCCATCCCATAGG - Intergenic
950586875 3:13898773-13898795 CTGAAATCCAGCCTTCACAGAGG + Intergenic
950611961 3:14132640-14132662 CTGCTGTCCAGCCACCACTGTGG - Intronic
950807970 3:15624767-15624789 CTGCACTCCAGCAGTGACAGAGG - Intronic
950892017 3:16412636-16412658 GTGCAATCCAGCCCTTTCAGTGG + Intronic
953420520 3:42750195-42750217 CTGCAGCCCAGAGCTCACACGGG - Intronic
954538906 3:51381086-51381108 CTGCCGTCCAGACCTGACTGGGG - Exonic
960056480 3:113279657-113279679 CTGCAGCTCAGCTCTGACAGTGG + Intronic
960605693 3:119502593-119502615 CTGCACTCCAGCCTGCACTGAGG - Intronic
962600890 3:136990127-136990149 TGGGAGGCCAGCCCTCACAGAGG + Intronic
962967016 3:140364830-140364852 CTGTTGTCCAGTCCTTACAGTGG + Intronic
964317751 3:155462229-155462251 CTGGAGTGCAGCACTCACTGAGG + Intronic
964351165 3:155805424-155805446 CTGCACTCCAGGCGTGACAGAGG + Intronic
965275460 3:166676985-166677007 CTGCTGTACTGCCCTAACAGAGG + Intergenic
965921679 3:173924499-173924521 CTGTAGTCCAGCACTTTCAGAGG + Intronic
968051664 3:195658573-195658595 CCGCAGGACAACCCTCACAGAGG - Intergenic
968071823 3:195788933-195788955 CTGCAGTGGAGGCCTCAGAGAGG + Exonic
968302453 3:197627350-197627372 CCGCAGGACAACCCTCACAGAGG + Intergenic
968664036 4:1810959-1810981 CTGCAGTCCAGCCCACAGGCAGG - Intergenic
969576805 4:8040788-8040810 CTGCATCCCAGCCCTCCCAGGGG - Intronic
969624876 4:8297353-8297375 CTGCTTTCCCGCCCGCACAGTGG + Intronic
970227793 4:13878022-13878044 CCACAGCCCAGCCCTCACACTGG - Intergenic
977155428 4:93566973-93566995 CTGCTGACCACCCCTTACAGTGG - Intronic
979595950 4:122534032-122534054 CTGTAGGCCAGACCTCACAGCGG - Intergenic
980692376 4:136311876-136311898 CTACAGGTCAGACCTCACAGTGG + Intergenic
982207921 4:153011066-153011088 CTGCCCTCCAGACCTCAGAGTGG - Intergenic
984512987 4:180701602-180701624 CTGGGGTCCACCCCTCACAGTGG + Intergenic
985472615 5:54906-54928 CCGCAGTCCAGCCTTCCCTGGGG - Intergenic
985865120 5:2508661-2508683 CTGCCGTCCAGCAGTCACTGAGG - Intergenic
989677353 5:43987121-43987143 CTGTAGGCCAGACCACACAGTGG - Intergenic
991090346 5:62688449-62688471 CTGCACTCCAGCCCTCAGCCTGG - Intergenic
994898821 5:105744290-105744312 CTGGAGTCCAGCCATCCCTGAGG - Intergenic
996034693 5:118745505-118745527 CTTCAGACCAGCCCCAACAGAGG + Intergenic
996349993 5:122528835-122528857 CTGCACTCCAGCCCAAACAATGG + Intergenic
997440463 5:133905514-133905536 CTGGAGTCCAGCCCTAACCCAGG + Intergenic
997676885 5:135719803-135719825 CTGCAGTCCAGCCCTGGAGGTGG + Intergenic
1001246491 5:170108831-170108853 CTGCAGAGCAGCACTAACAGTGG + Exonic
1001620631 5:173081945-173081967 ATGCAGTCCATCTGTCACAGAGG - Intronic
1001692729 5:173644818-173644840 CTGCACTCCTGCCTTCAAAGAGG - Intergenic
1002399414 5:178983268-178983290 ATCCATTCCAGCCCTGACAGAGG + Intronic
1002607411 5:180391355-180391377 CCACCATCCAGCCCTCACAGGGG - Intergenic
1004817699 6:19330628-19330650 TTGAAGTCCAGTCATCACAGAGG - Intergenic
1006133280 6:31881254-31881276 CAGCATTCCAGCCTTGACAGAGG + Intronic
1007424838 6:41740228-41740250 CTGCAGTCCAGCCCCATCATGGG - Intronic
1008885608 6:56429497-56429519 CTGCAGATCAGCCCTCAGAGCGG + Intergenic
1013299891 6:108795069-108795091 CTGCATTCCAGCCCTGGCAATGG + Intergenic
1013301402 6:108808392-108808414 CTGCAAGCCAGCCCTGAGAGTGG - Intergenic
1014470468 6:121808117-121808139 CTGCACTCCAGCCAACAGAGTGG + Intergenic
1014969098 6:127792027-127792049 CTGGAGCCCTGCCCTCCCAGGGG - Intronic
1015157814 6:130116713-130116735 CTGCACTCCAGCCTGGACAGTGG + Intronic
1016464925 6:144315700-144315722 CTGAAATCCAGCCAGCACAGCGG - Intronic
1017148321 6:151255045-151255067 TTTCAGTCCAGCCCTCCTAGCGG - Intronic
1018824505 6:167398970-167398992 CTGAGATCCAGCCATCACAGTGG + Intergenic
1018955283 6:168405710-168405732 CTACACACCAGACCTCACAGTGG + Intergenic
1019640680 7:2101907-2101929 GTGCAGTCCAGTGCACACAGGGG + Intronic
1019687138 7:2388248-2388270 CTGCAGCCCAGCACCCACACTGG - Intergenic
1020022856 7:4879324-4879346 CTGCCCTCCTGCCCCCACAGAGG - Intronic
1020247916 7:6444563-6444585 CTGCACTCCAGCCTGCGCAGCGG + Intronic
1020960403 7:14795570-14795592 CTGTAGGCCAGACCTCAGAGTGG + Intronic
1021262970 7:18481749-18481771 CTTCAGTTCACCCCTCACTGTGG + Intronic
1023026814 7:36058317-36058339 CTGCTGTCCCTCCCTCACTGTGG + Intergenic
1023125463 7:36950391-36950413 CTGCAGTTCACTCTTCACAGTGG + Intronic
1023896140 7:44434454-44434476 CTGCTGCCCAGCTCTCACTGAGG + Intronic
1024326984 7:48116492-48116514 CTGGTGACCAGCCCACACAGGGG - Intergenic
1024776197 7:52789284-52789306 GTGCTGACCAGCCCTTACAGAGG - Intergenic
1025919304 7:65895930-65895952 CTGCACTCCAGCCTGGACAGAGG - Intronic
1026381702 7:69806501-69806523 CTGCACTCCAGCCTGGACAGTGG - Intronic
1026749011 7:73034996-73035018 CTGCACTCCAGCCTGGACAGCGG + Intergenic
1026752659 7:73063141-73063163 CTGCACTCCAGCCTGGACAGCGG + Intergenic
1026756310 7:73091272-73091294 CTGCACTCCAGCCTGGACAGCGG + Intergenic
1026871522 7:73855735-73855757 CTGCAGTCCTGCACCCTCAGGGG + Intergenic
1027091095 7:75302151-75302173 CTGCACTCCAGCCTGGACAGCGG - Intergenic
1027094740 7:75330124-75330146 CTGCACTCCAGCCTGGACAGCGG - Intergenic
1028527025 7:91797872-91797894 CTGCATTCCAGCTGTCTCAGTGG - Intronic
1030232391 7:107222094-107222116 TAGCAGCCCAGCCCACACAGAGG + Intronic
1031474692 7:122207222-122207244 CTGCATTCCAGATCTAACAGTGG - Intergenic
1031495728 7:122445776-122445798 CTGCACTCCAGCCCTGAGACAGG + Intronic
1032509806 7:132463774-132463796 CTGCAAGCCACCCCTCACAAGGG + Intronic
1032688468 7:134259073-134259095 TTGCAGTCCAGTCTTCACTGTGG + Intronic
1032899351 7:136289439-136289461 CTGCAGGCAAGCTATCACAGTGG - Intergenic
1034053653 7:148011756-148011778 CCACAGGCCTGCCCTCACAGAGG - Intronic
1034053998 7:148015388-148015410 CTGCAGTGAAGGCCGCACAGTGG + Intronic
1034475707 7:151280323-151280345 CCCCAGTCCTGTCCTCACAGAGG - Intergenic
1035278075 7:157759885-157759907 CACAAGTCCAGCACTCACAGAGG + Intronic
1035781202 8:2229468-2229490 CTCCAGTCCAGCCCCTGCAGCGG + Intergenic
1036400974 8:8408085-8408107 CTGCACTCCAGCCTGGACAGTGG - Intergenic
1037761486 8:21744668-21744690 ATTCATTCCAGCCCCCACAGTGG - Intronic
1038455287 8:27668800-27668822 CTGCATTCCAGCCACAACAGAGG + Intronic
1040547055 8:48406934-48406956 CTGGAGTCCAGCATTCCCAGAGG + Intergenic
1041240805 8:55847711-55847733 CTGCACTCCAGCCTGGACAGAGG - Intergenic
1041376340 8:57211695-57211717 CTGCACTCCTGCGCTCAAAGAGG - Intergenic
1047205027 8:122796132-122796154 CTGCACTCCAGCCTGCACAATGG + Intronic
1049749477 8:144276514-144276536 CTGCAGTCCAGCCCTCACAGAGG - Intronic
1052012809 9:23431134-23431156 CTGCAGACAAGCCATCTCAGAGG - Intergenic
1052869675 9:33491834-33491856 TTGCATTCAAGACCTCACAGAGG + Intergenic
1055308637 9:74955214-74955236 CTGCAGCCCTGACCTCTCAGGGG + Intergenic
1059950757 9:119460325-119460347 CTATAGACCAGCCTTCACAGGGG - Intergenic
1060181281 9:121536059-121536081 CTGCACTCCAGCCTTGACAACGG + Intergenic
1060915699 9:127388753-127388775 CTCCTGGCCAGCCCTCCCAGTGG + Intronic
1061441269 9:130605490-130605512 CTGCACCCAAGCCCTCAGAGTGG - Intronic
1061959097 9:133979019-133979041 CTGCAGACCTGCTCTCACACTGG - Intronic
1062704016 9:137924847-137924869 CAGCAACCCTGCCCTCACAGGGG + Intronic
1187698689 X:21944645-21944667 CTGCACTCCAGCCTGGACAGTGG + Intronic
1189315826 X:40055856-40055878 CTGCACTCCAGCCTGGACAGTGG - Intronic
1190366078 X:49695876-49695898 CCGCAGGCCAGTCCTCCCAGGGG - Exonic
1190382400 X:49852299-49852321 CTACAGCCCAGCCCTCACCATGG - Intergenic
1190913891 X:54795661-54795683 CTCCAGTCCTGCCCTCACCCTGG + Intronic
1191192428 X:57680643-57680665 CTGCACTCCAGCCTGGACAGCGG - Intergenic
1200228642 X:154433023-154433045 CTGCAGGCCAGCTCTCTCTGTGG - Intronic
1202374061 Y:24217832-24217854 CTGCATTCCACTCCTCCCAGGGG + Intergenic
1202496720 Y:25452288-25452310 CTGCATTCCACTCCTCCCAGGGG - Intergenic