ID: 1049749481

View in Genome Browser
Species Human (GRCh38)
Location 8:144276537-144276559
Sequence CCAGGGACAGAGGCCCCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 660
Summary {0: 1, 1: 0, 2: 5, 3: 75, 4: 579}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049749481_1049749496 25 Left 1049749481 8:144276537-144276559 CCTCCCGGGGCCTCTGTCCCTGG 0: 1
1: 0
2: 5
3: 75
4: 579
Right 1049749496 8:144276585-144276607 CGGAAGCCACTGGGGCAGTCAGG No data
1049749481_1049749495 17 Left 1049749481 8:144276537-144276559 CCTCCCGGGGCCTCTGTCCCTGG 0: 1
1: 0
2: 5
3: 75
4: 579
Right 1049749495 8:144276577-144276599 GCTAGACACGGAAGCCACTGGGG No data
1049749481_1049749492 5 Left 1049749481 8:144276537-144276559 CCTCCCGGGGCCTCTGTCCCTGG 0: 1
1: 0
2: 5
3: 75
4: 579
Right 1049749492 8:144276565-144276587 CACGGGTGTCAGGCTAGACACGG No data
1049749481_1049749491 -5 Left 1049749481 8:144276537-144276559 CCTCCCGGGGCCTCTGTCCCTGG 0: 1
1: 0
2: 5
3: 75
4: 579
Right 1049749491 8:144276555-144276577 CCTGGGCTGACACGGGTGTCAGG No data
1049749481_1049749494 16 Left 1049749481 8:144276537-144276559 CCTCCCGGGGCCTCTGTCCCTGG 0: 1
1: 0
2: 5
3: 75
4: 579
Right 1049749494 8:144276576-144276598 GGCTAGACACGGAAGCCACTGGG No data
1049749481_1049749493 15 Left 1049749481 8:144276537-144276559 CCTCCCGGGGCCTCTGTCCCTGG 0: 1
1: 0
2: 5
3: 75
4: 579
Right 1049749493 8:144276575-144276597 AGGCTAGACACGGAAGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049749481 Original CRISPR CCAGGGACAGAGGCCCCGGG AGG (reversed) Intronic
900079387 1:844204-844226 CCAAGGAGAGAGGCCTCAGGAGG + Intergenic
900186373 1:1335019-1335041 CCAGGGACAGAGCCCAGGTGGGG + Exonic
900290933 1:1923309-1923331 CACGGGACAGGGGCACCGGGAGG + Intronic
900334234 1:2153577-2153599 CGAGGAACAGAGGCCCCAAGAGG + Intronic
900373103 1:2341019-2341041 CCAGGGCCAGAGGGGCCGGGTGG - Intronic
900398179 1:2461869-2461891 CCAGATGCAGAGGCCCTGGGGGG - Intronic
900429040 1:2593367-2593389 CCTGGGACAGGGGCCCCAGCTGG - Intronic
900479651 1:2891852-2891874 GCAGGGGCAGAGGCCCTGGCTGG - Intergenic
900495366 1:2973703-2973725 CCAGGCACAGAGGGCCAGGCGGG + Intergenic
900532067 1:3159399-3159421 CCAAGGAGAGAGGCCTTGGGAGG - Intronic
900596995 1:3484463-3484485 CCAGCGACAGAGCCCACAGGTGG - Intergenic
900605433 1:3521614-3521636 CCGGGGACGGAGTCCCCTGGGGG - Intronic
900617236 1:3570919-3570941 CCAGGGACAGGGCCCCAGGGAGG + Intronic
900773672 1:4565517-4565539 CCAAGGAGAGAGGCCTCAGGAGG - Intergenic
900798891 1:4725752-4725774 CCAAGGAGAGAGGCCTTGGGAGG - Intronic
900800527 1:4734398-4734420 GCAGAGGCAGAGGCCCCGAGAGG + Intronic
901182205 1:7349603-7349625 CCAAGGACAGAGGCCTCAGGAGG - Intronic
901461185 1:9392766-9392788 GAAGGGACAGAGGCCCCAGGAGG - Intergenic
901496984 1:9627882-9627904 CAGGGAACAGAGGCCGCGGGTGG + Intergenic
901768766 1:11519971-11519993 CCAGGGTCAGAGGCCTGGGCTGG + Intronic
902431617 1:16367563-16367585 TCAGGAAAGGAGGCCCCGGGTGG - Intronic
902535607 1:17118002-17118024 CCAGGGACAGAGGCATGGAGTGG + Intronic
903173407 1:21567221-21567243 CCAGGGGCAGTGGCCCGGGCTGG + Intronic
903764890 1:25727776-25727798 CCAGGGCCAGGGGCCCAGGATGG - Intronic
903780917 1:25819747-25819769 CCGGGGACACAGACCCCGCGGGG + Intronic
903807147 1:26013498-26013520 CCAGAGGGAGAGGCCCTGGGTGG + Intergenic
904442939 1:30543487-30543509 GCAGGGACAGAGGCTACGGATGG + Intergenic
904602750 1:31682941-31682963 CCAGAGACACTGGCCCCAGGAGG + Exonic
905798360 1:40828135-40828157 CCAGTGAGAGTGGCCCTGGGAGG + Intronic
907279794 1:53339995-53340017 CCTGGCACAGGGGCCCTGGGTGG - Intergenic
907400541 1:54222340-54222362 GCAGGAACAAAGGCCCTGGGGGG + Intronic
908355501 1:63322713-63322735 CCAGGGCCAGAGGCCGAGGAAGG + Intergenic
910538788 1:88331062-88331084 CCAGGGAGAGAGGCCCTTAGAGG + Intergenic
915224406 1:154401978-154402000 CCAGGGCCAGAGGCCAGGGAGGG + Intergenic
915573598 1:156760297-156760319 CTGGGGACAGAGGCCTGGGGAGG + Intronic
917007097 1:170426980-170427002 CCTGGGACAGAGCACCTGGGGGG + Intergenic
917534256 1:175863198-175863220 CCAGGGACAAAGGGCGGGGGTGG - Intergenic
917737922 1:177937255-177937277 GCAGTGACAGAGGCCACTGGAGG - Exonic
917768537 1:178250187-178250209 CCTGGGACAGAGCACCCTGGGGG - Intronic
917961943 1:180152752-180152774 ACAGGGACTGAGTCCCGGGGAGG + Intergenic
918341685 1:183573075-183573097 CCAGGGACAGAGCCACAAGGAGG + Intronic
920398155 1:205661163-205661185 CCAAGGAAAGGGGCCCCTGGAGG + Intronic
922253382 1:223870778-223870800 CCTGGGACAGAGCACCTGGGGGG - Intergenic
922314741 1:224433624-224433646 CGAGGGACGGAGGCTCCAGGGGG - Intronic
922881633 1:228985557-228985579 CCAAGGAGAGAGGCCTCAGGAGG - Intergenic
923027825 1:230219893-230219915 CCAGGCACAGAGGCTCTGGTTGG - Intronic
1062796828 10:351125-351147 GCAGGGAGAGAGGCCCAGAGGGG + Intronic
1062801511 10:384764-384786 CCATGCACACAGGCCCCTGGAGG + Intronic
1062892351 10:1073721-1073743 CCACAGACAGAGGCCTCAGGAGG - Intronic
1062894036 10:1089368-1089390 CCAGGCCCAGAGGCCCCAGAGGG - Intronic
1062903047 10:1160029-1160051 CCAGGGACACTGGGCCCAGGGGG - Intergenic
1063016102 10:2079327-2079349 CCATGGAGAGAGGCCTCAGGAGG - Intergenic
1063042545 10:2358257-2358279 GCATGGAGAGAGGCCCCAGGAGG - Intergenic
1063232618 10:4080662-4080684 CCAAGGAGAGAGGCCTCAGGAGG - Intergenic
1063250380 10:4267297-4267319 CCAGGCGCAGAGGCCCAGGGAGG + Intergenic
1063618210 10:7620782-7620804 CCAGGGAGAGAGTTTCCGGGAGG + Intronic
1065818843 10:29506820-29506842 GAAGGGACAGAGGCCCTAGGAGG + Intronic
1065818851 10:29506843-29506865 GAAGGGACAGAGGCCCTAGGAGG + Intronic
1068811226 10:61257656-61257678 CCTGGGACAGAGTGCCCAGGAGG - Intergenic
1070145871 10:73772906-73772928 CCATGGGCGGAGGCACCGGGCGG - Exonic
1074537681 10:114340410-114340432 CCAGGGAGAGAGGCCTCAGAAGG + Intronic
1075064767 10:119281992-119282014 CAAGGGACAGATGCCCAGGAGGG - Intronic
1075132862 10:119755296-119755318 CCTAGGACAGAGGCTTCGGGAGG - Intronic
1075446168 10:122514776-122514798 CAATGCACAGAGACCCCGGGTGG + Exonic
1075654365 10:124151645-124151667 GCTGGGACAGAGGCTCAGGGAGG + Intergenic
1075963388 10:126588201-126588223 CCTGGGACAGAGTCCCCAGGGGG + Intronic
1076411020 10:130250846-130250868 CTAGGCCCAGAGGCCCCGGCTGG + Intergenic
1076642861 10:131930750-131930772 CCAGGCTCAGAGGCCCCGCATGG - Intronic
1076740414 10:132480151-132480173 CCAAGGCCAGTGGCCCAGGGCGG + Intergenic
1076756091 10:132572489-132572511 CCAGGGAAAGCAGCCCCGGGCGG - Intronic
1076800853 10:132827386-132827408 CCAAGGACAGAGGGCCCTGCAGG - Intronic
1076805637 10:132857247-132857269 CATGGGACAGAGCCCCAGGGAGG - Intronic
1076843244 10:133056876-133056898 CCAGCCACAGGGGACCCGGGGGG + Intergenic
1076851431 10:133095327-133095349 CCCTGGACAGAGGCCCCTGAGGG - Intronic
1077124130 11:925079-925101 CCAGTGACAGCGGCCGGGGGCGG - Intronic
1077222981 11:1425588-1425610 CCTGGGCCAGGGGCCACGGGAGG + Intronic
1077322464 11:1948393-1948415 TGAGGGTCAGAGGACCCGGGTGG + Intronic
1077417661 11:2432385-2432407 CCAGGGATAGAGGCCCCGTGGGG - Intergenic
1077482249 11:2821256-2821278 CCAGGTGCAGAGGCCCCGCGTGG + Intronic
1077492308 11:2867274-2867296 CCAAGGAGAGAGGCCTCAGGAGG + Intergenic
1078464173 11:11538395-11538417 CTGGGGACAGACACCCCGGGTGG - Intronic
1079106647 11:17576360-17576382 CCAGGGATAGAGGTCACGGCTGG - Intronic
1081046421 11:38278862-38278884 CCAGGGCCAGTGGCGCCGGCCGG + Intergenic
1081582374 11:44360965-44360987 CCACAGGCAGAGGCCCTGGGAGG + Intergenic
1081674901 11:44963117-44963139 CCCAGGACAGAGGCCCTGTGAGG + Intergenic
1082650577 11:55787036-55787058 CCAGGAACAGAGGAACCTGGAGG - Intergenic
1083236898 11:61356873-61356895 CCAGGCATTGAGGCCTCGGGCGG - Intronic
1083638896 11:64134919-64134941 CCTGGGACCGAGGACCCTGGAGG - Intronic
1084404707 11:68964638-68964660 CCAAGGAGAGAGGCCTCAGGAGG - Intergenic
1084409662 11:68999323-68999345 CCAAGGAGAGAGGCCTCAGGAGG + Intergenic
1084444208 11:69194054-69194076 CCAGGCCCTGAAGCCCCGGGTGG + Intergenic
1084472984 11:69374107-69374129 CCAGAGAGAGAGGCCTCAGGAGG + Intergenic
1084477570 11:69397649-69397671 CCACGGAGAGAGGCCTCAGGAGG + Intergenic
1084518373 11:69648408-69648430 TCCGGGACGGAGGCCCCAGGCGG + Intronic
1084573923 11:69976642-69976664 CCAAGGAGAGAGGCCTCAGGAGG + Intergenic
1084662263 11:70552945-70552967 CCAAGGAGAGAGGCCTCAGGAGG - Intronic
1084766284 11:71310972-71310994 CCAAGGAGAGAGGCCTCAGGAGG + Intergenic
1084768211 11:71325946-71325968 CCAGGAAGAGAGGCCTCAGGAGG + Intergenic
1084779554 11:71399434-71399456 CCGAGGACAGAGGCCTTGGGAGG - Intergenic
1084783675 11:71429180-71429202 GCAGTGCCAGAGGCCCAGGGAGG + Intronic
1085410603 11:76288277-76288299 CAAGGGAAACAGGCCCCGGAGGG - Intergenic
1086839476 11:91667258-91667280 CTTGGGACAGAGGTCCCAGGGGG + Intergenic
1089502417 11:118940368-118940390 TGAGGTAGAGAGGCCCCGGGGGG + Intronic
1090561626 11:127938764-127938786 GCAGGGGCAGAGGGCCTGGGGGG - Intergenic
1090744348 11:129694513-129694535 AGAGGGAGAGAGGCCCAGGGAGG + Intergenic
1091280762 11:134380330-134380352 CCAGGGACAGGGAGCCAGGGAGG + Intronic
1202805482 11_KI270721v1_random:3706-3728 TGAGGGTCAGAGGACCCGGGTGG + Intergenic
1091693548 12:2612767-2612789 CCATCTACAGAGGCCCAGGGTGG - Intronic
1091712187 12:2749957-2749979 CCTGGGACAGAGCACCTGGGGGG - Intergenic
1092047266 12:5440712-5440734 CCAGGAAAAGAGGCCCACGGAGG - Intronic
1092251843 12:6903553-6903575 CCAAGGACACAGGCCAGGGGTGG + Intronic
1094493733 12:30976853-30976875 CCAGGGTCAGATGCCCCTTGCGG - Intronic
1095950483 12:47779209-47779231 CCAGGGAAAGAGGGCATGGGAGG + Intronic
1097357762 12:58621098-58621120 CCAGGGACCCAGACCCAGGGTGG + Intronic
1097517005 12:60618305-60618327 CCTGGGACAGAGTACCTGGGGGG + Intergenic
1097654382 12:62343026-62343048 CCTGGGACAGAGACACTGGGGGG - Intronic
1099238879 12:80115658-80115680 CCTGGGACAGAGCACCTGGGGGG - Intergenic
1100411386 12:94322829-94322851 CCTGGGACAGAGTTCCCAGGGGG - Intronic
1101331738 12:103762650-103762672 CCTGGCACAGAGGCTCAGGGTGG - Intronic
1102029426 12:109731448-109731470 GCAGGGGCAGAGGCTCCGAGAGG - Intronic
1103202208 12:119096994-119097016 GCAGGAACAGAGCCGCCGGGAGG + Intronic
1103568097 12:121827131-121827153 GCTGGGGCAGAGGCCCAGGGAGG + Intronic
1103617717 12:122165309-122165331 CCAGGGACGGAGGCCAGGGAAGG + Intergenic
1103968392 12:124654583-124654605 CCAGAGGCAGTGGCCCCTGGTGG - Intergenic
1104761358 12:131299100-131299122 CCGGGGAGGGAGGCCCAGGGCGG + Intergenic
1104811153 12:131621122-131621144 CCAGGGACAGTGCCCCAGTGAGG - Intergenic
1104818417 12:131661692-131661714 CCGGGGAGGGAGGCCCAGGGCGG - Intergenic
1105544997 13:21344753-21344775 CCTGGGCCAGAGGCCCCTGGAGG - Intergenic
1109823928 13:67692606-67692628 GCAGGTCCAGAGGCCCAGGGGGG - Intergenic
1112297629 13:98202191-98202213 CCCGGGACAGAGGCACAAGGTGG + Intronic
1112849456 13:103686588-103686610 CCAAGGAGAGAGGCCCCAGAAGG + Intergenic
1113565596 13:111317865-111317887 GCAGGCGCAGAGGCCCGGGGAGG - Intronic
1113681646 13:112248642-112248664 CCAGGGACAGGGGCTCCGCCAGG + Intergenic
1113804016 13:113103159-113103181 CCAGAGACAGAGAACCCGGGAGG - Intergenic
1113820621 13:113209795-113209817 CGAGGGCCAGGCGCCCCGGGCGG + Intronic
1113900921 13:113797472-113797494 CCACGGACAGAGGCTCCTGCTGG - Intronic
1114063423 14:19039253-19039275 CCACAGATAGAGGACCCGGGTGG - Intergenic
1114098833 14:19360743-19360765 CCACAGATAGAGGACCCGGGTGG + Intergenic
1114133513 14:19820539-19820561 CCTGGGACAGAGCACCTGGGGGG - Intronic
1114621294 14:24097996-24098018 CCAGGGGCAGAGACCCCCAGAGG + Intronic
1118716922 14:68566658-68566680 CCAGTCACTGAGGCACCGGGGGG - Intronic
1118733549 14:68686114-68686136 CCTGGGACACAGGCCCCGCCAGG - Intronic
1118748173 14:68789075-68789097 CCATGGGCAGAGGCTCCGGGAGG + Exonic
1118925741 14:70188634-70188656 CCAGGGCGAGGGGCCCCGGGAGG + Exonic
1119132779 14:72190181-72190203 CTAGGGAGAGAGGCTCAGGGAGG - Intronic
1119425431 14:74531824-74531846 CCAGGGTGAGAGGCCCAGGCTGG - Intronic
1119645615 14:76346406-76346428 CCAGGGATGGGTGCCCCGGGTGG - Intronic
1121492288 14:94369191-94369213 TCAAGGGCAGAGGCCCCTGGGGG + Intergenic
1121605413 14:95236617-95236639 CCAGGGGCAGAGGCCATTGGGGG + Intronic
1122005670 14:98701562-98701584 CAGGGGACAGAGGCCACGGGAGG - Intergenic
1122114328 14:99520312-99520334 CCAGGGCCAGAGGCCCTTGCTGG - Intronic
1122275979 14:100591008-100591030 ACAGGGGCAGAGGCCCAGGGAGG - Intergenic
1122652631 14:103233817-103233839 CCTGGGTCACAGGCCCCTGGGGG - Intergenic
1123054263 14:105561766-105561788 GCAGGGACAGAGGCTTGGGGAGG - Intergenic
1123078847 14:105682185-105682207 GCAGGGACAGAGGCTTGGGGAGG - Intergenic
1123576585 15:21676108-21676130 CCTGGGACAGAGCACCTGGGGGG - Intergenic
1123613207 15:22118576-22118598 CCTGGGACAGAGCACCTGGGGGG - Intergenic
1125113549 15:36062383-36062405 CAAGGGACAGCGGCCCGGGAAGG + Intergenic
1126879889 15:53083176-53083198 GCAGAGACAGAGGACCAGGGTGG - Intergenic
1128133988 15:65249345-65249367 CCAGGGACAGTGGCCCAGTGGGG + Intronic
1129118696 15:73381590-73381612 TCAGGGAGAGAGACCCCGTGGGG - Intergenic
1129185828 15:73905882-73905904 CCTGGGACAGAGGCCAGGGAAGG - Intergenic
1129462468 15:75706505-75706527 CCGGGGACAGAGGCCAGGTGAGG + Intronic
1129722396 15:77884909-77884931 CCAGGGACAGAGGCCAGCTGAGG - Intergenic
1129933433 15:79431110-79431132 CCAGGGACAGAGCCCTCTCGGGG - Intergenic
1130086375 15:80780807-80780829 CCAGGGCCACAGACCCCGAGTGG - Intronic
1130257572 15:82332875-82332897 ACAGGAACTGAGGCCCCTGGGGG + Intergenic
1130257581 15:82332905-82332927 CCAAGGACAGATGGCCCAGGAGG + Intergenic
1130352869 15:83107335-83107357 GCAGGGACAGGTGCCCCTGGCGG - Intergenic
1130597370 15:85257089-85257111 ACAGGAACTGAGGCCCCTGGGGG - Intergenic
1131094479 15:89646933-89646955 CGAGGCACAAAGGACCCGGGAGG + Exonic
1131171950 15:90185024-90185046 CCAGGAAGAGCGGCCCCGCGGGG + Intronic
1131455420 15:92579372-92579394 CCAAGGACAGGGGCCCTGGATGG + Intergenic
1132326348 15:100973515-100973537 CCGGGGACAGCGGCCCGCGGGGG - Intronic
1202985453 15_KI270727v1_random:410353-410375 CCTGGGACAGAGCACCTGGGGGG - Intergenic
1132515012 16:362191-362213 CCAGGGAGCAAGGCCTCGGGAGG - Intergenic
1132552842 16:560464-560486 CGAGGGACCGCGGACCCGGGAGG + Exonic
1132677799 16:1127792-1127814 CCTGGGACAGATGCCCCTGAGGG + Intergenic
1132747532 16:1443223-1443245 CTAGGGGCACAGGCCCAGGGCGG - Intronic
1132933890 16:2471579-2471601 CGAGGAACAGGGCCCCCGGGCGG - Exonic
1132943285 16:2519056-2519078 CCAGGGCAAGAGGACCCAGGAGG - Intronic
1133020356 16:2964324-2964346 CTAGGGGCAGAGGCCCTGGGAGG + Exonic
1133277629 16:4648263-4648285 CCACGGGAAGAGTCCCCGGGAGG - Intronic
1133277665 16:4648371-4648393 CCACGGGAAGAGTCCCCGGGAGG - Intronic
1133277680 16:4648407-4648429 CCACGGGAAGAGCCCCCGGGAGG - Intronic
1133277704 16:4648479-4648501 CCACGGGAAGAGCCCCCGGGAGG - Intronic
1133277734 16:4648550-4648572 CCACGGGAAGAGCCCCCGGGAGG - Intronic
1133277774 16:4648656-4648678 CCACGGGAAGAGTCCCCGGGAGG - Intronic
1133277789 16:4648692-4648714 CCACGGGAAGAGCCCCCGGGAGG - Intronic
1134188203 16:12100662-12100684 GCCAGGACAGAGGCCCTGGGTGG + Intronic
1134222060 16:12362630-12362652 CTAGGAACAAAGGCCCTGGGTGG - Intronic
1134692903 16:16202676-16202698 CCAAGGACAGAGGCCTCAGATGG + Intronic
1134880315 16:17740346-17740368 CCAGGGACAAAGCCCTCTGGGGG + Intergenic
1134978944 16:18592019-18592041 CCAAGGACAGAGGCCTCAGATGG - Intergenic
1135470216 16:22723201-22723223 CCAGCGCCACCGGCCCCGGGTGG - Intergenic
1135765914 16:25177935-25177957 CCAGGAGCAGAGGCCCCTAGAGG - Intronic
1135770823 16:25217162-25217184 AAAGGGACAGAGGACACGGGTGG - Intronic
1135994135 16:27235712-27235734 ACAGGGACAGAGGCCTCTCGCGG - Intronic
1136067821 16:27770661-27770683 CCAGGGAGAGGGGCCCCGTCAGG + Intronic
1136275122 16:29175410-29175432 CCCGGGAAAGAGGCCCTGGGAGG + Intergenic
1136275143 16:29175475-29175497 CCTGGGAAAGAGGTCCTGGGAGG + Intergenic
1136414860 16:30096615-30096637 CCGGGGGCTGAGGCCCAGGGAGG + Intronic
1136497090 16:30651317-30651339 GCAGGGACAAAGGCCTCGGGAGG + Exonic
1136666752 16:31819447-31819469 CCAGCCAGCGAGGCCCCGGGGGG + Intergenic
1139492070 16:67291549-67291571 GCAGAGACAGTGGCCCCTGGGGG - Intronic
1139597794 16:67968372-67968394 CCCGGGATGGCGGCCCCGGGTGG + Intronic
1139630157 16:68226423-68226445 CCAGGGACTCAGGACTCGGGAGG - Exonic
1139953128 16:70681450-70681472 CCAGGGGCAGAGGCACAGTGTGG + Intronic
1140315945 16:73896952-73896974 CCAGGCACAGTGGCTCAGGGAGG + Intergenic
1140580294 16:76223547-76223569 CTGGGGAGAGAGGCCCTGGGAGG - Intergenic
1140658190 16:77162096-77162118 CCAGGGACAGTGTCCCCTGTAGG + Intergenic
1140766639 16:78165556-78165578 GCAGGTGCAGAGGCCCTGGGAGG + Intronic
1141519113 16:84565983-84566005 TTAGGGAGAGAGGCCCAGGGTGG - Exonic
1141663188 16:85452729-85452751 CCTGGGAGAGAGACCCCTGGTGG + Intergenic
1141754535 16:85982561-85982583 CCAGGGGCGGAGGACCCCGGTGG + Intergenic
1141909150 16:87046747-87046769 CCAGGGAGGGAAGCCTCGGGAGG - Intergenic
1141948377 16:87325181-87325203 GCAGGGTCTGAGCCCCCGGGGGG + Intronic
1142079444 16:88141348-88141370 CCCGGGAAAGACGCCCTGGGAGG + Intergenic
1142079465 16:88141413-88141435 CCTGGGAAAGAGGCCCTGGGAGG + Intergenic
1142079485 16:88141478-88141500 CCTGGGAAAGAGGTCCTGGGAGG + Intergenic
1142079504 16:88141543-88141565 CCTGGGAAAGAGGTCCTGGGAGG + Intergenic
1142141366 16:88474221-88474243 CCAGGGGCAGTGGCCCGGGCGGG - Intronic
1142147699 16:88499451-88499473 CCGGGTACAGAGGCCTGGGGTGG + Intronic
1142200102 16:88757106-88757128 CCAGGGACCGAGGGCCAGTGCGG - Intronic
1142213763 16:88821076-88821098 ACAGAGACAGACGCCCCCGGGGG - Intronic
1142253195 16:89002188-89002210 GGAGGGACAGAGGAACCGGGGGG + Intergenic
1142253211 16:89002239-89002261 GGAGGGACAGAGGAGCCGGGGGG + Intergenic
1142253249 16:89002347-89002369 GGAGGGACAGAGGAGCCGGGGGG + Intergenic
1142277852 16:89132413-89132435 CCAGGAACAGATGGCACGGGAGG - Intronic
1203142534 16_KI270728v1_random:1777733-1777755 CCCAGGAGAGAGGCCCCAGGAGG + Intergenic
1142639973 17:1280139-1280161 CCAGATCCAGAGGCCCCGAGAGG - Exonic
1143099752 17:4498735-4498757 CCGGGGACTGGGGGCCCGGGCGG - Intergenic
1143106825 17:4534331-4534353 CCAGGGACACAAGCCCCTGCTGG - Intronic
1143246073 17:5486587-5486609 CCAGGGACAGACGGCGCGGTTGG - Exonic
1143585777 17:7849478-7849500 CCAGGGACAGAGGCTGACGGGGG - Exonic
1144595815 17:16569270-16569292 CCAGGGCCAGAGGCGCGGGAGGG - Intergenic
1144628076 17:16855397-16855419 TTAGGGAGAGAGGCCCAGGGTGG + Intergenic
1144764440 17:17725023-17725045 CCAGGGTCAGCAGCCCCAGGAGG - Intronic
1145159668 17:20565981-20566003 TTAGGGAGAGAGGCCCAGGGTGG + Intergenic
1145263789 17:21369750-21369772 TCACAGACAGAGGCCCCGAGAGG + Intergenic
1145743324 17:27294270-27294292 CCAGGGACAGAGGAGACGGGCGG - Exonic
1146403024 17:32515186-32515208 TCAGGGACAGAGGCCTTGAGAGG - Intronic
1146503389 17:33383656-33383678 CCAAGAGCAGAGGCCCAGGGTGG - Intronic
1146671601 17:34741770-34741792 ACAGGCACAGAGGCCATGGGAGG + Intergenic
1147156699 17:38547772-38547794 CCTGGGGCTGAGCCCCCGGGGGG + Intronic
1147310376 17:39592511-39592533 CCACGGACAGAGACACCAGGTGG - Intergenic
1147421096 17:40322562-40322584 CAGGGGACAGAGGCTCCGGGGGG - Intronic
1147614936 17:41822151-41822173 GGAGGGGCAGGGGCCCCGGGTGG - Intronic
1148209333 17:45798776-45798798 CCAGGGAGAAAGGCCGGGGGCGG + Intronic
1148440670 17:47710299-47710321 CCAGGGACAGGGTCCCCAGGAGG - Intronic
1148463554 17:47851368-47851390 CCAGGGAGAGGGGCCCGGGTGGG + Intronic
1149660456 17:58331843-58331865 CCAGGGCCTGAGGCCCTGGGGGG - Intergenic
1149660501 17:58331988-58332010 CTGGGGACTGAGGCCCTGGGGGG - Intergenic
1150382247 17:64729998-64730020 CCTGGGAAAGAGGCCACAGGTGG + Intergenic
1150774022 17:68064836-68064858 CCTGGGAAAGAGGCCACAGGTGG - Intergenic
1151577062 17:74958228-74958250 GGAGGGACAGAGGCACCGTGGGG + Intronic
1151728662 17:75898467-75898489 CCAGGGCCAGAGGACCCCGATGG - Intergenic
1151765288 17:76130624-76130646 AGAGGGGCAGGGGCCCCGGGAGG - Intergenic
1152253677 17:79225229-79225251 CCAGCGAGAGATGCCCAGGGAGG - Intronic
1152360535 17:79831305-79831327 CAACGGGCAGAGGCCACGGGTGG - Intergenic
1152433678 17:80262754-80262776 CGAGGGACGGAGGCACTGGGTGG - Intronic
1152630378 17:81408322-81408344 CCAGGCGCAGAGGCCTGGGGTGG - Intronic
1152644935 17:81464410-81464432 CAGGGGGCAGAGGCCACGGGAGG + Exonic
1152694958 17:81739423-81739445 CCAGGGAGAAAGGCCTCAGGAGG - Intergenic
1152757286 17:82092322-82092344 CGGGGGACAGAGGCTCCTGGTGG + Intronic
1152925471 17:83085668-83085690 CCAGGGAGAGAGGCCCCGCTCGG - Intronic
1154394551 18:13975046-13975068 CCAAGGAGAGAGGCCTCAGGAGG + Intergenic
1155091471 18:22515397-22515419 CCTGGGACAGAGGTCCCTGGGGG - Intergenic
1155117486 18:22783903-22783925 CCTGGGACAGAGCCCCAGGGAGG - Intergenic
1156459632 18:37314526-37314548 CCAGATACAGAGGCCAAGGGAGG + Intronic
1157422781 18:47560273-47560295 GGAGGGACAGAGCCCCTGGGTGG + Intergenic
1159770513 18:72542254-72542276 CCGGGGACGAAGGCCCCCGGAGG - Exonic
1159940156 18:74400621-74400643 CCAAGGTCAGAGGCCCCTGCTGG - Intergenic
1160397151 18:78580838-78580860 CCCAGGAGAGAGGCCTCGGGAGG + Intergenic
1160518508 18:79491200-79491222 CCAGCGACTGAGCCCCAGGGTGG - Intronic
1160856717 19:1221117-1221139 CCAGGGACAGAGGCGTCCCGTGG - Intronic
1160892437 19:1386343-1386365 CCAAGGACAGAGGCCTCAGCAGG - Intronic
1160938404 19:1608765-1608787 CCACGGACAGAGCTCTCGGGGGG - Intergenic
1160969131 19:1759674-1759696 CCAGGGACAGAGCCCAGGGAAGG - Intronic
1161302334 19:3548671-3548693 CCAGGCACAGAGTCCCCCGGGGG + Intronic
1161319225 19:3633335-3633357 GCAGGGACTGAGGCCCGGGGCGG - Intronic
1161436887 19:4268842-4268864 CCTGGGGCTGAGGCCCCTGGTGG - Exonic
1161461418 19:4400101-4400123 GCGGGGACAGAGCCCCTGGGAGG - Intronic
1161573052 19:5040846-5040868 CAGGGGACAGAGGCCCTGGGAGG - Intronic
1161799779 19:6411056-6411078 CCAGGGAGAGTGACCCTGGGTGG + Intergenic
1162031987 19:7921497-7921519 TCAGGGACCAAGGCGCCGGGAGG + Exonic
1162463925 19:10829782-10829804 GCAGGGACTGAGGCCCAGGAGGG + Intronic
1162498291 19:11035616-11035638 CCAGGTTCAGAGGCCCTTGGGGG - Intronic
1162548539 19:11345628-11345650 CCTGGGAAGGAGGCACCGGGTGG + Exonic
1162796077 19:13088354-13088376 CCTGGGCCAGGGGCCCCGGCTGG - Intronic
1163111155 19:15161473-15161495 CCAGGGAGGAAGGCCCCTGGAGG + Exonic
1163362065 19:16853008-16853030 CGATGGACAGAGGCCACCGGTGG + Intronic
1163547743 19:17949672-17949694 CCAGGGCCAGGGACCCCTGGGGG - Intergenic
1164742972 19:30590348-30590370 CTAGGAAGAGAGGCCCCAGGAGG - Intronic
1164826695 19:31289525-31289547 CCAGGGGCTGGGGCCCGGGGAGG - Intronic
1165394482 19:35556947-35556969 TCAGGGACGGTGGCCCGGGGTGG + Exonic
1166390461 19:42406423-42406445 GCAGGGGCAGAGGCCTGGGGAGG + Intronic
1166725659 19:45025682-45025704 GCAGGGACAGATGCGCCGGATGG + Exonic
1166788338 19:45382773-45382795 CCAGGAACAGGGGCCACGTGGGG + Intronic
1167103575 19:47418496-47418518 CCAGGGAGACAGGCTCCGTGGGG + Intronic
1168105976 19:54165897-54165919 GGAGGGACAGAGGCCCCAGAGGG + Intronic
1168686719 19:58353375-58353397 CCAGGGACCCAGACCCCAGGAGG + Intronic
925055042 2:850835-850857 CCAAGGAGAGAGGCCTCAGGAGG - Intergenic
925303062 2:2830616-2830638 CCAGGGACAGAGACCCTGCCTGG + Intergenic
925898370 2:8490338-8490360 CCTGGGACAGAGGCCCATGCAGG + Intergenic
925900347 2:8504780-8504802 CCAGGGAGAGAGGCCTTGGGAGG - Intergenic
926358987 2:12067491-12067513 CCAGGACAAGAGGCCCCAGGAGG - Intergenic
926709888 2:15870723-15870745 CCAGGGAGAGAGCACCCAGGGGG + Intergenic
927111252 2:19865024-19865046 CCAGGGACAGAGGACAGGGAGGG + Intergenic
927201382 2:20580082-20580104 CCAGGGACACAGCCCCAAGGGGG + Intronic
927507516 2:23624074-23624096 CCAGGGAGAATGGCCCCTGGAGG + Intronic
927866115 2:26588690-26588712 CCAGGGACTGACGCCACGGCAGG - Intronic
928095786 2:28404260-28404282 CCAGGGACAGAGGCCAGGCCCGG - Exonic
929777789 2:44939311-44939333 CCGGGGACCCAGGCGCCGGGCGG - Intergenic
930585952 2:53267575-53267597 CCCGGGACAGAGTTCCCAGGGGG + Intergenic
930976078 2:57463297-57463319 CCAGGGACTGGGGGCTCGGGGGG - Intergenic
931094370 2:58922548-58922570 TCAGGGACTGAGTCCCAGGGAGG - Intergenic
932748572 2:74356137-74356159 CCAGGGACAGAGGTCCTCAGAGG - Intronic
933613336 2:84459304-84459326 CCAGGGGCAGAGGCCGGAGGAGG + Exonic
934767434 2:96887822-96887844 CTAGGGAGAGAGGCCCCGAAGGG + Intronic
935529735 2:104217917-104217939 CCAGGGACACAGGTCCCAAGAGG - Intergenic
935664075 2:105494888-105494910 CCGTGGGCACAGGCCCCGGGTGG + Intergenic
936432319 2:112475185-112475207 CCTGGGACATGGGCCCAGGGAGG - Intergenic
937134965 2:119544519-119544541 CCAGGGACCTGGGGCCCGGGTGG + Intronic
937225301 2:120365413-120365435 CAAGGCACAGAGGCACAGGGGGG - Intergenic
937933028 2:127220121-127220143 CCGAGGACAAAGGCGCCGGGCGG - Intergenic
938258841 2:129881043-129881065 CAAGGAACAGAGGCTCAGGGTGG - Intergenic
938568065 2:132538674-132538696 CCTGGGACAGAGCACCCGGGGGG - Intronic
938583841 2:132670382-132670404 CCTGGGAAAGGGGCGCCGGGGGG + Intronic
941682286 2:168412652-168412674 CCTGGGACAGAGCACCTGGGGGG - Intergenic
942582064 2:177429930-177429952 CCTGGGACAGAGCCCCTTGGGGG - Intronic
943953996 2:194162684-194162706 ACAGGTACAGAGACCCCAGGTGG + Intergenic
944244251 2:197515852-197515874 GCAGGGACTGAGGCACCGGAAGG - Exonic
946210529 2:218143829-218143851 CCATGGACACAGGCCCAGTGTGG + Intergenic
946648750 2:221868640-221868662 CCTGGGATGGAGGCCCCGGGAGG + Intergenic
946735807 2:222753530-222753552 GCAGATACAGAGGCCCAGGGAGG + Intergenic
946966342 2:225041889-225041911 CGAGTGCCAGAGACCCCGGGTGG - Intronic
947033545 2:225825071-225825093 CCTGGGACAGAGCACCTGGGGGG + Intergenic
947272589 2:228353217-228353239 CCCGGGACATGGGCCCAGGGCGG - Intergenic
948248365 2:236505479-236505501 CCAGAGACAGAGGGCTCTGGGGG - Intronic
948388532 2:237596557-237596579 CCCGGAACAGAGGCCCCTGCAGG - Intronic
948491163 2:238314228-238314250 CCAGAGACAAAGGCCTGGGGAGG - Intergenic
948624752 2:239262010-239262032 CCAGACACAGAGGCCCTAGGTGG + Intronic
948861588 2:240755173-240755195 CCAGAGGCAGAGGCCCCTGGGGG + Intronic
949041319 2:241851194-241851216 TCAGGGACACAGGGCACGGGGGG + Exonic
949045815 2:241872228-241872250 ACAGGGAGAGAGGCCCCCGCAGG - Exonic
1170510151 20:17068075-17068097 CCAGGGGCTGAGGCCCTGGAGGG + Intergenic
1170574662 20:17653275-17653297 TAAAGGACAGAGGCCCTGGGTGG - Intronic
1171448814 20:25222376-25222398 ACAGGAACAGAGGACCCCGGAGG - Intronic
1172094685 20:32454914-32454936 CCAGGGAGAGAGGCCTGGCGGGG - Intronic
1172404387 20:34676892-34676914 CCATTCACAGAGGCCGCGGGAGG + Intronic
1172816896 20:37694271-37694293 CGAGGGGCTGAGACCCCGGGTGG - Intronic
1173310952 20:41895459-41895481 CCAGGGACAGAGGAGGAGGGAGG - Intergenic
1173384645 20:42576148-42576170 CTAGGGACAAAGGCCCAGGAGGG - Intronic
1173795538 20:45857103-45857125 CCGGAGCCAGGGGCCCCGGGCGG + Intronic
1173987967 20:47277443-47277465 CCAGAGCCAGTGGCCCCCGGGGG + Intronic
1174072611 20:47909495-47909517 CCAGGGACAGTGGGTCTGGGTGG - Intergenic
1174133870 20:48365345-48365367 CCAGGGGCACAGGCCTGGGGAGG - Intergenic
1174275058 20:49397694-49397716 CCCAAGACAGGGGCCCCGGGAGG - Intronic
1174308737 20:49633913-49633935 GCAGGGACAAAGGCCCGGTGGGG + Exonic
1174385565 20:50186844-50186866 CCAGGGACTGAGGCCCAGAGGGG + Intergenic
1175938854 20:62528087-62528109 CCCCGGACAGTGGCCCTGGGTGG + Intergenic
1176096686 20:63347542-63347564 CCAGGAGCAGAGGCCTAGGGAGG + Intronic
1176869602 21:14074474-14074496 ACAAGGACAGAAGCCGCGGGGGG - Intergenic
1176871244 21:14084538-14084560 CCAGGGAAGGAGGTCCCCGGGGG + Intergenic
1177166658 21:17612246-17612268 CCGGGGACAGCGGACCCGCGGGG - Intronic
1178343601 21:31806473-31806495 CCTGGGACAGAGGCCTCAGAAGG - Intergenic
1178670247 21:34583615-34583637 CCAAGGAGAGAGGCCTCAGGAGG + Intronic
1178944088 21:36931868-36931890 CCACAGACAGTGGCCCCGGCTGG - Intronic
1179186611 21:39089790-39089812 CCAAGGAGAGAGGCCTCAGGAGG + Intergenic
1179251398 21:39674139-39674161 CCAAGGAGAGAGGCCTCAGGAGG - Intergenic
1179312334 21:40207811-40207833 CCACGGAGAGAGGCCTCAGGAGG - Intronic
1179715584 21:43285853-43285875 CCAAGGAGAGAGGCCTCGGGAGG + Intergenic
1179715603 21:43285958-43285980 CCAAGGAGAGAGGCCTCAGGAGG + Intergenic
1179715640 21:43286168-43286190 CCAAGGAGAGAGGCCTCGGGAGG + Intergenic
1179715661 21:43286273-43286295 CCAAGGAGAGAGGCCTCGGGAGG + Intergenic
1179885341 21:44311923-44311945 CCAAGGAGAGAGGCCCAGGGAGG + Intronic
1180052985 21:45341399-45341421 CCAGCCACAGAGACCCCGGGTGG - Intergenic
1180162855 21:46006016-46006038 CCCGGGGCAGAGGCAGCGGGTGG + Intergenic
1180162928 21:46006212-46006234 CCCGGGTCAGAGGCAACGGGTGG + Intergenic
1180481917 22:15761887-15761909 CCACAGATAGAGGACCCGGGTGG - Intergenic
1180627623 22:17204702-17204724 CCAAGGACAGAGGTCTCAGGAGG + Intronic
1180838754 22:18947972-18947994 CCAGGGCCAGAGGATCCAGGTGG + Intergenic
1180839937 22:18954570-18954592 GCAGGGACAGAGGCGGCCGGCGG + Intergenic
1181017669 22:20080470-20080492 TCCGGGACCGAGGCCGCGGGCGG + Intronic
1181171481 22:21012556-21012578 GCAGGTACAGAGGCCCTGGCAGG - Intronic
1181484055 22:23219458-23219480 CCAGGGACAGAGGCCAAGGGTGG - Intronic
1181528808 22:23504429-23504451 CCAGGGAGGGAGGGCCTGGGGGG - Intergenic
1181743381 22:24939086-24939108 ACAGAGACAGGGGCTCCGGGTGG + Intronic
1182194961 22:28506411-28506433 CCTGGGACAGAGCTCCCGGGGGG + Intronic
1182296980 22:29315646-29315668 AGAGGCACAGAGGCTCCGGGAGG - Exonic
1183426406 22:37741703-37741725 GAAGGGACTGAGGCCCAGGGAGG + Intronic
1183457945 22:37932899-37932921 CCAGGGAGGGATGCCCCAGGCGG - Intronic
1183732991 22:39628784-39628806 CCAGGGAGAGTGGCCCCCAGTGG + Intronic
1183784571 22:40021991-40022013 CGAGGGCCAGAGGCCTGGGGAGG - Intronic
1184067962 22:42130846-42130868 CCAGGCACAGAGGACCAGGCAGG + Exonic
1184070699 22:42144519-42144541 CCAGGCACAGAGGACCAGGCAGG + Intergenic
1184072581 22:42155056-42155078 CCAGGCACAGAGGACCAGGCAGG + Intergenic
1184110289 22:42390134-42390156 GCTGGGACAGAGCCGCCGGGTGG + Intronic
1184601581 22:45546946-45546968 GGAGAGACAGAGGTCCCGGGGGG - Intronic
1184663448 22:45976050-45976072 CCAGGGCCCAGGGCCCCGGGCGG + Intronic
1184866638 22:47205214-47205236 CCAGGAACGGAGGCCCCGTCAGG - Intergenic
1184896672 22:47411300-47411322 CCAGGGAAAGAGGCACCAAGGGG + Intergenic
1184997056 22:48215027-48215049 CCAGTCACAGAGGGCTCGGGGGG + Intergenic
1185175032 22:49321555-49321577 ACAGGGACAGAGGTGCAGGGTGG - Intergenic
1185223242 22:49639638-49639660 CCAGACACAGAGGCCCTGGTCGG + Intronic
1185346933 22:50314520-50314542 GCAGAGACAGAGGTCCAGGGAGG + Intronic
1185378942 22:50497869-50497891 CCACGGGCAGAGGCCCTGGCTGG - Intergenic
950424738 3:12919074-12919096 TCAGGATGAGAGGCCCCGGGTGG + Intronic
952238715 3:31507497-31507519 CCAGGGACAGAGGGCACAAGAGG + Intergenic
953084419 3:39653127-39653149 CAATGGACAGAGGCCCATGGAGG + Intergenic
953102303 3:39842067-39842089 CCTGGGACAGAGCACCTGGGGGG - Intronic
953269265 3:41424271-41424293 CCTGGGACTGAGCCCCTGGGGGG + Intronic
953901539 3:46846556-46846578 TCAGGGACACAGGCCCCGGGTGG - Intergenic
954038127 3:47864210-47864232 CCAGGTACAGTGGCCCTGGGAGG - Intronic
954370378 3:50166916-50166938 CCAGTTTCAGAGGCCCCCGGGGG - Intronic
954635439 3:52068499-52068521 CCAGGCACACAGGCCCCTGCAGG + Intergenic
956753582 3:72364296-72364318 CCAGGGAGAGAGGCCTCAGGAGG - Intergenic
957085804 3:75675461-75675483 CCAGGGACAGTGGACTGGGGTGG - Intergenic
959846229 3:111036518-111036540 CCAGGGACAGGGGTGCCAGGTGG - Intergenic
960996676 3:123344812-123344834 ACAGGGAAAGAGGCCCCAGAGGG + Intronic
962241818 3:133756539-133756561 CCAGAGGCAGAGGCACCGTGTGG - Intronic
963296022 3:143547639-143547661 ACAGGTACAGAGGCCCCCTGGGG - Intronic
965615047 3:170585303-170585325 CCGGGGACAGACGCCCCTCGGGG + Intronic
968281652 3:197481606-197481628 ACAGGCCCAGAGGCCCAGGGCGG - Intergenic
968361359 3:198149074-198149096 CCAGGGACAGATGCCCTTAGGGG - Intergenic
968449404 4:668146-668168 GCAGGGAGAGAGGCCACGGCGGG + Intronic
968551336 4:1225270-1225292 CCAGGAGGAGAGGCCCGGGGCGG - Intronic
968563489 4:1296999-1297021 TCAGGGAGAGAGGCCTGGGGAGG - Intronic
968816056 4:2822609-2822631 CCAGGACCAGAGGCCCAGGGAGG - Intronic
968845159 4:3036898-3036920 ACAGGGACAGAGGCCACCAGCGG - Intronic
969230916 4:5830277-5830299 CCAGAGACAGAGGACCAGGGAGG - Intronic
969658336 4:8510657-8510679 TCAGGGGAAGAGGGCCCGGGAGG + Intergenic
969854988 4:9991785-9991807 CCATGGAGAGAAGCCTCGGGAGG + Intronic
970057624 4:11993645-11993667 ACAGGCCCAGAGGCCTCGGGGGG + Intergenic
970480745 4:16471217-16471239 CCAAGGAAAGAGGCCCCAGGAGG - Intergenic
974016897 4:56656189-56656211 CCAGGGAGGGAGGCCCGGGTGGG - Intronic
974539755 4:63218975-63218997 CCTGGGACAGAGACCCTGGCGGG - Intergenic
974868346 4:67607239-67607261 TCAAGGAGAGAGGCCTCGGGGGG + Intronic
975584892 4:75940147-75940169 CTAGGGACAGAGTCCCCAAGTGG - Exonic
975839629 4:78459783-78459805 CCAAGGAGAGAGGCCTGGGGCGG - Intronic
976366772 4:84241420-84241442 CCAGAGACAGAGGCACCGGGAGG - Intergenic
977524302 4:98125809-98125831 CCTGGGACAGAGCCCCTGGCGGG - Intronic
977657231 4:99536361-99536383 CCTGGGACAGAGCCCCTTGGGGG - Intronic
978611293 4:110543819-110543841 CCAGAGAAAGAGGCCATGGGAGG - Intronic
980477260 4:133333961-133333983 CCTGGGACAGAGCACCTGGGGGG - Intergenic
981663120 4:147190395-147190417 TCAGGGACAGAGGCCCAGGCAGG - Intergenic
981750710 4:148090589-148090611 ATAGGGACAGAGGCTCCGAGAGG - Intronic
982793405 4:159618086-159618108 CCATGGCCACAGGCCCCAGGAGG + Intergenic
985444212 4:190012064-190012086 CCAGGGACAGTGGACTGGGGTGG + Intergenic
985559434 5:575287-575309 CCAAGGAAAGAGACCCCAGGAGG + Intergenic
985783227 5:1881607-1881629 CCTGGGACAGATGACCCGGCAGG - Intronic
986032720 5:3909069-3909091 CCAGAGACAGAGGCACAGGCCGG - Intergenic
986065470 5:4230085-4230107 CCTGACGCAGAGGCCCCGGGTGG + Intergenic
986402610 5:7395529-7395551 CCGGGGTCAGAGGACCCGGGGGG - Intergenic
986469273 5:8058395-8058417 CCAGGAACAGGGTCCCAGGGAGG + Intergenic
986541007 5:8843643-8843665 CCAGGAACAGGGTCCCAGGGAGG - Intergenic
986569644 5:9151934-9151956 CCAGGCACAGAGGCCTGGGGAGG - Intronic
987837377 5:23178976-23178998 CCTGGGACAGAACCCCCGGGAGG - Intergenic
987906747 5:24088001-24088023 CCTGGGACAGAGTACCCAGGGGG + Intronic
989139904 5:38191974-38191996 ACAGGGACACAGGCTCCTGGAGG + Intergenic
990803550 5:59632273-59632295 CCTGGGACAGAGCACCTGGGGGG + Intronic
991679948 5:69129083-69129105 CCAGGCACAGTGGCCCAGGGAGG - Intronic
993365504 5:87030073-87030095 CCTGGGTCAGAGGACCTGGGGGG - Intergenic
993792221 5:92222562-92222584 CCTGGTACAGAGGTCCCAGGTGG - Intergenic
995678896 5:114695558-114695580 CCAGGGCCAGTGGCACCGGCTGG - Intergenic
996340936 5:122438218-122438240 ACAGGGACAGTGGCCCTGGCTGG - Intronic
997205035 5:132043241-132043263 CCTGGGACAGAGCCCCCAGAGGG - Intergenic
997262465 5:132475398-132475420 CCAGGGACAGAGGCCTGGCTGGG - Intronic
997297735 5:132778086-132778108 CCAGGGTCGGAGGCCTCAGGAGG + Intronic
997733611 5:136197858-136197880 CCAGGCTCAGGGGCCCCTGGTGG + Intergenic
997741495 5:136258804-136258826 CCTGGGACAGTAGCCCCTGGGGG - Intronic
997959074 5:138305070-138305092 GCAGGTACAGAGGCCCCAGGTGG - Intronic
998167999 5:139855527-139855549 CCAGCTACAGAGGCCCCCGAGGG + Intronic
998385609 5:141755495-141755517 CCAGGGATTGAGGCACTGGGTGG - Intergenic
998471429 5:142386810-142386832 CCAGAGACAGAGGCCAAGAGAGG + Intergenic
998691575 5:144594350-144594372 CCTGGGACAGAGCACCTGGGGGG - Intergenic
999452654 5:151689964-151689986 CCAGGGTGAGAGGCCTTGGGGGG - Intergenic
999721214 5:154400512-154400534 CCTGGGTCACAGGCCCCAGGTGG + Intronic
1000128220 5:158268450-158268472 GCAGCGACAGTGGCCCTGGGCGG - Intergenic
1000345823 5:160312567-160312589 CGAGGGAGGGAGGCCCCCGGCGG - Exonic
1001139678 5:169134310-169134332 AGAGGGACAGAGGCCCCAGGTGG - Intronic
1001146141 5:169186345-169186367 CCAAGGAGAGAGGCACCAGGAGG + Intronic
1001550475 5:172598727-172598749 CTTGAGACAGAGGCCCCGTGGGG - Intergenic
1001843548 5:174901617-174901639 CCAGGGCCAGCGGCGCCGGCTGG - Intergenic
1002055336 5:176595384-176595406 CCTGGACCAGAGGCCCCAGGAGG + Intronic
1002382655 5:178841312-178841334 TGTGGGACAGAGGCCCAGGGGGG + Intergenic
1002612771 5:180432269-180432291 CCAGGGCCACCAGCCCCGGGTGG + Intergenic
1002696785 5:181097679-181097701 GCTGGGCCAGAGGCCCCGGCTGG + Intergenic
1002697837 5:181101694-181101716 GCTGGGCCAGAGGCCCCGGCTGG - Intergenic
1002839852 6:896298-896320 CCAGGGATAGAGGAGCAGGGCGG - Intergenic
1003322506 6:5063947-5063969 CCAGGGGCAGTGGCTCCGGTGGG + Intergenic
1003406622 6:5831751-5831773 CCTGGGCCAGAGGCCCCTGGAGG + Intergenic
1003872190 6:10412395-10412417 CGAGGGAGAGGAGCCCCGGGTGG + Intronic
1004179863 6:13371842-13371864 GCAGGGACAGAGCCCTCAGGGGG - Intronic
1004983937 6:21059053-21059075 CCTGGGACAGAGACCCTGAGGGG - Intronic
1006101837 6:31690351-31690373 CTAGGGACACAGGCCAGGGGAGG + Intronic
1006284362 6:33081398-33081420 CCAGGGAGAGGGGACCCAGGGGG + Intronic
1006811735 6:36824563-36824585 CAAGGGGCAGAGGCCCCTGTGGG - Intronic
1007167826 6:39841157-39841179 CCAGGGGGAGAGGCTCCAGGGGG + Intronic
1007167901 6:39841337-39841359 CCAGGGGGAGAGGCTCCAGGGGG + Intronic
1007434951 6:41803835-41803857 ACAGAGACAGAGGCCCTGGAAGG - Exonic
1007485695 6:42179138-42179160 GCAGGGACAGAGCCCACGTGAGG - Intronic
1011603718 6:89081763-89081785 GCAGGGACAGGGCCCGCGGGAGG + Intronic
1012052501 6:94362175-94362197 CCCGGGAATGCGGCCCCGGGAGG + Intergenic
1016286102 6:142474639-142474661 TAAGGAACAGAGGCACCGGGAGG - Intergenic
1016683965 6:146860777-146860799 CCAGGGACAGAAGCCAGTGGAGG - Intergenic
1017656074 6:156631086-156631108 CCAGGCACAGGGGCCCCTGGAGG + Intergenic
1017891433 6:158643031-158643053 CCTGGGATGGAGGCCCTGGGAGG - Intronic
1017994466 6:159520464-159520486 CCAGGGACAGAGCTCCCAGTGGG - Intergenic
1018397466 6:163389661-163389683 CCCGGGTCAGAGGCCCTGGATGG - Intergenic
1018617578 6:165702597-165702619 CCAGGAACAGTGGCAGCGGGTGG + Intronic
1018640069 6:165897484-165897506 CCAGGGAGTGAGGTCCCTGGAGG + Intronic
1019167773 6:170110349-170110371 ACAGGGACAGAGTGCCAGGGTGG + Intergenic
1019171537 6:170135978-170136000 CCAGGGACAGGCGCCCTTGGCGG - Intergenic
1019406168 7:885419-885441 ACGGGGACAGAGGCACGGGGTGG - Intronic
1019495823 7:1340190-1340212 GCAGGTGCAGAGGCCCTGGGTGG - Intergenic
1019623266 7:2002863-2002885 GCAGGGGCAGAGGCCCAGGGCGG - Intronic
1020101287 7:5395486-5395508 CGTGGGACAGAGCCCCTGGGTGG - Intronic
1020111734 7:5451554-5451576 GCAGGTGCAGAGCCCCCGGGTGG - Intronic
1020116491 7:5479386-5479408 CCAGAGACACAGGCCCCCTGAGG + Intronic
1020391364 7:7661918-7661940 CCAGGGACAGAGCACCTCGGGGG - Intronic
1020557759 7:9691462-9691484 CCTGGGACAGAGCACCTGGGGGG + Intergenic
1020867994 7:13590778-13590800 CCTGGGACAGAGTCCCTGGGGGG - Intergenic
1022691981 7:32665070-32665092 CCAGAGACAGAGGCTCCAGGAGG + Intergenic
1022795750 7:33730252-33730274 CCAGGGACAGGGGCCTCAGAAGG + Intergenic
1022919646 7:34999623-34999645 CCAGAGACAGAGGCTCCAGGAGG + Intronic
1023275070 7:38510170-38510192 CCAAGGAGAGAGGCCACGGGGGG - Intronic
1024214996 7:47240960-47240982 CCAAGGATAGAGGCCTCAGGAGG + Intergenic
1024248444 7:47488452-47488474 CCCGGGAGAGAGGCCTCAGGAGG - Intronic
1024473886 7:49790721-49790743 GCAGGGCCAGAGTCCCCAGGTGG + Intronic
1024658786 7:51473948-51473970 CCCAGGACAGAGGCCTCAGGAGG - Intergenic
1025231291 7:57204731-57204753 CCAGGGACAGTGGGTCCAGGGGG - Intergenic
1027958484 7:84913449-84913471 CCAGGGACAGAGGAGCCCCGAGG - Intergenic
1029325879 7:99808347-99808369 ACAGGCACAGAAGCCCCAGGTGG + Intergenic
1029995263 7:105001236-105001258 CCAGGGAAGGAGGCCCCCAGGGG + Intergenic
1030079963 7:105768964-105768986 CCATGGATAGAGACCCCAGGGGG - Intronic
1032198822 7:129805061-129805083 CCAGTGGCAGAGGCTCCTGGGGG + Intergenic
1032428486 7:131841286-131841308 GCATGGACAGAGGCCTCAGGTGG - Intergenic
1033232690 7:139614034-139614056 CCAGGGACACAGTCCCTGGCAGG + Intronic
1034569055 7:151940713-151940735 CCAGAGCAAGAGGGCCCGGGAGG + Intergenic
1034819769 7:154205954-154205976 CAAGGGTCAGAGGCCGAGGGTGG - Intronic
1034943334 7:155246158-155246180 CCAGGAACAGAGGCTCCTGCAGG + Intergenic
1035038072 7:155908309-155908331 CCAGGGTCAGAGGCTCCAGAGGG - Intergenic
1035153309 7:156892866-156892888 GCGGGGACGGAGGGCCCGGGCGG + Intronic
1035319833 7:158021683-158021705 CCAAGGAGAGGGGCCTCGGGAGG + Intronic
1035526239 8:315474-315496 CCAAGGAGAGAGGCCTCAGGAGG - Intergenic
1035649595 8:1254839-1254861 CCAGGGAGTGAGGCCCACGGAGG - Intergenic
1036122775 8:6036279-6036301 TCAGGGACAGGTGCTCCGGGTGG - Intergenic
1036752009 8:11449453-11449475 CCTGGGGCCCAGGCCCCGGGAGG + Intronic
1036766292 8:11551313-11551335 CCAAGGAGAGAGCTCCCGGGAGG - Intronic
1037281526 8:17247147-17247169 CCAGCGACAGAGGAGCGGGGTGG - Exonic
1037817702 8:22120647-22120669 CTAGGGACCAAGGCCCCGAGGGG + Intronic
1039428355 8:37505561-37505583 GAAGGGGCAGAGGCCCAGGGTGG - Intergenic
1039659151 8:39444638-39444660 CCAAGGACAAAGGCCCCCTGAGG + Intergenic
1039967474 8:42293638-42293660 CCAGGGACGGGGGACCCTGGTGG + Intronic
1040280580 8:46039842-46039864 CCAGGGAACGAGGTCCCCGGGGG + Intergenic
1040551838 8:48443965-48443987 CAAGCAACAGAGGACCCGGGAGG + Intergenic
1042195623 8:66229061-66229083 CCTGGGACAGAGCACCCGGGGGG + Intergenic
1042226761 8:66520430-66520452 CCCAGGACGGAGGCCCCGAGTGG - Intergenic
1044961712 8:97537782-97537804 ACAGGGACAGAGGTCCAGCGTGG + Intergenic
1045294437 8:100861161-100861183 CCAAGGAGAGAGGCCTCAGGAGG - Intergenic
1046239344 8:111470797-111470819 CAAGGGACAGAGGCTGAGGGGGG + Intergenic
1046907257 8:119586992-119587014 CCAGGGGCAGAGGCCTGGGCAGG + Intronic
1048877588 8:138849183-138849205 CCAGGGACTGAGCGCCCGCGTGG + Intronic
1049242163 8:141543592-141543614 CGCTGGACAGAGGCCCCAGGGGG - Intergenic
1049297561 8:141850898-141850920 CCAAGGAGAGAGGCCTTGGGAGG + Intergenic
1049352780 8:142172944-142172966 CCAAGGAGAGAGGCCCCAGGAGG + Intergenic
1049431701 8:142568335-142568357 CCAAGGAGAGAGGCCCCAGGAGG + Intergenic
1049498170 8:142946447-142946469 CCAAGGACAGAGGCCCCAGGAGG - Intergenic
1049529594 8:143147750-143147772 CCAGGGTCAGTGGCCTGGGGAGG + Intergenic
1049600924 8:143507171-143507193 CCCGGGATAGCGGCCCCAGGAGG + Intronic
1049633375 8:143672014-143672036 CCAGGGAGAGAGGCCCCAGAGGG - Intergenic
1049748397 8:144272600-144272622 CCAAGGACACTGGCCCCGAGTGG + Intronic
1049749481 8:144276537-144276559 CCAGGGACAGAGGCCCCGGGAGG - Intronic
1049872329 8:144990424-144990446 CCTGGGACAGAGCCCCTGGAGGG - Intergenic
1051403087 9:16704849-16704871 ACAGGGACGGAGGCCAGGGGAGG + Intronic
1051613349 9:18982507-18982529 CCAGTGACAGAAGACCCTGGAGG - Intronic
1051982949 9:23046213-23046235 CCTGGGACAGAGCACCTGGGGGG + Intergenic
1052756797 9:32550620-32550642 CCAGGGCCAGGGCCCCCGAGCGG - Intronic
1054255081 9:62802685-62802707 CAGGGGACAGAGGCCTCCGGCGG - Intergenic
1055480381 9:76703648-76703670 CCAGGGACTCAGGGCCTGGGTGG - Exonic
1056273852 9:84973688-84973710 CCAGACACAAAGGCCCAGGGAGG - Intronic
1056969106 9:91187746-91187768 CCAGGAACAGAGGCCACGTAGGG + Intergenic
1057530008 9:95836886-95836908 CCAAGGAGAGAGGCCTCAGGAGG - Intergenic
1058637613 9:107051586-107051608 AGAGGGACAGAGGCCCAGAGGGG + Intergenic
1058991192 9:110256355-110256377 CCAGTTACAGAGGCCGCGCGCGG + Intronic
1059076343 9:111197401-111197423 CCTGGGACAGAGCTCCCAGGGGG + Intergenic
1060340165 9:122768135-122768157 CCCGGGACAGAGCTCCTGGGAGG + Intergenic
1060629509 9:125143305-125143327 CCAGGGGCAGCGGCTCGGGGCGG - Intronic
1061255303 9:129451723-129451745 CCAGGGAGGGAGGGCCTGGGGGG + Intergenic
1061296241 9:129678388-129678410 CCAGGCACAGGGGCCCCTGCAGG + Intronic
1061425008 9:130493244-130493266 ACAGGGAGAGAGGCCCAGAGAGG - Intronic
1061737255 9:132670084-132670106 CCGGGGACGGCGGCACCGGGCGG + Exonic
1061843781 9:133375766-133375788 GCCGGGACAGAGGGCCCGGGCGG + Intronic
1061991271 9:134160030-134160052 CCGGGGACAAAGCCCCAGGGCGG - Intergenic
1062002680 9:134224810-134224832 CAAGGCACTGAGGCCCAGGGAGG + Intergenic
1062076104 9:134590776-134590798 CCACAGAGAGAGGCCCTGGGAGG + Intergenic
1062126443 9:134865420-134865442 CCATGGAGAAAGGCCCCGAGTGG + Intergenic
1062267918 9:135695844-135695866 TTAGGGACAAAGGCCCCGGGTGG + Intronic
1062280781 9:135750739-135750761 CCAGGGACAGAGCCTCTTGGAGG + Intronic
1062373085 9:136250208-136250230 CCAAGGACAGCGGCCCTGGAGGG - Intergenic
1062379415 9:136280090-136280112 CCAAGGCCAGAGGCCCACGGGGG + Intergenic
1062396181 9:136353754-136353776 CCAGAGGCAGAGGCCCCCCGCGG + Intronic
1062404352 9:136387849-136387871 CTAGGGACAGAGGAACAGGGAGG + Intronic
1062409868 9:136418164-136418186 CCAGGGACAGAGGGCAGGGCTGG - Intronic
1062683206 9:137795591-137795613 CCACAGACAGTGGCCCCGGCTGG + Intronic
1062746070 9:138212894-138212916 CCAGGGACAGATGCCCTTAGGGG - Intergenic
1185672147 X:1821414-1821436 CCAAGGAGAGAGGCCTCAGGAGG - Intergenic
1185700147 X:2225529-2225551 CCAAGGAGAGAGGCCTCAGGAGG + Intronic
1185700216 X:2226002-2226024 CCAAGGAGAGAGGCCTCGGGAGG + Intronic
1185704773 X:2258556-2258578 CCAAGGAGAGAGGCCTCAGGAGG + Intronic
1185726243 X:2424186-2424208 CCAAGGAGAGAGGCCTCAGGAGG + Intronic
1185770403 X:2761555-2761577 CCCAGGACAGAGGCCTCAGGAGG + Intronic
1185822323 X:3217572-3217594 CCAAGGGGAGAGGCCTCGGGAGG - Intergenic
1185841720 X:3398203-3398225 CCAAGGAGAGAGGCCTCAGGAGG + Intergenic
1185853464 X:3510557-3510579 CCAAGGAGAGAGGCCTCAGGAGG + Intergenic
1185895112 X:3851516-3851538 CCAAGGAGAGAGGCCTCAGGAGG + Intergenic
1185900230 X:3889941-3889963 CCAAGGAGAGAGGCCTCAGGAGG + Intergenic
1185905346 X:3928372-3928394 CCAAGGAGAGAGGCCTCAGGAGG + Intergenic
1186022581 X:5272519-5272541 CCAAGGAGAGAGGCCCCAGGAGG + Intergenic
1186043659 X:5509416-5509438 CCAAGGAGAGAGGCCTCAGGAGG + Intergenic
1186044136 X:5516038-5516060 CCAAGGAGAGAGGCCTCAGGAGG - Intergenic
1186063620 X:5738233-5738255 CCACGGAGAGAGGCCTCAGGAGG - Intergenic
1186112156 X:6269957-6269979 CCAAGGAGAGAGGCCCCAGGAGG - Intergenic
1186203711 X:7179752-7179774 CCAGGGGCAGAGGGTGCGGGTGG + Intergenic
1186471124 X:9822846-9822868 GAAGGGACAGAGCCCCAGGGAGG - Intronic
1186481691 X:9901092-9901114 CCTAGGAGAGAGGCCCCAGGAGG - Intronic
1189195575 X:39149468-39149490 CCAAGGAGAGAGGCCTCAGGTGG - Intergenic
1189674157 X:43443883-43443905 CCTGGGACAGAGTTCCCAGGGGG - Intergenic
1190977134 X:55416690-55416712 CCTGGGACAGAGTTCCCAGGGGG + Intergenic
1191185516 X:57607360-57607382 CCAGGGACAGAGCACTTGGGAGG - Intergenic
1192167044 X:68832882-68832904 CCAGGGGAAGAGGCTGCGGGAGG - Intronic
1192916013 X:75652086-75652108 CCTGGGACAGAGCACCTGGGGGG - Intergenic
1192997854 X:76531512-76531534 CCTGGGACAGAGTTCCTGGGAGG - Intergenic
1194595082 X:95847761-95847783 CCAGGGACAGTGGACTAGGGAGG + Intergenic
1194930430 X:99881003-99881025 CTTGGGACAGAGCCCCTGGGGGG + Intergenic
1196228076 X:113189458-113189480 CCTGGGACAGAGGCTCCAGAGGG - Intergenic
1198687104 X:139238327-139238349 CCTGGGACAGAGCTCCCTGGGGG + Intergenic
1198868570 X:141152175-141152197 CCAAGGAGAGAGGCCCCAGAAGG - Intergenic
1199177085 X:144801945-144801967 CAAGAGATAGAGGCCCGGGGAGG - Intergenic
1199775845 X:151011156-151011178 CCAAGGAGAAAGGCCCCAGGAGG + Intergenic
1199849521 X:151715504-151715526 GCAGGGCCTGAGGCCCCTGGGGG + Intergenic
1199959436 X:152767816-152767838 GGAGGAACAGAGGCCCCCGGAGG - Exonic
1200110520 X:153738438-153738460 GCTGGGACAGAGGCCCCGAGCGG - Intronic
1200183957 X:154169726-154169748 GCTGGGACAGAGGCCCCGAGTGG - Intergenic
1200189611 X:154206854-154206876 GCTGGGACAGAGGCCCCGAGTGG - Intergenic
1200195364 X:154244663-154244685 GCTGGGACAGAGGCCCCGAGTGG - Intergenic
1200201016 X:154281784-154281806 GCTGGGACAGAGGCCCCGAGTGG - Intronic
1200232487 X:154451010-154451032 CCTGGGAGAGAGGCCTGGGGAGG - Intergenic
1200321731 X:155196721-155196743 CCTGGAACAGAGCCCCTGGGGGG - Intergenic
1200336247 X:155354017-155354039 CCTGGGACAGAGGTCCCAGGGGG + Intergenic
1200336287 X:155354240-155354262 CCTGGGACAGAGCTCCCGGAGGG + Intergenic
1200350183 X:155486987-155487009 CCTGGGACAGAGCTCCCGGAGGG - Intergenic
1200350223 X:155487210-155487232 CCTGGGACAGAGGTCCCAGGGGG - Intergenic
1200809968 Y:7473970-7473992 CCAAGGAGAGAGGCCTCAGGAGG - Intergenic
1201299822 Y:12495939-12495961 CCAAGGAGAGAGGCCTCAGGAGG - Intergenic
1201299857 Y:12496174-12496196 CCCAGGACAGAGGCCTCAGGAGG - Intergenic
1201532712 Y:15009859-15009881 CCAAGGAGAGAGGCCTCAGGAGG + Intergenic
1201605728 Y:15782456-15782478 CCAAGGAGAGAGGCCTCAGGAGG - Intergenic