ID: 1049749484

View in Genome Browser
Species Human (GRCh38)
Location 8:144276540-144276562
Sequence AGCCCAGGGACAGAGGCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 667
Summary {0: 1, 1: 0, 2: 8, 3: 58, 4: 600}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049749484_1049749496 22 Left 1049749484 8:144276540-144276562 CCCGGGGCCTCTGTCCCTGGGCT 0: 1
1: 0
2: 8
3: 58
4: 600
Right 1049749496 8:144276585-144276607 CGGAAGCCACTGGGGCAGTCAGG No data
1049749484_1049749493 12 Left 1049749484 8:144276540-144276562 CCCGGGGCCTCTGTCCCTGGGCT 0: 1
1: 0
2: 8
3: 58
4: 600
Right 1049749493 8:144276575-144276597 AGGCTAGACACGGAAGCCACTGG No data
1049749484_1049749491 -8 Left 1049749484 8:144276540-144276562 CCCGGGGCCTCTGTCCCTGGGCT 0: 1
1: 0
2: 8
3: 58
4: 600
Right 1049749491 8:144276555-144276577 CCTGGGCTGACACGGGTGTCAGG No data
1049749484_1049749492 2 Left 1049749484 8:144276540-144276562 CCCGGGGCCTCTGTCCCTGGGCT 0: 1
1: 0
2: 8
3: 58
4: 600
Right 1049749492 8:144276565-144276587 CACGGGTGTCAGGCTAGACACGG No data
1049749484_1049749495 14 Left 1049749484 8:144276540-144276562 CCCGGGGCCTCTGTCCCTGGGCT 0: 1
1: 0
2: 8
3: 58
4: 600
Right 1049749495 8:144276577-144276599 GCTAGACACGGAAGCCACTGGGG No data
1049749484_1049749494 13 Left 1049749484 8:144276540-144276562 CCCGGGGCCTCTGTCCCTGGGCT 0: 1
1: 0
2: 8
3: 58
4: 600
Right 1049749494 8:144276576-144276598 GGCTAGACACGGAAGCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049749484 Original CRISPR AGCCCAGGGACAGAGGCCCC GGG (reversed) Intronic
900110946 1:1005359-1005381 AGCTGAGGGACAGCAGCCCCAGG - Intergenic
900525540 1:3126634-3126656 AGCCCAGGGCTGGAGGCTCCTGG - Intronic
900596998 1:3484466-3484488 GGCCCAGCGACAGAGCCCACAGG - Intergenic
900604327 1:3517056-3517078 AGGCCATGCTCAGAGGCCCCTGG - Intronic
900605437 1:3521617-3521639 AGACCGGGGACGGAGTCCCCTGG - Intronic
901145216 1:7060267-7060289 AGGCCAAGGAGAGAGGCCTCGGG - Intronic
901235848 1:7667289-7667311 AGCCCAGGGTCAGGGGGCACGGG - Intronic
901285816 1:8077864-8077886 AGCCCAGGGAGAGAGGCCAGAGG - Intergenic
901393530 1:8963961-8963983 AGCCCAGGCACAGGGGCTTCAGG - Intronic
901445203 1:9304214-9304236 AGCCCCGGGCCAAAGACCCCGGG - Intronic
901461186 1:9392769-9392791 AAGGAAGGGACAGAGGCCCCAGG - Intergenic
902542133 1:17163018-17163040 AGGCTTGGTACAGAGGCCCCGGG - Intergenic
902558683 1:17262156-17262178 AGGCCAGGGGCAGAGGCTCATGG - Exonic
903943303 1:26946293-26946315 GGCCCAGGCACACAGGTCCCGGG + Exonic
904396908 1:30228207-30228229 AGCCAAGGGAAAGAGCACCCAGG - Intergenic
904432265 1:30471958-30471980 AGCTCAGGCACTGAGGCCCCTGG + Intergenic
904602747 1:31682938-31682960 GGCCCAGAGACACTGGCCCCAGG + Exonic
904889799 1:33771241-33771263 AGCCCAGGGACAGGTGCACGGGG - Intronic
905260270 1:36712311-36712333 AGCCCAGGGACAGAGAGTCTGGG + Intergenic
905271713 1:36791769-36791791 AGCCCAGGCACAGAGGAATCAGG - Intergenic
906180582 1:43815042-43815064 AGCCTGAGGACAGAGGCCCCAGG - Intronic
906544785 1:46613333-46613355 AGCCCCTGGACAGCAGCCCCAGG - Exonic
906710624 1:47927199-47927221 AGGCCTGGCACAGTGGCCCCAGG + Intronic
907091939 1:51733249-51733271 AAACTAGGGACAAAGGCCCCGGG - Intronic
907957512 1:59244294-59244316 AGGCCAAGGAGAGAGGCCTCGGG - Intergenic
908401141 1:63774077-63774099 AGCCCCGGGACGGCAGCCCCTGG + Exonic
908490583 1:64639999-64640021 AGGCAAGGAACAGAGGCCCCTGG - Intronic
908849868 1:68364889-68364911 TCCACAGGGACAGAGGCTCCTGG - Intergenic
908927186 1:69270000-69270022 AGCCTAGGGACTGGGGCACCTGG - Intergenic
910684459 1:89902071-89902093 AGGCCAGGGAGAGAGGCACAAGG + Intronic
910702217 1:90088356-90088378 AGCCCAGGAACAGTGGCACAGGG + Intergenic
910793049 1:91070796-91070818 AGCCCAGGGGCAGAGAACCTGGG + Intergenic
912561572 1:110555336-110555358 AGGCCAGGGAGCGAGGACCCAGG - Intergenic
913054549 1:115145438-115145460 ACTCCAGGGACAGAGCCCTCTGG - Intergenic
913099023 1:115546127-115546149 AGCCCAAGCAGAGAGGCCCCCGG + Intergenic
914902460 1:151718124-151718146 AGCTCAGGAATGGAGGCCCCTGG - Intronic
915281842 1:154828114-154828136 AGCTCTGGAACAGAGGCCCAGGG + Intronic
915593402 1:156883079-156883101 AGCCCAGGGACAGATGCAGAGGG + Intergenic
917512339 1:175678807-175678829 AGGGCAGGGCCACAGGCCCCAGG - Intronic
918341682 1:183573072-183573094 ATCCCAGGGACAGAGCCACAAGG + Intronic
918352948 1:183676684-183676706 ACTCCAGAGCCAGAGGCCCCTGG + Intronic
919850310 1:201667977-201667999 AGGCCATGGCCATAGGCCCCAGG + Intronic
919887649 1:201946531-201946553 AGCCCAGGGCTAGTGGACCCCGG + Exonic
920035231 1:203061043-203061065 GGCCCAGGGACAAAGGCCAAGGG - Intronic
920098673 1:203502967-203502989 GGCTCAGGGGCAAAGGCCCCGGG - Exonic
920182887 1:204143429-204143451 AGAGCAGGGAGGGAGGCCCCGGG - Intronic
920954636 1:210607143-210607165 GGCCCAGGCATAGAGGCACCAGG - Intronic
921024032 1:211260465-211260487 AGTCCAGGGTCCGAGGCCGCGGG + Intronic
921316648 1:213898010-213898032 AGCCCAGGGACCCAGGCAACAGG + Intergenic
922725198 1:227919604-227919626 AGCCCAGGGCGAGAGGCTCTGGG + Exonic
922850094 1:228725409-228725431 AGCTCAGGGCCACAGCCCCCAGG - Intergenic
922884077 1:229004623-229004645 AGCCAAGGGACAGAGACCTCTGG - Intergenic
923024449 1:230193904-230193926 AGCATAGGCACTGAGGCCCCGGG - Intronic
923257233 1:232232509-232232531 AGCCCTGGGCCAGAGTTCCCGGG + Intergenic
924457697 1:244231451-244231473 AGCCCATGAGAAGAGGCCCCAGG + Intergenic
924776141 1:247115367-247115389 ATCCCAGTGACAGAGATCCCTGG - Intergenic
924800321 1:247325103-247325125 AGGCCAGGGACACTGGCCTCTGG - Intronic
1063126764 10:3142723-3142745 AGCTCAGGGAAGGAGGCCCTGGG - Intronic
1063222025 10:3977910-3977932 ATTCCAGGGAGAGAGGCCACTGG - Intergenic
1064246022 10:13668313-13668335 AGCTCAGGAACAGCTGCCCCAGG - Intronic
1064339727 10:14475157-14475179 AGGCCAAGGAGAGAGGCCTCAGG + Intergenic
1065818842 10:29506817-29506839 AGGGAAGGGACAGAGGCCCTAGG + Intronic
1065818850 10:29506840-29506862 AGGGAAGGGACAGAGGCCCTAGG + Intronic
1065921579 10:30397989-30398011 AGCCCAGGGACACTGCACCCTGG - Intergenic
1065963865 10:30755041-30755063 AGCACAGGGATGGAGGCACCAGG - Intergenic
1066096421 10:32076676-32076698 AGCCCAGGGAGAGATGCCGAGGG - Intergenic
1067518147 10:46972994-46973016 AGGCCAAGGAGAGAGGCCTCAGG + Intronic
1067644102 10:48078834-48078856 AGGCCAAGGAGAGAGGCCTCAGG - Intergenic
1069638192 10:69938240-69938262 TGCCCAGAGCCAGAAGCCCCAGG + Intronic
1069681355 10:70287887-70287909 AAGCCAAGGACAGAGGCCTCAGG + Intergenic
1069950348 10:72014393-72014415 AGCACGGGGACAGTGGCTCCTGG + Intergenic
1070307368 10:75247790-75247812 AGCCCAGGGACAGAAGATCTAGG - Intergenic
1071290478 10:84185412-84185434 GGAGCAGGGACAGAGGCCCTGGG + Intergenic
1071830042 10:89362576-89362598 AGCCCAGGCAAAGTTGCCCCAGG - Intronic
1073188180 10:101629983-101630005 AGCCCAGGCTCAGAGGCTGCTGG - Intronic
1073435703 10:103514488-103514510 AGCCCAGGGGCAGATGGCCCAGG - Intronic
1073815615 10:107203162-107203184 AACCAAGAGACAGAGGCACCAGG - Intergenic
1074015579 10:109530551-109530573 CGCACAGGGACAGAGGACCTGGG + Intergenic
1074116419 10:110460338-110460360 AGCCCAGGGCCTCAGGCCTCAGG + Intergenic
1074143989 10:110700644-110700666 AGGACAGTGACAGAGGCCCCAGG + Intronic
1075092330 10:119450817-119450839 ATGCCAGGAACAGAGGCCCTGGG - Intronic
1075410293 10:122222729-122222751 CGCCCGGGGCCACAGGCCCCTGG + Intronic
1075728682 10:124623549-124623571 AGCGCAGGGACAGAGGACTGCGG - Exonic
1075820277 10:125302087-125302109 AAGCCAAGGATAGAGGCCCCAGG + Intergenic
1075963383 10:126588198-126588220 CTCCCTGGGACAGAGTCCCCAGG + Intronic
1076019458 10:127060085-127060107 ACGCCAGGGAGAGAGTCCCCAGG - Intronic
1076070605 10:127485308-127485330 GGCCCAGGGACAGAGGCAGGAGG - Intergenic
1076118323 10:127916684-127916706 AGCCCAGGGACAGAGGGGATGGG + Intronic
1076300232 10:129419975-129419997 AAGCAAGGGACAGAGGTCCCAGG - Intergenic
1076430585 10:130399183-130399205 AGCCCAGGGCCAGTGGCACCAGG - Intergenic
1076608042 10:131701975-131701997 AGCCCAGTGACACTGGCCCTTGG + Intergenic
1076676906 10:132151809-132151831 AGCCCAGGGACAGAGGAGGTTGG + Intronic
1076796888 10:132802812-132802834 GGCCCAGGGAGAGAGGCACAGGG + Intergenic
1077039112 11:510245-510267 ACCCCGGGGAGAGAGGCACCAGG + Intergenic
1077211080 11:1371250-1371272 AGGCCTACGACAGAGGCCCCGGG - Intergenic
1077458137 11:2693311-2693333 AGGGCAGGGAGAGAGGGCCCAGG - Intronic
1078090526 11:8262138-8262160 GCCCCAGGGACAGAGGGCTCAGG + Intronic
1079008564 11:16810118-16810140 AGCCCCGGGAATGGGGCCCCTGG + Intronic
1079083840 11:17431485-17431507 AGCTCAGGGACACTGGCCCCGGG + Intronic
1080909709 11:36583294-36583316 AACCCAGGTCCAGAGGCCTCCGG - Intronic
1081991620 11:47341075-47341097 GGCCCAGTGACAGGGGCTCCTGG + Intronic
1082650579 11:55787039-55787061 AGACCAGGAACAGAGGAACCTGG - Intergenic
1083399089 11:62411571-62411593 TGCCCAGGCACAGAGGGACCTGG - Intronic
1083433881 11:62629749-62629771 AGCCCAGAGACTGAGGGCCTAGG - Intronic
1083727950 11:64638080-64638102 AGACCAGGGAAGGCGGCCCCAGG + Intronic
1083840589 11:65302054-65302076 TGCCCAGGCAAAGGGGCCCCTGG + Intronic
1083943684 11:65912165-65912187 GGACCAGGGACAGAGCTCCCTGG + Intergenic
1084149370 11:67281025-67281047 AGCCCTGGGGCAGAGGCACCTGG - Intronic
1084178358 11:67434878-67434900 TGCCCAGGCACACAGGCCGCGGG - Intronic
1084423869 11:69073759-69073781 AGGCCACGGAGAGAGGCCTCAGG - Intronic
1084544685 11:69809009-69809031 AGCCCAGGGTCAGAGTGTCCAGG - Intergenic
1084658978 11:70536103-70536125 AGCCCAGGGTGAGGGCCCCCAGG - Intronic
1084676467 11:70638299-70638321 CTCCCAGTGACAGAGGACCCAGG + Intronic
1084687736 11:70706935-70706957 AGCGCAGGATCAGAGGCCACTGG - Intronic
1085514626 11:77105145-77105167 AGCAGAGGGACTCAGGCCCCGGG - Intronic
1088556101 11:111062757-111062779 AGCCCAGAGACAGAGACTCTAGG - Intergenic
1089256351 11:117196337-117196359 AGCCAAAGGACAGGGGCCCATGG - Exonic
1090288113 11:125517571-125517593 AACCTAGGGAGAGAGGCGCCTGG + Intergenic
1090422578 11:126585661-126585683 TGCCAAGTGGCAGAGGCCCCGGG + Intronic
1090443496 11:126744092-126744114 AGCCAAGGGGCAGAGGGCCCAGG + Intronic
1090796072 11:130136568-130136590 AGCACTGGAACAGAGGCCTCAGG + Intronic
1090807261 11:130210240-130210262 AGCCCAGGCTCGGAGGACCCTGG + Exonic
1091280759 11:134380327-134380349 AGCCCAGGGACAGGGAGCCAGGG + Intronic
1091293671 11:134457358-134457380 AGCACAGAGACAGAGGCCTTAGG - Intergenic
1091293675 11:134457396-134457418 AGCACAGAGACAGAGGCCTTAGG - Intergenic
1091293680 11:134457434-134457456 AGCACAGAGACAGAGGCCTTAGG - Intergenic
1091293685 11:134457474-134457496 AGCACAGAGACAGAGGCCTTAGG - Intergenic
1091293705 11:134457626-134457648 AGCACAGAGACAGAGGCCTTAGG - Intergenic
1091293709 11:134457664-134457686 AGCACAGAGACAGAGGCCTTAGG - Intergenic
1091293714 11:134457702-134457724 AGCACAGAGACAGAGGCCTTAGG - Intergenic
1091293728 11:134457818-134457840 AGCACAGAGACAGAGGCCTTAGG - Intergenic
1091293733 11:134457856-134457878 AGCACAGAGACAGAGGCCTTAGG - Intergenic
1091293737 11:134457894-134457916 AGCACAGAGACAGAGGCCTTAGG - Intergenic
1091293753 11:134458008-134458030 AGCTCAGAGACAGAGGCCTTAGG - Intergenic
1091293759 11:134458046-134458068 AGCACAGAGACAGAGGCCTTAGG - Intergenic
1091293765 11:134458084-134458106 AGCACAGAGACAGAGGCCTTAGG - Intergenic
1091399906 12:175387-175409 TGCCCAAGGCCCGAGGCCCCGGG - Exonic
1091438756 12:496223-496245 AGCCCAGGGACCAAGGCTGCTGG - Intronic
1091447850 12:554137-554159 TCTCCAGGGACAGGGGCCCCGGG - Intronic
1091457361 12:617902-617924 TGCCCAGAGAAAGAGGCACCTGG - Intronic
1091915844 12:4271459-4271481 AGGCAAGGGACAGAGGCCGCCGG - Intergenic
1091976605 12:4830736-4830758 AGCCCAGGGACAGAGGCTGCAGG - Intronic
1093484826 12:19641390-19641412 AATCCAGGGACAGAGGCCTGGGG - Intronic
1096021133 12:48326540-48326562 AGCACAGGGACAGTGCACCCAGG - Intergenic
1096496365 12:52041626-52041648 AGCCTGGGGGCCGAGGCCCCAGG - Intronic
1096822161 12:54244921-54244943 AGCCCAGGATCACAGGCCCATGG + Intronic
1097184611 12:57189870-57189892 AGCTCTGGGACCGAGGACCCAGG + Intronic
1097503075 12:60431127-60431149 AGCCCAGAGACAGAGGACCCAGG - Intergenic
1097521750 12:60679234-60679256 AGCCCAGGAACAGAGCAACCAGG + Intergenic
1098443770 12:70545664-70545686 AGGCCAAGGACACAGGGCCCTGG + Intronic
1098927889 12:76372896-76372918 AGCCCAGGAACCCTGGCCCCAGG - Intronic
1101599572 12:106197465-106197487 GGCCCAGGGCAAGAGGCCCAAGG + Intergenic
1101939965 12:109092647-109092669 AGGCCCAGGAGAGAGGCCCCAGG - Exonic
1102146383 12:110658098-110658120 AGCCAAGGGAAAGTGGTCCCAGG - Intronic
1102204039 12:111078020-111078042 AGGACAGGGACAGAAACCCCAGG - Intronic
1102638417 12:114344888-114344910 TCCCCAGGGTCTGAGGCCCCTGG - Intergenic
1103178804 12:118889668-118889690 AGCCCACAGACACAGGCCCAAGG - Intergenic
1103719094 12:122964005-122964027 AGCCCAGGGAGGGAAGCTCCTGG + Intronic
1103926588 12:124426815-124426837 AGGGCAGGGTCAGAGGCCCAGGG + Intronic
1104737031 12:131141618-131141640 ATCCCTGGGACACAGGCTCCCGG - Intergenic
1104785524 12:131445877-131445899 AGCCCTGACACAGAGGCCTCTGG + Intergenic
1105291299 13:19055404-19055426 AGCCCAGTCTCAGTGGCCCCAGG + Intergenic
1106319823 13:28626801-28626823 ACCCCACAGCCAGAGGCCCCAGG - Intergenic
1107837423 13:44423074-44423096 AGCCCAGGAGCAGAGGGCCCAGG - Intergenic
1110616893 13:77551524-77551546 AGGCCAAGGAGAGAGGCCTCAGG - Intronic
1111180690 13:84660349-84660371 AACCCAGGAATAGTGGCCCCTGG - Intergenic
1111955924 13:94758450-94758472 GGCCCAGGGAGAGAGGACTCTGG - Intergenic
1112305275 13:98267771-98267793 GGCCCAGGATCAGAGGCCCCAGG - Intronic
1112478529 13:99753366-99753388 TGGAGAGGGACAGAGGCCCCAGG + Intronic
1113376263 13:109767211-109767233 GGCCCAGGGACAGAGGCCAGAGG + Intronic
1113521965 13:110947679-110947701 GGGCCAGGGACAGAAGCCACAGG + Intergenic
1113705926 13:112433017-112433039 GGGCCAGGGACAGAAGCCACAGG - Intronic
1113772482 13:112918924-112918946 AGCGCAGGGGCAGAGCCCACAGG - Intronic
1114496639 14:23137472-23137494 AGGCCAGACCCAGAGGCCCCAGG + Intronic
1114524315 14:23358932-23358954 AGCTCAGGGATCTAGGCCCCCGG - Exonic
1117475454 14:56090127-56090149 ATCCCAGCCACAAAGGCCCCTGG - Intergenic
1118822767 14:69355783-69355805 AGCCAAGTCACAGAGGCCCAGGG - Exonic
1119415730 14:74468015-74468037 AGCCCAGGGAAAGACGCCATTGG + Intergenic
1119731406 14:76953584-76953606 AGACCAGGAACAGTGGCCTCAGG + Intergenic
1119873697 14:78038231-78038253 AAGCCAGGGAGGGAGGCCCCAGG + Intergenic
1120157558 14:81110442-81110464 AAGCCAGGGAGAGAGGCCTCAGG + Intronic
1120688745 14:87568856-87568878 AGGCCAAGGAGAGAGGCCTCAGG - Intergenic
1121492285 14:94369188-94369210 AGATCAAGGGCAGAGGCCCCTGG + Intergenic
1121647138 14:95526153-95526175 GGCAAAGGCACAGAGGCCCCTGG - Intergenic
1122051679 14:99065282-99065304 AGCCTAGGGAAAGAGGCATCAGG - Intergenic
1122158355 14:99764697-99764719 AGCCCAGGCACAGAAGCAGCAGG + Intronic
1122632458 14:103113165-103113187 AGCTCAGGGACAGAGACCAGAGG - Intergenic
1122652635 14:103233820-103233842 AGGCCTGGGTCACAGGCCCCTGG - Intergenic
1122725375 14:103747145-103747167 TGCTCAGGAACAGAGGCGCCTGG + Intronic
1122804244 14:104248599-104248621 AGGCCAAGGAGAGAGGCCTCAGG - Intergenic
1122826845 14:104374696-104374718 GGCCCAGGAGGAGAGGCCCCTGG + Intergenic
1123000448 14:105291190-105291212 AGAGCAGGGCCAGAGGCCGCAGG + Intronic
1123470900 15:20551327-20551349 AACCCAGAGGCAGAGGCCGCGGG - Intergenic
1123647159 15:22449383-22449405 AACCCAGAGGCAGAGGCCGCGGG + Intergenic
1123731202 15:23146314-23146336 AACCCAGAGGCAGAGGCCGCGGG - Intergenic
1123749340 15:23343729-23343751 AACCCAGAGGCAGAGGCCGCGGG - Intergenic
1123764674 15:23466418-23466440 AACCCAGAGGCAGAGGCCGCGGG - Intergenic
1123931196 15:25172473-25172495 GGCCCAGGGACAGTGGGACCAGG - Intergenic
1123941817 15:25220333-25220355 GGCCCAAGAACAGAGGGCCCAGG - Intergenic
1124281711 15:28367615-28367637 AACCCAGAGGCAGAGGCCGCGGG - Intergenic
1124300992 15:28543993-28544015 AACCCAGAGGCAGAGGCCGCGGG + Intergenic
1125743857 15:41986051-41986073 AGCCAATGGACAGAGGCACTTGG + Intronic
1126521970 15:49605612-49605634 AGCCCATGGACCCAGGCTCCAGG - Intronic
1126667103 15:51085420-51085442 ACCCAAGGGAAGGAGGCCCCTGG + Intronic
1126949526 15:53865387-53865409 AAGCCAGGGAGAGAGGCCTCAGG - Intergenic
1128107273 15:65054306-65054328 ATCCAATGGACAGAAGCCCCAGG - Exonic
1129387626 15:75204443-75204465 AGTCCAGGGAGGGAGGCCCCAGG - Intronic
1129607580 15:77032373-77032395 AGCACGGGCACAGAGCCCCCCGG + Exonic
1129608875 15:77037885-77037907 AGCCCAGGCACGTTGGCCCCGGG + Intergenic
1129847099 15:78772997-78773019 AGGCCAAGGACAGGGGCCCAGGG + Intronic
1129922174 15:79328806-79328828 AGCCTGGGGGCAGAGGCCCCTGG + Intronic
1129923266 15:79339001-79339023 ATCACAGGGAGACAGGCCCCTGG - Intronic
1130254803 15:82320893-82320915 AGGCCAAGGACAGGGGCCCGGGG - Intergenic
1130257569 15:82332872-82332894 AGAACAGGAACTGAGGCCCCTGG + Intergenic
1130352870 15:83107338-83107360 CGCGCAGGGACAGGTGCCCCTGG - Intergenic
1130597373 15:85257092-85257114 AGAACAGGAACTGAGGCCCCTGG - Intergenic
1130600170 15:85269113-85269135 AGGCCAAGGACAGGGGCCCGGGG + Intergenic
1130901419 15:88209622-88209644 AGCCCAGGGTCAGAGCCGTCTGG + Intronic
1131855117 15:96585462-96585484 AGCTCAGCAGCAGAGGCCCCCGG - Intergenic
1132124694 15:99212613-99212635 AGCCCAGGGAGAAAGGCACTGGG + Intronic
1132670674 16:1101041-1101063 AGCCCAGGAGCAGGAGCCCCCGG - Intergenic
1132903989 16:2272786-2272808 AGACCAGGCCCAGAGTCCCCAGG - Intergenic
1132943288 16:2519059-2519081 AGCCCAGGGCAAGAGGACCCAGG - Intronic
1133059519 16:3165342-3165364 AGCCCTGGGACTGAGTCTCCTGG - Intergenic
1133116056 16:3578610-3578632 AGCCAAGGGACAGGGGTCCTGGG + Intergenic
1134030533 16:10988940-10988962 AGCCCAGGGAAGAAGGTCCCAGG - Intronic
1135974093 16:27095897-27095919 AAGCCAGGGAGAGAGGCCTCAGG - Intergenic
1135993707 16:27232729-27232751 CGCCCAGGGACTTGGGCCCCAGG - Intronic
1136233430 16:28900988-28901010 GGCCCAGGGCCAGAGGGCCCTGG + Intronic
1136377196 16:29872592-29872614 AGCCCAGGGTTTGAGGCCCAGGG - Intronic
1136458803 16:30397516-30397538 AGCCTCGGGACAGAGGCCCCCGG + Exonic
1136849299 16:33601126-33601148 AGCACAGGAACAGAGGCCGAGGG + Intergenic
1137760847 16:50939125-50939147 AGCCCAGGGAGAGGGGTCTCTGG + Intergenic
1138459372 16:57138897-57138919 AGCCAAGGGAGGGAGGCACCTGG + Intronic
1139157178 16:64457712-64457734 AGCCAAGGGAGTGAGGCCTCAGG - Intergenic
1139504532 16:67392392-67392414 AGCCCTGGGGCTGAGGCCCCTGG + Intronic
1139545268 16:67647009-67647031 GGCCCAGGGATATGGGCCCCGGG - Intronic
1140580296 16:76223550-76223572 AGCCTGGGGAGAGAGGCCCTGGG - Intergenic
1141069347 16:80939256-80939278 TGCACAGGGACTTAGGCCCCAGG + Intergenic
1141128800 16:81420450-81420472 AAGCCAGGGAGAGAGGCCTCAGG - Intergenic
1141515243 16:84539746-84539768 GGCCCAGGGAGAGAGGCCAGTGG + Intronic
1141641075 16:85341908-85341930 GGCCCAGGGACTGAGGCCATTGG - Intergenic
1141995697 16:87635242-87635264 GGGCCATGGACAGATGCCCCAGG - Intronic
1142009736 16:87707741-87707763 TGGCCCGGGGCAGAGGCCCCGGG + Intronic
1142132611 16:88437841-88437863 AGCGCCGGGACAGAAGGCCCGGG + Exonic
1142175313 16:88642540-88642562 CCCCCAGGAACAGAGGACCCTGG + Intergenic
1142178510 16:88656051-88656073 TGACTAGGGACAGAGGCCACCGG + Intronic
1142286200 16:89172471-89172493 AGCCCAGGAACAGAGCCCCCAGG - Intronic
1142420554 16:89967007-89967029 CTCCACGGGACAGAGGCCCCTGG + Exonic
1203111006 16_KI270728v1_random:1449776-1449798 AGCACAGGAACAGAGGCCGAGGG + Intergenic
1142604749 17:1075246-1075268 ACCCCAGGGACAGAGCATCCAGG - Intronic
1143369029 17:6426866-6426888 AGACCAAGGTCAGAGGCCGCTGG - Exonic
1143840550 17:9728281-9728303 AGCCGAGGGACAGGGCACCCCGG - Exonic
1144764443 17:17725026-17725048 GGCCCAGGGTCAGCAGCCCCAGG - Intronic
1145166246 17:20615054-20615076 CTCCACGGGACAGAGGCCCCTGG + Intergenic
1145208001 17:20994875-20994897 AGCCCAGGGGAGGAGGGCCCTGG - Intergenic
1145262923 17:21365396-21365418 TGCTCAGGGACAGAGGGTCCTGG + Intergenic
1145286134 17:21507107-21507129 AGCCCAGGGTCAGAGGTCAGGGG + Intergenic
1145391467 17:22459185-22459207 AGCCCAGGGTCAGAGGTCAGGGG - Intergenic
1145743327 17:27294273-27294295 GGCCCAGGGACAGAGGAGACGGG - Exonic
1146591470 17:34131494-34131516 AGCTCAGCCACAGAGGCTCCAGG + Intronic
1147191928 17:38742923-38742945 ACCCCAGCAACAGAGACCCCAGG - Intronic
1147312786 17:39605174-39605196 AGCCCCCGGAGAGAGGTCCCTGG + Exonic
1147322911 17:39656823-39656845 AGCCCACGGCCAGAGACCTCAGG - Intronic
1147421101 17:40322565-40322587 ACCCAGGGGACAGAGGCTCCGGG - Intronic
1147537806 17:41332351-41332373 AGCTCAGGGAGAGAAGGCCCAGG - Intergenic
1147538001 17:41333439-41333461 AGCTCAGGGACAGAAGTCCCAGG + Intergenic
1147989077 17:44322478-44322500 GGCACAGGTACAGAGGCTCCAGG + Exonic
1148074731 17:44928722-44928744 AACCCAGCAACTGAGGCCCCTGG + Intronic
1148075698 17:44934160-44934182 AACCCAGGGCCAAAGGCCACAGG - Intronic
1148440673 17:47710302-47710324 TGCCCAGGGACAGGGTCCCCAGG - Intronic
1148776173 17:50096796-50096818 GGCCCAGGGTCAGGGGCCCTGGG - Intronic
1148793031 17:50184252-50184274 AACCCGGGGACAGAGGACGCAGG + Exonic
1148858112 17:50590272-50590294 CACCCAGGGGCAGGGGCCCCAGG - Intronic
1149660460 17:58331846-58331868 AGGCCAGGGCCTGAGGCCCTGGG - Intergenic
1150133033 17:62679670-62679692 AGCCCAGATGGAGAGGCCCCAGG + Intronic
1151216685 17:72581956-72581978 GGCCCACAGACAGAGGCCCAGGG + Intergenic
1151343183 17:73484932-73484954 AGCCCAGGCACAGTGGCTCATGG - Intronic
1151438929 17:74115673-74115695 AGCCCATGGGCAGGGGCCCGTGG - Intergenic
1151508819 17:74545947-74545969 AGCTCAGGGAGAGAGCCGCCTGG + Exonic
1151677036 17:75603904-75603926 AGCACAGGGACAGAGGGAGCAGG + Intergenic
1152031146 17:77844188-77844210 AGCTCAGTGAGAGAGGCCACAGG + Intergenic
1152761250 17:82108109-82108131 AGCTCAGAGTCAGAGGCCACAGG + Intronic
1152779358 17:82219503-82219525 GGCCCAGGGAGCGAGGCCTCTGG - Intergenic
1153515073 18:5895124-5895146 AGCGCAGGGACAGCGCCCCGGGG + Exonic
1153766130 18:8376619-8376641 AGCCCAGGGACCAAGGCCCCAGG - Intronic
1153840314 18:9001457-9001479 AAGCCAAGGACAGAGGCCTCAGG + Intergenic
1155091476 18:22515400-22515422 CTCCCTGGGACAGAGGTCCCTGG - Intergenic
1155307936 18:24497617-24497639 AGCCCAGGGATTTAGGGCCCAGG - Intergenic
1156108374 18:33692975-33692997 AGGCCAAGGAGAGAGGCCTCAGG - Intronic
1156882131 18:42093392-42093414 AGCCAAGAGAGAAAGGCCCCAGG - Intergenic
1157562505 18:48658855-48658877 AGCCCAGGGCAAGTGGGCCCTGG + Intronic
1157584193 18:48790846-48790868 AGCCAGCTGACAGAGGCCCCAGG - Intronic
1158306216 18:56109077-56109099 AGCCGAGGGAGAGAGGAGCCAGG - Intergenic
1160009071 18:75089958-75089980 CGCAGAGGCACAGAGGCCCCGGG + Intergenic
1160540174 18:79616941-79616963 AACACAGGGACCGGGGCCCCCGG + Intergenic
1160581778 18:79887323-79887345 CGCCCTGGGCCAGAGGCCACGGG + Intronic
1160831988 19:1108471-1108493 CGTCCAGGGACAGCGGCGCCGGG + Exonic
1161134397 19:2611163-2611185 AGCCCAGGGATCCAGGGCCCTGG + Intronic
1161302330 19:3548668-3548690 CGGCCAGGCACAGAGTCCCCCGG + Intronic
1161560947 19:4972107-4972129 AAGCCAGGAACAGAGACCCCTGG - Intronic
1161697669 19:5778614-5778636 AGGGCAGGCACAGAGCCCCCGGG + Exonic
1161788883 19:6346657-6346679 AAGCCAAGGAGAGAGGCCCCAGG - Intergenic
1161861541 19:6801762-6801784 TGTGCAGGGACAGAGGCCTCTGG - Intronic
1162179888 19:8861146-8861168 ATCCTAGGGACAGAGACCACAGG + Exonic
1162501316 19:11055593-11055615 AGCCCAGGAAGTGAGACCCCAGG - Intronic
1162794137 19:13078050-13078072 AGAGCAGGGACAGAGGCCAGAGG - Intronic
1162818852 19:13210956-13210978 AGCCCAGGGCCAGGGGCTCGAGG - Intronic
1163111153 19:15161470-15161492 AGGCCAGGGAGGAAGGCCCCTGG + Exonic
1163268124 19:16233647-16233669 AGAACAGGGACAGAGGCCGCAGG + Intronic
1163382179 19:16976397-16976419 AGCCCAGAGACAGAGGTTGCAGG + Intronic
1163547748 19:17949675-17949697 AGCCCAGGGCCAGGGACCCCTGG - Intergenic
1163755398 19:19103691-19103713 AGCTGAGGGGCAGAGGGCCCGGG - Intronic
1163804861 19:19389565-19389587 AGCCCAGCAGCAGAGGGCCCAGG - Intronic
1164372195 19:27652523-27652545 AGCCCAGTGATAGAGACCCCTGG - Intergenic
1164426900 19:28149732-28149754 AGCTGAAGGACAGAGGGCCCTGG + Intergenic
1165247429 19:34505379-34505401 AGCCCTGTGACACATGCCCCAGG - Exonic
1165383210 19:35495403-35495425 AGCCCAGTCACTGAGGCACCGGG - Intronic
1165741345 19:38206990-38207012 AGCCCAGGTGCAGTGGCCTCTGG - Exonic
1165819538 19:38665824-38665846 AACCCGGGGAAAGAGCCCCCCGG - Intronic
1166276443 19:41757390-41757412 AGCCCTGGCACAGACTCCCCAGG - Intronic
1167044725 19:47042883-47042905 AGCCCGGGGCCAGAGCCCACAGG + Exonic
1167915235 19:52734934-52734956 GTCCCAGGGACAGAAGCCCTGGG + Intronic
1167991644 19:53365804-53365826 GTCCCAGGGACAGAAGCGCCGGG - Intronic
1168403154 19:56097771-56097793 ACCCCAGGGACAAAGCCACCTGG + Intronic
1168655570 19:58125211-58125233 AGCCCAAGGTCAGAGGGCTCAGG + Intergenic
925444393 2:3915355-3915377 AGCCCAAGCACAGTGGCCCAGGG + Intergenic
925532809 2:4883598-4883620 GGCCCTGGCCCAGAGGCCCCAGG - Intergenic
925900349 2:8504783-8504805 AGTCCAGGGAGAGAGGCCTTGGG - Intergenic
926125640 2:10270155-10270177 AACGCAGGGACAGGGGCACCAGG + Intergenic
926438209 2:12859089-12859111 AAGCCAAGGAGAGAGGCCCCAGG - Intergenic
926590344 2:14733978-14734000 AGGCCAGGGAGAGAGGCATCAGG - Intergenic
927249279 2:20983283-20983305 AGCCCAGGGTCACAGGTCACTGG + Intergenic
927341566 2:21989555-21989577 GGCCCAGGGACTGGGGACCCTGG - Intergenic
927458906 2:23280603-23280625 AGCCCAGGTGCAGAGGGCCTTGG + Intergenic
927809396 2:26173187-26173209 GGCCCCGGGACGGCGGCCCCGGG + Exonic
927877529 2:26668803-26668825 AGCCCAGGGATGTGGGCCCCAGG + Intergenic
928269993 2:29847304-29847326 AGCCCAGGTCCAGAGGTCCTGGG - Intronic
929450079 2:42030936-42030958 AGCCCAGGGACAGAGGCTTGAGG - Intergenic
929533261 2:42765144-42765166 GTCCCAGGCACAGTGGCCCCTGG + Intergenic
929575514 2:43049528-43049550 CGCCCAGGGACTGGGGCCCACGG - Intergenic
932420000 2:71596067-71596089 AGCCCAGTGTCTGAGGCCCCAGG + Intronic
932625561 2:73293341-73293363 AGCCCAGCGGGCGAGGCCCCGGG - Exonic
932750234 2:74366814-74366836 ATGCCAGGGACAGATGCTCCTGG - Exonic
934112381 2:88755971-88755993 ACTCCAGGGACAGAGACCTCAGG - Intergenic
934165130 2:89287321-89287343 AGCACAGGGGCAGTGTCCCCAGG + Intergenic
934202143 2:89895141-89895163 AGCACAGGGGCAGTGTCCCCAGG - Intergenic
934522225 2:95026569-95026591 ACCGCAGGTGCAGAGGCCCCGGG - Intronic
934661576 2:96146100-96146122 AGCCCAGGGGCCTGGGCCCCGGG - Intergenic
934735762 2:96689124-96689146 AGCCCAGAGTCAGGGGGCCCAGG + Intergenic
934751285 2:96795749-96795771 AGCCTAGGAAGAAAGGCCCCCGG - Intronic
935623068 2:105145280-105145302 AACACAGGGACAGAGCCCCAGGG + Intergenic
936086527 2:109473307-109473329 AGCCCAGGCACAGCTGCCCATGG - Intronic
936163597 2:110102432-110102454 ACTCCAGGGACAGAGACCTCAGG - Intronic
936255601 2:110908127-110908149 TGCCCAGGGACAAATCCCCCAGG - Intronic
936357168 2:111761695-111761717 AGCTCAGGCACAGTGGCCTCAGG - Intergenic
936840815 2:116765948-116765970 GGACCAGGAAAAGAGGCCCCTGG - Intergenic
937120573 2:119437605-119437627 AGACCAGGTGCAGAGGCCCCCGG - Exonic
937314023 2:120919732-120919754 AGCCAAGGGGCTGAGGGCCCTGG + Intronic
937854707 2:126663814-126663836 AGCCGAGGGAAGGAGGCCCCCGG - Intronic
938146543 2:128839225-128839247 AGCCCTGTCCCAGAGGCCCCAGG - Intergenic
938770837 2:134499467-134499489 AGCCCTGGAGCAGAGTCCCCAGG + Intronic
938835563 2:135100107-135100129 AGCCCAGGGAAAGTGGTCTCTGG - Intronic
938998236 2:136703379-136703401 TGCCCATGAACAGAGGCCCTGGG - Intergenic
939853595 2:147329890-147329912 ACCCCAGGGAAAAAGGACCCTGG - Intergenic
940605166 2:155914012-155914034 AAGCCAAGGACAGAGGCCTCAGG - Intergenic
941697479 2:168569158-168569180 AGGCCAGGGAAAGAAGGCCCTGG - Intronic
942678847 2:178455540-178455562 GGCCCAGGCACACAGGTCCCAGG + Intronic
942890227 2:180980181-180980203 TGCCCAGGTACTGGGGCCCCGGG + Intronic
943367620 2:186980999-186981021 AGCCCAGTGAGGGAGGCTCCTGG - Intergenic
943703743 2:191013958-191013980 CGCGCAGGGACAGAGTCCTCGGG - Intronic
943763228 2:191632179-191632201 GGCCCAGGAAAAGAGGCCCATGG + Intergenic
943953995 2:194162681-194162703 AACACAGGTACAGAGACCCCAGG + Intergenic
944268975 2:197760056-197760078 AGGCCTGGGACACAGGCTCCAGG - Intronic
944306038 2:198181049-198181071 AAGCCAGGGAGAGAGGCCTCCGG - Intronic
944614580 2:201447531-201447553 AGACCAAGGAGAGAGGCCTCAGG - Intronic
945251511 2:207769307-207769329 GACCCAGGGACGGAGGACCCAGG - Exonic
946878023 2:224149863-224149885 AGCCCGGGCTCAGAGGCCCTGGG - Intergenic
947521078 2:230846574-230846596 AAGCCAGGGAGAGAGGCCTCTGG - Intergenic
947832637 2:233152674-233152696 AACCCAGGGAAAGAGGCAACTGG + Intronic
947921430 2:233878213-233878235 AGCCCACTGACAGAGCTCCCAGG - Intergenic
948062623 2:235052778-235052800 AACCCAGGGACAGAGGGGCTCGG - Intronic
948712453 2:239833533-239833555 AGTCCAGGGAGAGATGGCCCTGG + Intergenic
948770346 2:240248519-240248541 AGCCCAGGGACTGATGCACTTGG - Intergenic
948823101 2:240560366-240560388 AGCCCAGTGCCACAGGCCGCGGG + Exonic
948872770 2:240812016-240812038 AGCCCTGAGCCAGGGGCCCCAGG + Intronic
948890934 2:240906809-240906831 AGCCTGGGGAGAGAGGGCCCAGG + Intergenic
948899637 2:240949797-240949819 AGCTCAGAGACATAGGCGCCTGG + Intronic
948903032 2:240965683-240965705 GGCCCATGGACAGCGGCTCCAGG + Intronic
1169065032 20:2690338-2690360 AGCCTAGGGACAGAGCCTCTTGG + Intergenic
1171448815 20:25222379-25222401 AGAACAGGAACAGAGGACCCCGG - Intronic
1171490047 20:25510433-25510455 GACCCAGGGGCAGAGGCCCGTGG - Intronic
1172013721 20:31861172-31861194 AGCCCAAGGACTAAGGCACCAGG + Exonic
1172094643 20:32454720-32454742 AGGGCAGGGACAGTGTCCCCAGG - Intronic
1172438540 20:34948358-34948380 AGCCCTGGGACAGAGGCAGAGGG - Intronic
1173079191 20:39849882-39849904 TGCCCAGGGCCGGAGGCTCCGGG - Intergenic
1173318899 20:41969983-41970005 GGCCCATGGAGAGGGGCCCCAGG + Intergenic
1173436179 20:43034071-43034093 AGCTCCAGGGCAGAGGCCCCCGG - Intronic
1173563299 20:44021473-44021495 TGCACAGGGACAGGGGCCTCAGG - Intronic
1173820080 20:46013985-46014007 AACCCAGGGGCAGAGGCGCTGGG - Intronic
1173928754 20:46800627-46800649 AGCCCAGGGACAGCTGACTCTGG + Intergenic
1174417498 20:50377097-50377119 TGCCCAGGGACAGATGAGCCGGG + Intergenic
1176111634 20:63413607-63413629 AGCCCTGGGCCAGAGACCCCCGG + Intronic
1176374035 21:6078343-6078365 AGCCCAGGGCCACACACCCCTGG + Intergenic
1178492060 21:33058692-33058714 AGCCCAGGGCAGGAGGCACCAGG + Intergenic
1178492714 21:33063413-33063435 AGCCCAGGGACAGAAGGGGCTGG + Intergenic
1178620414 21:34169294-34169316 AAGCCAGGGAGAGAGGCCTCAGG - Intergenic
1179047106 21:37855912-37855934 CTGTCAGGGACAGAGGCCCCTGG - Intronic
1179251402 21:39674142-39674164 ACCCCAAGGAGAGAGGCCTCAGG - Intergenic
1179285000 21:39969702-39969724 ATCCTGGGGGCAGAGGCCCCTGG + Intergenic
1179642653 21:42757612-42757634 AGACCAGGGACCGAGGCCTCCGG - Intronic
1179749442 21:43459900-43459922 AGCCCAGGGCCACACACCCCTGG - Intergenic
1179975401 21:44862718-44862740 AGCCCTGGGAAAGAAGGCCCAGG - Intronic
1180007485 21:45029574-45029596 GGCCCATGGTCAGAGTCCCCAGG - Intergenic
1180746146 22:18090400-18090422 AGCCAAGGCACAGAGGCCAAGGG - Exonic
1181027303 22:20133350-20133372 CGCCCAAGGACAGAGGCCCTGGG - Intronic
1182497310 22:30718656-30718678 TGCCCAGGGCCTGTGGCCCCAGG - Intronic
1182964852 22:34511348-34511370 AGCCAAAGGGCATAGGCCCCTGG - Intergenic
1183161586 22:36117191-36117213 AGCTCAGGCCCACAGGCCCCTGG - Intergenic
1183457463 22:37930455-37930477 AGCCCAGGGAGAGAGGCTCTCGG - Intronic
1184243216 22:43222423-43222445 AGCCCAGGGTCAGGGGACCGTGG - Intronic
1184254354 22:43278631-43278653 AGCCAATGGACAGAGACCCATGG - Intronic
1184649357 22:45912597-45912619 AGCCCAGGGCAAGTGGCCCCAGG + Intergenic
1184911780 22:47540139-47540161 TCCCCAGGGACAGAGGACCTAGG + Intergenic
1185047363 22:48535088-48535110 ATCCCAGGGTGAGAGGCCCCAGG - Intronic
1185062098 22:48612473-48612495 TGCCCAGGGACAGGGCCCCAGGG - Intronic
949530127 3:4947411-4947433 AGTTCAGAAACAGAGGCCCCAGG - Intergenic
949533332 3:4978259-4978281 GACCCAGGGACTGAGACCCCGGG - Intergenic
950612304 3:14134293-14134315 GGCCCAGGAACAGAGCCCCAGGG - Intronic
950861248 3:16149332-16149354 AGCCCAGGGAGGAAGGCCCCTGG - Intergenic
951587611 3:24231704-24231726 AGACCAGGAAAGGAGGCCCCGGG - Intronic
951755016 3:26081299-26081321 AAGCCAAGGAGAGAGGCCCCAGG + Intergenic
952117027 3:30195111-30195133 AACACAGGAACAGAGGCTCCAGG - Intergenic
952960090 3:38583554-38583576 AGCCCAGAGAGAGAGGAGCCAGG - Intronic
953738108 3:45513551-45513573 ACCTCAGGGATAGAGCCCCCAGG + Intronic
953901540 3:46846559-46846581 CACTCAGGGACACAGGCCCCGGG - Intergenic
954038129 3:47864213-47864235 AGGCCAGGTACAGTGGCCCTGGG - Intronic
954884437 3:53859481-53859503 AGCTCAGGCACAGAGTGCCCAGG - Intronic
954983869 3:54771862-54771884 AGCACATGGACAGAGACCACTGG - Intronic
955063608 3:55515742-55515764 CGCCCCAGGACAGACGCCCCAGG + Intronic
955098542 3:55823964-55823986 AGCCAAAGGAGAGAGGCCTCAGG - Intronic
955615788 3:60805366-60805388 AAGCCAGGGAGAGAGGCCTCAGG - Intronic
956745431 3:72307260-72307282 AGCCCAGGTACACAGTCCTCTGG - Intergenic
956753584 3:72364299-72364321 AAGCCAGGGAGAGAGGCCTCAGG - Intergenic
956762673 3:72457729-72457751 AACCCAAGGAGAGAGGCCTCAGG + Intergenic
959906548 3:111716967-111716989 AAGCCAAGGACAGAGGCCTCAGG + Intronic
960281662 3:115787225-115787247 AAGCCAGGGAGAGAGGCCTCAGG - Intergenic
960592406 3:119378683-119378705 AGCCAAGGGAGAGAAGCCCCGGG - Intronic
960843236 3:121981540-121981562 AGCCAAGGAAAAGAGGCCTCAGG + Intergenic
961481307 3:127182821-127182843 AGCCCAGCTACCAAGGCCCCCGG - Intergenic
961486660 3:127221803-127221825 CACACAGGCACAGAGGCCCCCGG + Intergenic
961635255 3:128329185-128329207 AGGGCAGAGACAGGGGCCCCAGG - Intronic
961707781 3:128802409-128802431 AGCACAGGAACAGAGGGCACAGG + Intronic
961742011 3:129039058-129039080 AGCAGAGGCACAGAAGCCCCAGG + Intronic
962288229 3:134106439-134106461 AGCCCAGGCAAAGGGGCCACAGG + Intronic
962307276 3:134299953-134299975 AGCAAAGGGCCAGAGGACCCAGG - Intergenic
963380011 3:144517073-144517095 AGCCCAGGCTCTGAGTCCCCTGG - Intergenic
964277040 3:155019916-155019938 AGCTCAGGGACAAAGGCCCCTGG - Intergenic
965522096 3:169678363-169678385 AGCTCAGAGGCAGAGGCACCAGG + Intergenic
965664564 3:171079059-171079081 GGCCCAGGAACTAAGGCCCCAGG - Intronic
966931387 3:184678018-184678040 AGCCCTGGGGCAAAAGCCCCGGG - Intronic
967744822 3:193043458-193043480 AAGCCAAGGACAGAGGCCTCAGG - Intergenic
967967643 3:194974737-194974759 AGCCCAGGGGCACAGGCACCAGG - Intergenic
968468927 4:768283-768305 AGACGAGAGGCAGAGGCCCCAGG - Exonic
968579883 4:1384942-1384964 AGCCCTGTGCCAGGGGCCCCAGG - Intronic
968610613 4:1555281-1555303 TGCCCAGGGACTGAGACCCTGGG + Intergenic
968644019 4:1729706-1729728 ATCACAGGGACACAGGCCTCTGG + Intronic
968703605 4:2067862-2067884 AGCCCAGGAACACAGGCCTGTGG - Exonic
968936525 4:3614011-3614033 AGCCCAGGGGCAGAGTCACTGGG - Intergenic
968953966 4:3708827-3708849 ACCCCAGGGTCAGAGGCTCCAGG - Intergenic
969359446 4:6653116-6653138 AAGCCAGGGAGAGAGGCCTCAGG + Intergenic
969468981 4:7375348-7375370 TGCCCAGAGACAGAGGCGCATGG - Intronic
969473153 4:7401678-7401700 GGCACAGGCACAGAGTCCCCTGG - Intronic
969569746 4:8001472-8001494 ACCCCGAGGACAGTGGCCCCAGG - Intronic
969575251 4:8032878-8032900 TTCCCAGAGAAAGAGGCCCCCGG + Intronic
969691233 4:8705334-8705356 AGCTCAGGCACTGGGGCCCCGGG + Intergenic
970480747 4:16471220-16471242 AAGCCAAGGAAAGAGGCCCCAGG - Intergenic
972788469 4:42348489-42348511 AAGCCAAGGACAGAGGCCTCAGG + Intergenic
973547770 4:51999102-51999124 AGGCCTGGGGCAGAGGCACCAGG + Intronic
973638929 4:52884761-52884783 AGCCCAAGGAGAGAGGCTTCTGG - Intronic
976366775 4:84241423-84241445 CGCCCAGAGACAGAGGCACCGGG - Intergenic
976758568 4:88523911-88523933 AGCCCCAGGGCAGAGGCCTCTGG + Intronic
977331198 4:95639826-95639848 TGCCCAGGGATAAAGGGCCCAGG + Intergenic
977728566 4:100325452-100325474 AGCTCAGTGACACAGACCCCTGG + Intergenic
979829750 4:125284870-125284892 AGCCCTGGGACGGAGACCCTGGG - Intergenic
980686749 4:136239786-136239808 GGCCCAGAGACAGAGGACTCGGG + Intergenic
982715940 4:158808042-158808064 GGCCCAGGGTTAGAGGCTCCTGG - Intronic
985615069 5:915376-915398 GGCCCTGGGGCAGAGGCTCCCGG + Intronic
985615099 5:915488-915510 GGCCCTGGGGCAGAGGCTCCCGG + Intronic
985615114 5:915544-915566 GGCCCTGGGGCAGAGGCTCCCGG + Intronic
985624971 5:980572-980594 CGCCCAGCCTCAGAGGCCCCCGG - Intronic
985789317 5:1916706-1916728 AGCTGAGGGACGGAGGTCCCAGG - Intergenic
986060741 5:4187925-4187947 TGGCCAGGGAGGGAGGCCCCAGG + Intergenic
986221198 5:5770520-5770542 TGGCCTGGGACTGAGGCCCCTGG - Intergenic
986976282 5:13398073-13398095 AAGCCAGGGAGAGAGGCCTCAGG + Intergenic
989434094 5:41391179-41391201 AGCCCAGGGACAGTGGACTGAGG + Intronic
989638022 5:43556871-43556893 AGCGCAGCGGCAGCGGCCCCTGG - Exonic
990331699 5:54733436-54733458 AGCGCAGGGAGAGAGAACCCAGG - Intergenic
991679950 5:69129086-69129108 AGGCCAGGCACAGTGGCCCAGGG - Intronic
992997097 5:82344830-82344852 AGACCAGGGAATGAGGACCCCGG - Intronic
993991234 5:94660800-94660822 CTGCCAGTGACAGAGGCCCCAGG + Intronic
997071975 5:130633193-130633215 TTCCCTGGGCCAGAGGCCCCAGG - Intergenic
997368366 5:133340128-133340150 GGCCCAGGGAGAGAAGCCCTGGG - Intronic
997673551 5:135695715-135695737 AGCCGGAGGACAGAGGCTCCTGG + Intergenic
997696046 5:135861946-135861968 TGCCAAGTGGCAGAGGCCCCAGG - Intronic
997741500 5:136258807-136258829 TGCCCTGGGACAGTAGCCCCTGG - Intronic
999099245 5:149008999-149009021 AGCCTAGGAACAGAAGCCCAAGG + Exonic
999375143 5:151081238-151081260 AGGCCCGGGACGGTGGCCCCAGG - Intronic
999447821 5:151654750-151654772 AGCCCAGGGCCAGGGTCACCTGG - Intergenic
999737558 5:154523972-154523994 AGTCCAGGGAGAGAGGCCCAGGG - Intergenic
1000560898 5:162788246-162788268 AGTCCAGGTACAGTGGCTCCTGG + Intergenic
1001413070 5:171524440-171524462 AGGCCAGGGGCAAAGCCCCCAGG + Intergenic
1001487882 5:172132807-172132829 AGCCTGGGGACTGAGGACCCAGG + Intronic
1002198303 5:177512971-177512993 AGGCCGGGGCCAGAGTCCCCAGG - Intronic
1002306431 5:178286506-178286528 GCCCCAGGGACAGCAGCCCCGGG + Intronic
1002416120 5:179121803-179121825 ACCCCAGGCAGAGAGGCTCCGGG + Intronic
1002516137 5:179760419-179760441 AGAGCAGGTGCAGAGGCCCCAGG + Intronic
1002839855 6:896301-896323 AGCCCAGGGATAGAGGAGCAGGG - Intergenic
1003122152 6:3327180-3327202 AGCCCAAGGCCAGTGGCCCCTGG - Intronic
1003274562 6:4638338-4638360 AAGCCGAGGACAGAGGCCCCAGG - Intergenic
1003392301 6:5724495-5724517 AGCCAAGGAACAGAGCCCCCAGG + Intronic
1004020512 6:11771870-11771892 AAGCCAAGGACAGAGGCCTCAGG + Intronic
1004078205 6:12364711-12364733 AAGCCAAGGAGAGAGGCCCCAGG - Intergenic
1004183161 6:13398039-13398061 AACCCAGCGGCAGAGGCTCCAGG - Intronic
1004310323 6:14539878-14539900 AAGCCAAGGAGAGAGGCCCCGGG + Intergenic
1004839668 6:19568851-19568873 AGTCCTGGGAGAGAGGCCTCTGG + Intergenic
1005755779 6:28923902-28923924 AGCCGAGGGTCAGAGTCCCAGGG + Exonic
1006164899 6:32058330-32058352 GAACCAGGCACAGAGGCCCCAGG - Intronic
1006276152 6:33007064-33007086 TCCCCAGGTGCAGAGGCCCCGGG - Exonic
1006380631 6:33695176-33695198 GGCCCAGGGCCAGAGGCCAGTGG - Intronic
1007071533 6:39041689-39041711 AGCTCAGGGACATATGCCACTGG + Intergenic
1007274391 6:40662770-40662792 AGCCCAGGTGGGGAGGCCCCAGG - Intergenic
1009740202 6:67734179-67734201 CTCCCTGGGACAGAGGCCCTGGG - Intergenic
1013940145 6:115651275-115651297 AGGCCAAGGACAGACGCCTCTGG - Intergenic
1014205503 6:118651545-118651567 AGCCCAGGCTCAAAGGCTCCAGG + Intronic
1016286103 6:142474642-142474664 AGCTAAGGAACAGAGGCACCGGG - Intergenic
1016450024 6:144172961-144172983 AGCCCAGGATCAGGGGCACCTGG - Intronic
1016683969 6:146860780-146860802 ACCCCAGGGACAGAAGCCAGTGG - Intergenic
1017656072 6:156631083-156631105 GGTCCAGGCACAGGGGCCCCTGG + Intergenic
1017664221 6:156703693-156703715 TGCCCAGGGACACAGGGCACAGG - Intergenic
1019144636 6:169968908-169968930 AGTCCAGGGACAGTGCCCACGGG - Intergenic
1019181134 6:170187840-170187862 AGCTCAGGGACAAGGGGCCCGGG - Intergenic
1019215462 6:170440134-170440156 CTCCCAGGAAGAGAGGCCCCAGG + Intergenic
1019275387 7:173058-173080 AGTCCGGGGAGAGAGGGCCCAGG + Intergenic
1019336402 7:484995-485017 ATCCCTTGCACAGAGGCCCCAGG + Intergenic
1019341840 7:512166-512188 AGGCCAGAGCCAGAGGCACCAGG + Intronic
1019423465 7:962526-962548 AGCCCAGGAACAGAGGTGCTGGG + Intronic
1019508714 7:1406433-1406455 AAGCCAGGGACAGAGGCCAGGGG - Intergenic
1019602809 7:1893692-1893714 AGGCCAGGGTCAGGGCCCCCAGG + Intronic
1019623268 7:2002866-2002888 ACCGCAGGGGCAGAGGCCCAGGG - Intronic
1019791208 7:3015054-3015076 AGGCCCGGGAGAGAGGCCTCAGG - Intronic
1022287156 7:28964514-28964536 GGCCCAGAGACGTAGGCCCCAGG - Intergenic
1022484838 7:30770522-30770544 AGGCCAGGGAGAGAGGCCTCAGG + Intronic
1022514023 7:30964145-30964167 AGCCCAGTGGCAGAGGCCAGAGG - Intronic
1022652973 7:32293986-32294008 AGCCCTGGCAGAGAGGCCCCCGG - Intronic
1022973334 7:35536545-35536567 GGGCCAGGGCCAGAGTCCCCAGG - Intergenic
1023354798 7:39355970-39355992 AGGCCAGGTCCACAGGCCCCTGG + Intronic
1023746757 7:43329252-43329274 AGCCCAGGGTCAGAGGTTCTAGG + Intronic
1023834267 7:44059215-44059237 AGTGCAGGAACAGAGGCCCCAGG - Intronic
1023844044 7:44111301-44111323 GGCCCAGTGACAGAAGCACCAGG - Intronic
1023879185 7:44308872-44308894 TGGCCATGGACAGAGGCCCCGGG - Intronic
1023907066 7:44530724-44530746 AGCCCTGTGACATAGCCCCCAGG + Intronic
1024248446 7:47488455-47488477 AGGCCCGGGAGAGAGGCCTCAGG - Intronic
1024658788 7:51473951-51473973 AGGCCCAGGACAGAGGCCTCAGG - Intergenic
1026709341 7:72723217-72723239 ACCCCAGGGACAGGGGACCAGGG - Intronic
1026866562 7:73827864-73827886 AGGGCAGGTACAGAGGCTCCAGG - Intronic
1026996326 7:74619290-74619312 GGCCCAGACACAGATGCCCCAGG + Intergenic
1029100790 7:98128416-98128438 AGGCCAAGGAGAGAGGCCTCAGG + Intronic
1029446352 7:100615045-100615067 TGGCCAGGGACCCAGGCCCCAGG + Intronic
1029599020 7:101553170-101553192 AGCCCAGGGCAGGAGTCCCCTGG + Intronic
1029711773 7:102303746-102303768 AGGGCAGGGACAGAAGCCCAGGG + Intronic
1032198817 7:129805058-129805080 GGCCCAGTGGCAGAGGCTCCTGG + Intergenic
1032841237 7:135714915-135714937 AGCGCAGGGCCAGAGACCGCTGG + Intronic
1033242218 7:139689885-139689907 AGGACAGGGACAAAGGCCTCAGG + Intronic
1033244812 7:139708654-139708676 TCCCCAGAGACAGAGGGCCCAGG - Intronic
1033510798 7:142058368-142058390 AACCCAGACACAGAGGCACCTGG - Intronic
1035056413 7:156039477-156039499 AGAGCAGGAACAGAGGCCACAGG - Intergenic
1035337337 7:158138353-158138375 AGCCCTGGGAGAGCGGCCCTGGG - Exonic
1035436789 7:158865447-158865469 AATCGAGGGACAGAGGCCCTGGG + Intronic
1036032801 8:4992029-4992051 AGCCCAGGGTCCCAGGCCCCTGG - Intronic
1036755867 8:11470768-11470790 AGCCCAGGGCCAGAGTCCACCGG + Intronic
1037531360 8:19777390-19777412 AACCCAAGGAGGGAGGCCCCAGG - Intergenic
1037834886 8:22209929-22209951 AGGCCTGGGTCAGAGGCCGCAGG - Intronic
1038334609 8:26636078-26636100 AGCCTAAGGACAGAGGCCCCAGG - Intronic
1038432453 8:27511054-27511076 AAGCCAGGGAGAGAGGCCTCAGG + Intronic
1038496785 8:28008932-28008954 AAACCAAGGACAGAGGCCACAGG + Intergenic
1038524500 8:28261455-28261477 AAGCCAGGGAGAGAGGCCTCAGG + Intergenic
1039848070 8:41340263-41340285 AGCCCAAGGACAGAGTCAGCCGG + Intergenic
1039967471 8:42293635-42293657 AGCCCAGGGACGGGGGACCCTGG + Intronic
1040890725 8:52313852-52313874 TGCCCAGAGAGAGAGGCCACTGG + Intronic
1044569473 8:93700808-93700830 AGCCCAAGGAATTAGGCCCCAGG - Intronic
1045029035 8:98117529-98117551 ACACCAGGGAGAGGGGCCCCGGG - Intronic
1047992720 8:130303099-130303121 AGCCTGGAGACAGAGGCTCCAGG + Intronic
1048295520 8:133210855-133210877 CGCCCAGAGAAAGGGGCCCCAGG + Intronic
1048311198 8:133323579-133323601 AGGCCAGAGACACCGGCCCCAGG - Intergenic
1048873272 8:138816189-138816211 AGGCCAGGGACAGAGCACACTGG + Intronic
1048897243 8:139003155-139003177 AGCCCACTGACAGAGGCTGCAGG + Intergenic
1049240711 8:141536165-141536187 CGCCCAGGGAGAGAGGCCTCAGG + Intergenic
1049266500 8:141670581-141670603 AGCCCCGAGGCAGAGGCTCCTGG + Intergenic
1049352778 8:142172941-142172963 ACGCCAAGGAGAGAGGCCCCAGG + Intergenic
1049404889 8:142447905-142447927 TGCCCAGAGACACAGGCCACAGG - Intergenic
1049417857 8:142503738-142503760 GGCAGAGGCACAGAGGCCCCAGG - Intronic
1049431699 8:142568332-142568354 AAGCCAAGGAGAGAGGCCCCAGG + Intergenic
1049468558 8:142764819-142764841 AGCTGAGGGTCAGACGCCCCAGG + Intronic
1049498172 8:142946450-142946472 GTGCCAAGGACAGAGGCCCCAGG - Intergenic
1049519844 8:143082530-143082552 AGCCCAGGAACAGCAGCGCCTGG - Exonic
1049578414 8:143400126-143400148 AGCCCTAGAAGAGAGGCCCCTGG + Intergenic
1049643592 8:143726445-143726467 GGCCCAGTGACAGACGCCGCGGG + Exonic
1049690522 8:143956974-143956996 AGCACAGGAAGAGAGGCCACAGG + Intronic
1049749484 8:144276540-144276562 AGCCCAGGGACAGAGGCCCCGGG - Intronic
1051603476 9:18897220-18897242 CTCCCTGGGACAGAGCCCCCGGG + Intronic
1052995136 9:34547870-34547892 AGCCCAGAGCCACAGGACCCTGG - Intergenic
1053290886 9:36879099-36879121 TGCCCAAGGACAGAGTCCCATGG + Intronic
1053303225 9:36966318-36966340 TGGCCAGCGACAGAGGCACCAGG + Intronic
1053307407 9:36994339-36994361 AGTCCAGGCACAGAGGGCGCAGG - Intronic
1055129054 9:72753800-72753822 TGCCCAGGGACACAGGACCTTGG - Intronic
1055701944 9:78954344-78954366 ACCCCAGGGACAGCTTCCCCCGG + Intergenic
1056442487 9:86634702-86634724 AAGCCAGGGAGAGAGGCCTCGGG - Intergenic
1057062055 9:92013007-92013029 AAGCCAAGGAGAGAGGCCCCAGG + Intergenic
1057063512 9:92026601-92026623 AGGCCCGGGTCAGGGGCCCCAGG + Intergenic
1057170011 9:92956561-92956583 AAGCCAGGGAGAGAGGCCTCAGG + Intronic
1057215186 9:93224008-93224030 TGGCCCAGGACAGAGGCCCCAGG - Intronic
1057264184 9:93603249-93603271 ACCCCAGGGTCAGAGGCACTCGG + Intronic
1058007806 9:99938233-99938255 AGCACAGGGAGAGAGAGCCCTGG - Intronic
1059329141 9:113524165-113524187 AGCCCAGGAACAGAGGCCACTGG - Intronic
1059351960 9:113671915-113671937 AGCCCAGGCCAAGAGACCCCGGG + Intergenic
1060221212 9:121765030-121765052 AGCCCAGGGGCTAAGGCCCTGGG - Intronic
1060236633 9:121868240-121868262 AGCTTAGTGACAGAGGCCCCAGG - Intronic
1060416322 9:123433101-123433123 AGCGCTGGCACACAGGCCCCTGG - Intronic
1060661436 9:125407563-125407585 ACACCAGGGAAAGAGGCCCTTGG - Intergenic
1061010300 9:127950692-127950714 GACCCAAGGACAGAGGCCCCGGG + Intronic
1061633516 9:131889847-131889869 AGCACAGCCACAGAGGCCCTGGG - Intronic
1061800808 9:133112626-133112648 TCCCCAGGGCCAGAGGCCCATGG + Intronic
1061996029 9:134186493-134186515 GGCGCTGGGACAGTGGCCCCGGG + Intergenic
1062004892 9:134234141-134234163 AGCCCAGGGAAAGGGGACCCCGG - Intergenic
1062032041 9:134366133-134366155 AGCCAAGGCTCAGAGGCACCAGG + Intronic
1062195096 9:135268707-135268729 AGAATAGGGACAGAGGGCCCTGG + Intergenic
1062464297 9:136674366-136674388 AGCCCAGGGGCACAGGCTGCGGG - Intronic
1185700213 X:2225999-2226021 AACCCAAGGAGAGAGGCCTCGGG + Intronic
1185704770 X:2258553-2258575 AACCCAAGGAGAGAGGCCTCAGG + Intronic
1186022579 X:5272516-5272538 AAGCCAAGGAGAGAGGCCCCAGG + Intergenic
1186057912 X:5671128-5671150 AAGCCAGGGAGAGAGGCCTCAGG + Intergenic
1186112158 X:6269960-6269982 AAGCCAAGGAGAGAGGCCCCAGG - Intergenic
1187562804 X:20418535-20418557 GGGCCAGAGAAAGAGGCCCCTGG - Intergenic
1189296719 X:39923644-39923666 AAACCTGGGACAGAGGGCCCAGG - Intergenic
1190418074 X:50200390-50200412 ACCCCAGGGTCAGAGGCAGCAGG - Intronic
1191111093 X:56803523-56803545 GGCCCAGGGACAGAGCAGCCAGG - Intergenic
1192175014 X:68879996-68880018 GGACCAGGGAAAGAGGCCCCTGG - Intergenic
1193970162 X:88040201-88040223 GGCCCAAGGACTGATGCCCCTGG + Intergenic
1196389032 X:115190186-115190208 AGCGCAGGGACAAAATCCCCAGG - Exonic
1198052096 X:132959664-132959686 TGCCCAGGGACAGATTTCCCAGG - Intronic
1199608144 X:149592920-149592942 GGCCCAGGGACAGCGGCCACCGG + Exonic
1199630976 X:149776440-149776462 GGCCCAGGGACAGCGGCCACCGG - Exonic
1200052859 X:153444115-153444137 AGAGCAGGGACAGAGACTCCAGG + Intergenic
1200156989 X:153982106-153982128 AGCCACGGCACAGAGGCCACCGG - Exonic
1200234029 X:154459691-154459713 AGCCCTGGGACAGAGGTCTGGGG - Intronic
1200251669 X:154557353-154557375 AGGACAGGCACAGAGGCCCGCGG - Intronic
1200253876 X:154569037-154569059 AGGACAGGCACAGAGGCCCGCGG - Intergenic
1200263893 X:154635371-154635393 AGGACAGGCACAGAGGCCCGCGG + Intergenic
1200266098 X:154647063-154647085 AGGACAGGCACAGAGGCCCGCGG + Intergenic
1200725555 Y:6664999-6665021 AGCCCAAGCACTGAGGCCACTGG + Intergenic
1200955164 Y:8937411-8937433 AGCACAAGGACAGAGGCGGCAGG + Intergenic
1201299825 Y:12495942-12495964 AACCCAAGGAGAGAGGCCTCAGG - Intergenic
1201707183 Y:16950117-16950139 ATCCCTGGGACAGAGGACCTGGG + Intergenic
1202233304 Y:22678655-22678677 AGCGCAAGGACAGAGGCGGCAGG + Intergenic
1202309852 Y:23517503-23517525 AGCGCAAGGACAGAGGCGGCAGG - Intergenic
1202560949 Y:26153090-26153112 AGCGCAAGGACAGAGGCGGCAGG + Intergenic