ID: 1049749485

View in Genome Browser
Species Human (GRCh38)
Location 8:144276541-144276563
Sequence CAGCCCAGGGACAGAGGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 940
Summary {0: 1, 1: 0, 2: 5, 3: 82, 4: 852}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049749485_1049749493 11 Left 1049749485 8:144276541-144276563 CCGGGGCCTCTGTCCCTGGGCTG 0: 1
1: 0
2: 5
3: 82
4: 852
Right 1049749493 8:144276575-144276597 AGGCTAGACACGGAAGCCACTGG No data
1049749485_1049749496 21 Left 1049749485 8:144276541-144276563 CCGGGGCCTCTGTCCCTGGGCTG 0: 1
1: 0
2: 5
3: 82
4: 852
Right 1049749496 8:144276585-144276607 CGGAAGCCACTGGGGCAGTCAGG No data
1049749485_1049749494 12 Left 1049749485 8:144276541-144276563 CCGGGGCCTCTGTCCCTGGGCTG 0: 1
1: 0
2: 5
3: 82
4: 852
Right 1049749494 8:144276576-144276598 GGCTAGACACGGAAGCCACTGGG No data
1049749485_1049749492 1 Left 1049749485 8:144276541-144276563 CCGGGGCCTCTGTCCCTGGGCTG 0: 1
1: 0
2: 5
3: 82
4: 852
Right 1049749492 8:144276565-144276587 CACGGGTGTCAGGCTAGACACGG No data
1049749485_1049749491 -9 Left 1049749485 8:144276541-144276563 CCGGGGCCTCTGTCCCTGGGCTG 0: 1
1: 0
2: 5
3: 82
4: 852
Right 1049749491 8:144276555-144276577 CCTGGGCTGACACGGGTGTCAGG No data
1049749485_1049749495 13 Left 1049749485 8:144276541-144276563 CCGGGGCCTCTGTCCCTGGGCTG 0: 1
1: 0
2: 5
3: 82
4: 852
Right 1049749495 8:144276577-144276599 GCTAGACACGGAAGCCACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049749485 Original CRISPR CAGCCCAGGGACAGAGGCCC CGG (reversed) Intronic
900185496 1:1331363-1331385 GAGCCCAGAGGCTGAGGCCCAGG - Exonic
900341314 1:2190634-2190656 CAGCCCCGGGACATCGTCCCCGG - Intronic
900495362 1:2973699-2973721 CTTCCCAGGCACAGAGGGCCAGG + Intergenic
900556036 1:3281013-3281035 CCACCCAGGGAAGGAGGCCCAGG - Intronic
900611404 1:3546093-3546115 CACCCCAGGGTCAGATGCCAGGG + Intronic
900906440 1:5562908-5562930 CAGCCATGGCTCAGAGGCCCAGG - Intergenic
900926536 1:5709674-5709696 CAGCAGAGAGACAGAAGCCCAGG - Intergenic
901145217 1:7060268-7060290 CAGGCCAAGGAGAGAGGCCTCGG - Intronic
901444949 1:9302518-9302540 CAGCTCCGGGACAGAGAGCCAGG - Intronic
901445179 1:9304110-9304132 CAGCTCCGGGACAGAGAGCCAGG - Intronic
901445204 1:9304215-9304237 CAGCCCCGGGCCAAAGACCCCGG - Intronic
901856632 1:12048557-12048579 GAGCCCAGGCACAGAGGACACGG + Intergenic
901924088 1:12554957-12554979 CACCCCAGGGAGAGAGTCCCTGG + Intergenic
902271194 1:15306518-15306540 CATCACAGGCCCAGAGGCCCAGG + Intronic
902304053 1:15524039-15524061 CAGCGCGGGGACAGGGGGCCGGG + Intronic
902396772 1:16136217-16136239 GAGCACAGGGCCAGAGCCCCAGG + Intronic
902477004 1:16693613-16693635 CGGCCCAGGCAAAGCGGCCCCGG + Intergenic
902542134 1:17163019-17163041 CAGGCTTGGTACAGAGGCCCCGG - Intergenic
902653496 1:17852183-17852205 CAGCCCAGGGACACCAGGCCTGG + Intergenic
902698203 1:18154571-18154593 CATCCCAGGCAAGGAGGCCCAGG + Intronic
902772815 1:18655563-18655585 CAGCCCTGAGCCACAGGCCCCGG - Intronic
902956094 1:19924875-19924897 CAGCCGGAGGATAGAGGCCCGGG + Intergenic
902978920 1:20109371-20109393 CAGCCCAGGGACAAAGTGACAGG - Intergenic
902984900 1:20149304-20149326 CAGCCCAGGGAGAGAGGGTGTGG - Exonic
902984927 1:20149398-20149420 CAGCCCAGGGAGAGAGGGTGTGG - Exonic
903354692 1:22739495-22739517 CAGGCCAGGCACAGTGGCTCAGG - Intronic
903743150 1:25570015-25570037 CAGCTGAGGGGCAGAGGCCTGGG - Intergenic
903764892 1:25727780-25727802 CTGGCCAGGGCCAGGGGCCCAGG - Intronic
903884976 1:26535820-26535842 CAGCCCTGGGAGGTAGGCCCTGG - Intronic
904213654 1:28902633-28902655 CAGGCCAGGCATAGAGACCCAGG - Intronic
904386208 1:30143722-30143744 CATCACAGGCCCAGAGGCCCAGG - Intergenic
904572087 1:31473690-31473712 CATCACAGGCCCAGAGGCCCAGG - Intergenic
904889800 1:33771242-33771264 AAGCCCAGGGACAGGTGCACGGG - Intronic
904893618 1:33797812-33797834 CAGCCCTGGGGCAGAGGACACGG + Intronic
905260269 1:36712310-36712332 AAGCCCAGGGACAGAGAGTCTGG + Intergenic
905543605 1:38780030-38780052 CAGACCTGGGACCTAGGCCCAGG - Intergenic
905627899 1:39500399-39500421 CAGCTAAGGGGCAGAGGCCAGGG + Intronic
905776825 1:40673333-40673355 CATTCCAGGAACAAAGGCCCAGG + Intergenic
905806065 1:40878408-40878430 CAGGCCAGGCACAGTGGCTCAGG - Intergenic
905885039 1:41487223-41487245 GAGGCAACGGACAGAGGCCCAGG - Intergenic
905922757 1:41730260-41730282 CAGGTGAGGGGCAGAGGCCCAGG - Intronic
905935676 1:41822198-41822220 CAACATAGGGAGAGAGGCCCTGG - Intronic
906020751 1:42627550-42627572 CATCACAGGCACAGAGGCCCAGG + Intronic
906317708 1:44799142-44799164 AGGGCCAGAGACAGAGGCCCAGG - Intergenic
906728269 1:48059770-48059792 CATACCAGGGACAAAGGACCAGG - Intergenic
907415823 1:54313185-54313207 CAGGCCAGAGACAGCTGCCCAGG + Intronic
907563886 1:55416667-55416689 CAGGCCAGGCACAGTGGCCCAGG - Intergenic
907957513 1:59244295-59244317 CAGGCCAAGGAGAGAGGCCTCGG - Intergenic
907999938 1:59669887-59669909 CAGCCCAGGGATGTAGGGCCTGG - Intronic
908355499 1:63322709-63322731 CACGCCAGGGCCAGAGGCCGAGG + Intergenic
910123895 1:83819523-83819545 CATCACAGGCCCAGAGGCCCAGG + Intergenic
910285932 1:85553955-85553977 CAGGGCAGGCACAGAGGCCTGGG - Intronic
910702216 1:90088355-90088377 AAGCCCAGGAACAGTGGCACAGG + Intergenic
910793048 1:91070795-91070817 GAGCCCAGGGGCAGAGAACCTGG + Intergenic
912263622 1:108132597-108132619 CATCACAGGCCCAGAGGCCCAGG - Intergenic
912661196 1:111532490-111532512 CAGCCCAGGGACTGAGTCTCTGG - Intronic
913183329 1:116343814-116343836 CAGCCAGGGGCCAGAGGCCCAGG - Intergenic
913320244 1:117582833-117582855 CAGCCCAGGGTCAGAGGGCTGGG + Intergenic
913443482 1:118924858-118924880 CAGAGAAGGGACAGAGGCCCAGG + Intronic
913458959 1:119063535-119063557 CATCACAGGTCCAGAGGCCCAGG + Intronic
913994769 1:143643060-143643082 CAGCGCAGGGAAAGTAGCCCCGG + Intergenic
914846465 1:151286491-151286513 CAGGCCATGGTCAGAGGCCTGGG - Exonic
915281841 1:154828113-154828135 CAGCTCTGGAACAGAGGCCCAGG + Intronic
915382325 1:155453071-155453093 CAGGCCAGGCACAGTGGCTCAGG + Intronic
915445234 1:155970772-155970794 CAGTGCAGGGACAGAGGGCATGG + Intronic
915496283 1:156284927-156284949 GAGTCAAGGGACACAGGCCCTGG - Intronic
915593401 1:156883078-156883100 GAGCCCAGGGACAGATGCAGAGG + Intergenic
915601480 1:156925321-156925343 CAGTACAGGGCCAGAGCCCCAGG - Intronic
918045947 1:180941158-180941180 CAGCCCTGGGCCAGAGTTCCCGG + Exonic
918072156 1:181141093-181141115 CATCCCATGGCCAGAAGCCCAGG - Intergenic
918119836 1:181529046-181529068 CATCACAGGCCCAGAGGCCCAGG + Intronic
918314973 1:183316053-183316075 CAGCCCAAGAACAGAGGTCCTGG - Intronic
918394718 1:184101802-184101824 CAGCCCTGAGAGAGAGGTCCAGG - Intergenic
918420032 1:184354806-184354828 CAGGCCAGGCACAGTGGCTCAGG - Intergenic
919177246 1:194033873-194033895 AATCACAGGGCCAGAGGCCCAGG - Intergenic
919200365 1:194348701-194348723 CATCACAGGCCCAGAGGCCCAGG + Intergenic
919767602 1:201137218-201137240 CAGCCCAGGAACAGAACCCAGGG - Intronic
919777806 1:201205595-201205617 CAGCCTTGGGACAGTGGCCCAGG + Intronic
919797926 1:201332401-201332423 CAGGCCTGGGTCAGAGGCCCGGG - Exonic
919880086 1:201895418-201895440 CAGCACTGGGACCTAGGCCCTGG - Intergenic
920035232 1:203061044-203061066 AGGCCCAGGGACAAAGGCCAAGG - Intronic
920182888 1:204143430-204143452 CAGAGCAGGGAGGGAGGCCCCGG - Intronic
920249837 1:204616242-204616264 CAGACCAGGGACAGAGCATCAGG - Intergenic
920646306 1:207806701-207806723 CAGTCCAGGCACGGGGGCCCTGG + Intergenic
921314295 1:213875806-213875828 CAGCGCAGGGATACAGGGCCTGG + Intergenic
922176719 1:223202892-223202914 GAGCCCTGAGCCAGAGGCCCGGG - Intergenic
922466217 1:225846876-225846898 CAGCCAAGGGCCTGAGCCCCAGG + Exonic
922610175 1:226920703-226920725 CAGCCCAAGGACACTGGGCCTGG - Intronic
922663147 1:227447561-227447583 CAGAGCAGGGAGAAAGGCCCCGG + Intergenic
922725197 1:227919603-227919625 GAGCCCAGGGCGAGAGGCTCTGG + Exonic
922765070 1:228152332-228152354 TAGCACAGGGTCAGGGGCCCAGG - Intronic
922983706 1:229850345-229850367 CTGCCCTGGGACAGAGGACAAGG - Intergenic
923019624 1:230153208-230153230 CAGGCCAGGGGCAGTGGCTCAGG - Intronic
923027828 1:230219897-230219919 AAGCCCAGGCACAGAGGCTCTGG - Intronic
923729918 1:236540225-236540247 AAGCCCAGGCACAGGTGCCCTGG - Intronic
924482635 1:244451310-244451332 CAGCGCCGGGACTGAGGCCGGGG - Intronic
924921084 1:248629715-248629737 CAGCCCAGGGACAGACAGACTGG - Intergenic
1062874393 10:932403-932425 CACCCCCGGGACCAAGGCCCCGG + Intergenic
1062941550 10:1425535-1425557 CTGCCCAGTGACAGAGGACTGGG - Intronic
1063126765 10:3142724-3142746 AAGCTCAGGGAAGGAGGCCCTGG - Intronic
1063178616 10:3574711-3574733 CAGGCCTGGGAGAGAAGCCCAGG + Intergenic
1065046905 10:21753426-21753448 CAGCCCAGGGCCCTGGGCCCAGG + Intergenic
1066062535 10:31736707-31736729 CATCACAGGTCCAGAGGCCCAGG - Intergenic
1066096422 10:32076677-32076699 GAGCCCAGGGAGAGATGCCGAGG - Intergenic
1066610808 10:37246937-37246959 GAGCCCAGGCACAGTGGCTCAGG + Intronic
1067661619 10:48240381-48240403 GAGCCCAGCGGCACAGGCCCCGG - Exonic
1067814654 10:49464582-49464604 CATCACAGGCCCAGAGGCCCAGG + Intronic
1068116241 10:52740425-52740447 GGGCCCAGAGCCAGAGGCCCAGG + Intergenic
1068552988 10:58426691-58426713 CATCACAGGCCCAGAGGCCCAGG - Intergenic
1069456977 10:68561032-68561054 CAGCCCGGGGTCAGAGCCCCAGG - Intronic
1069689161 10:70338254-70338276 CAGTGCAGGGACAGTGGCTCAGG - Intronic
1069830594 10:71280080-71280102 CACCCCAGGCCCAGAGGCACAGG + Intronic
1069841707 10:71343890-71343912 CTGCCCATGGACTGAGGCCATGG - Intronic
1069867391 10:71512243-71512265 CAGCTCAGTAACAGAGGCCAGGG - Intronic
1069889609 10:71644777-71644799 CAGTCCAGAGGCAGAGGCTCTGG - Intronic
1069898884 10:71695770-71695792 CAGCCCAGGGACAGTGGCAGGGG + Intronic
1070288877 10:75102098-75102120 CAGTGCTGGGACAGAGGCCTGGG - Intronic
1070746459 10:78936695-78936717 CAGCCAAGGGGCAGAAGCCTGGG + Intergenic
1070953906 10:80452403-80452425 AAGCCTAGGGGAAGAGGCCCAGG - Intergenic
1071290477 10:84185411-84185433 AGGAGCAGGGACAGAGGCCCTGG + Intergenic
1071442913 10:85718733-85718755 CATCACAGGCCCAGAGGCCCAGG - Intronic
1071463040 10:85916498-85916520 CAGCACAGGGTCACAGGCACAGG + Intronic
1072488063 10:95874997-95875019 CATCACAGGCCCAGAGGCCCAGG - Exonic
1072626679 10:97116675-97116697 CTCCCCAGGGAGAGGGGCCCAGG + Intronic
1073164260 10:101430354-101430376 CAGCCCAGCCACAGAGACCTGGG - Exonic
1074015578 10:109530550-109530572 CCGCACAGGGACAGAGGACCTGG + Intergenic
1074178316 10:111033115-111033137 CATCACAGGCTCAGAGGCCCGGG - Intergenic
1074552756 10:114460228-114460250 GAGACCAAGTACAGAGGCCCTGG - Intronic
1074803872 10:117028504-117028526 CATCACAGGCACAGAGGCCTAGG + Intronic
1074836762 10:117303624-117303646 CATCACAGGCCCAGAGGCCCAGG + Intronic
1075092331 10:119450818-119450840 GATGCCAGGAACAGAGGCCCTGG - Intronic
1076118322 10:127916683-127916705 GAGCCCAGGGACAGAGGGGATGG + Intronic
1076226264 10:128778728-128778750 CAGGCCAGTGTAAGAGGCCCGGG - Intergenic
1076297524 10:129397939-129397961 CAGCCCTGGGAGAAAAGCCCTGG - Intergenic
1076368592 10:129937302-129937324 CAGCTAAAGGACAGAGGCTCAGG + Intronic
1076567715 10:131410305-131410327 GGGCCCAGGGACAGAGGTCCTGG + Intergenic
1076673709 10:132136853-132136875 CAGCCCAGCTGCAGAGTCCCTGG - Intronic
1076740411 10:132480147-132480169 CAGACCAAGGCCAGTGGCCCAGG + Intergenic
1076760130 10:132599993-132600015 CACCACAGGCCCAGAGGCCCAGG - Intronic
1076796887 10:132802811-132802833 GGGCCCAGGGAGAGAGGCACAGG + Intergenic
1076834942 10:133016345-133016367 CAGCCCAGGCCCAGAGCCACCGG + Intergenic
1076919113 10:133442111-133442133 CAGCCCAGGCACAGAGGCAGGGG - Intergenic
1077046941 11:550944-550966 CACCCCAGGGACTGAGGGACTGG - Intronic
1077097303 11:804556-804578 CAGCCCAGGCCCAGATGGCCTGG - Intronic
1077124135 11:925083-925105 CACCCCAGTGACAGCGGCCGGGG - Intronic
1077211081 11:1371251-1371273 CAGGCCTACGACAGAGGCCCCGG - Intergenic
1077377195 11:2210634-2210656 CTGCCCAGGGACCTCGGCCCTGG - Intergenic
1077426261 11:2479628-2479650 CATCCCAGGCCCAGAGGCCTAGG - Intronic
1078108545 11:8373708-8373730 CATCCCAGTGATTGAGGCCCAGG + Intergenic
1078472923 11:11606085-11606107 AAGCCCAGGGACAGAAGAGCTGG - Intronic
1078552482 11:12290135-12290157 CAGCCCAGGGACAAGGGGCTCGG + Intronic
1078712992 11:13813155-13813177 CATCACAGGCCCAGAGGCCCAGG - Intergenic
1078930795 11:15910808-15910830 CCCATCAGGGACAGAGGCCCAGG + Intergenic
1079083839 11:17431484-17431506 CAGCTCAGGGACACTGGCCCCGG + Intronic
1079341090 11:19612239-19612261 CATCACAGGCCCAGAGGCCCAGG - Intronic
1080192798 11:29571317-29571339 CATCACAGGCACAGAGGCCTAGG - Intergenic
1080921296 11:36711952-36711974 CAAGCCAAGGACAGAGGCCTCGG + Intergenic
1081046418 11:38278858-38278880 CTGCCCAGGGCCAGTGGCGCCGG + Intergenic
1081157737 11:39715975-39715997 CATCACAGGTCCAGAGGCCCAGG + Intergenic
1081242184 11:40720565-40720587 CAGACAAGGGACAGAGGACATGG + Intronic
1081479953 11:43476748-43476770 CATCACAGGCCCAGAGGCCCAGG - Intronic
1081939390 11:46928100-46928122 CATCACAGGCCCAGAGGCCCAGG + Intergenic
1081993960 11:47352009-47352031 CAGCCCAGGGACCTGGGCCTGGG - Intronic
1082099296 11:48158670-48158692 AAGGCCAGGCACAGAGGCTCAGG + Intronic
1082266948 11:50129537-50129559 CAGAGCAAGGACACAGGCCCTGG - Intergenic
1082289141 11:50349031-50349053 CAGAGCAAGGACACAGGCCCTGG + Intergenic
1083201575 11:61123968-61123990 CAGGCCCTGGACAGAGGCCATGG + Intronic
1083335207 11:61917904-61917926 CAGCCTAGGGAAGGAGGGCCGGG - Intronic
1083373569 11:62201762-62201784 CACCCAGGGGACAGAGGCCAGGG - Intergenic
1083822738 11:65182049-65182071 CAGCCCAGGAGCAGTGGCCAGGG - Intronic
1083827109 11:65210160-65210182 CACCCCAGGGACAAGGGCCTGGG - Intronic
1083863106 11:65436355-65436377 CAGCACAGGAGCAGAGGCCCAGG - Intergenic
1084097113 11:66918838-66918860 CAGCCCAGTGAAGAAGGCCCAGG + Intronic
1084178359 11:67434879-67434901 CTGCCCAGGCACACAGGCCGCGG - Intronic
1084182833 11:67455241-67455263 CAGCCCTGGGGCAGAGGACTGGG + Intronic
1084204871 11:67585370-67585392 CAGCTCTGGGCCAGGGGCCCAGG + Intronic
1084335976 11:68458061-68458083 CATGCCAGGGAAAGAGGCCGAGG - Intergenic
1084535542 11:69754190-69754212 CAGGCCAAGGGGAGAGGCCCCGG + Intergenic
1084641546 11:70429461-70429483 CAGCTCAGGGACAGAGGGCAGGG - Intronic
1084661614 11:70549666-70549688 CATCCCAGGGACAGAGCTCTGGG - Intronic
1084779557 11:71399438-71399460 CAGGCCGAGGACAGAGGCCTTGG - Intergenic
1084938648 11:72600756-72600778 CAACCCAGGGCCAGCTGCCCAGG + Intronic
1085023499 11:73223360-73223382 CAGCAGAGGGACAGAGGTCATGG - Intronic
1085194374 11:74659328-74659350 CATCACAGGCCCAGAGGCCCAGG - Intronic
1085514627 11:77105146-77105168 CAGCAGAGGGACTCAGGCCCCGG - Intronic
1086231675 11:84577861-84577883 CATCACAGGCCCAGAGGCCCAGG + Intronic
1086974793 11:93119375-93119397 CAGACCAGGGATGGAGGCCAGGG + Intergenic
1086995784 11:93353861-93353883 CATCACAGGCCCAGAGGCCCAGG - Intronic
1087496318 11:98894422-98894444 CAGCACAGGGACCCTGGCCCTGG + Intergenic
1087550254 11:99639303-99639325 CACCACAGGCCCAGAGGCCCAGG - Intronic
1089140296 11:116278870-116278892 CAGGCCAGGGCCAAAGGCACTGG - Intergenic
1089339894 11:117750215-117750237 CAGGCTGGGGACAGAGTCCCTGG - Intronic
1089432424 11:118435640-118435662 CAGCCCGGGCACTGAGGCCACGG - Intergenic
1089453235 11:118610902-118610924 CAGCCGAGTGGCGGAGGCCCAGG - Intronic
1089499146 11:118922581-118922603 CACCCCAGGGAGAGCGGGCCTGG + Intronic
1089625727 11:119749456-119749478 CAGCCCTCAGTCAGAGGCCCAGG - Intergenic
1089729736 11:120512342-120512364 CAGCCGGGGAACAGAGGCGCTGG - Intronic
1089734604 11:120541072-120541094 CAGTCCAGGGGCAGGGCCCCAGG - Intronic
1089860837 11:121588785-121588807 GAGGCCAGGGAGAGAGGCCTCGG - Intronic
1090014555 11:123074542-123074564 CAGCCTAGGGACAGAGGGTATGG - Intronic
1090609263 11:128455698-128455720 CTGCCCAGGGCCAGTGGCTCAGG + Intergenic
1090725880 11:129526870-129526892 CGGCCCATGGACAGTGGCCATGG + Intergenic
1090727424 11:129540244-129540266 CATCACAGGCCCAGAGGCCCAGG - Intergenic
1091065660 11:132509481-132509503 CATCACAGGCTCAGAGGCCCAGG + Intronic
1091280758 11:134380326-134380348 GAGCCCAGGGACAGGGAGCCAGG + Intronic
1091399907 12:175388-175410 CTGCCCAAGGCCCGAGGCCCCGG - Exonic
1091438968 12:497809-497831 CAGCCCAGGGATGCAGGGCCTGG - Intronic
1091447851 12:554138-554160 CTCTCCAGGGACAGGGGCCCCGG - Intronic
1092015873 12:5157489-5157511 CAGAGCTGGGACAGAGGTCCAGG - Intergenic
1092132176 12:6120274-6120296 CAGGCCAAGGACAGAGCCCAAGG - Intronic
1092485904 12:8901783-8901805 CATCACAGGTCCAGAGGCCCAGG - Intergenic
1093234239 12:16586438-16586460 CAGCTGAGTCACAGAGGCCCTGG + Intronic
1093484827 12:19641391-19641413 CAATCCAGGGACAGAGGCCTGGG - Intronic
1095313830 12:40733954-40733976 AAACCCAGGAACAGAGACCCTGG - Intronic
1096529645 12:52234593-52234615 CAGCTCAGGGCCCCAGGCCCTGG - Intronic
1097182717 12:57180286-57180308 CAGCCCTGGGCCAGACTCCCCGG + Intronic
1097184739 12:57190499-57190521 CAGCCAAGTGAGACAGGCCCTGG - Intronic
1097253674 12:57655868-57655890 CTGCCCAGGGCCAGTGGCACTGG - Intergenic
1097516999 12:60618301-60618323 CCGCCCTGGGACAGAGTACCTGG + Intergenic
1099490725 12:83284833-83284855 CATCACAGGCCCAGAGGCCCAGG + Intergenic
1099503642 12:83446300-83446322 CATCACAGGTTCAGAGGCCCAGG + Intergenic
1099700441 12:86075851-86075873 CACCACAGGCCCAGAGGCCCAGG - Intronic
1099707820 12:86179993-86180015 CATCACAGGCCCAGAGGCCCAGG + Intronic
1099846210 12:88031382-88031404 CATCACAGGCCCAGAGGCCCAGG - Intronic
1101268256 12:103114824-103114846 CCACCCAGGGACAGTGGCTCAGG + Intergenic
1101944852 12:109128996-109129018 CAGGCCAGGCACAGTGGCTCAGG + Intronic
1102368791 12:112363693-112363715 CAGGCCAGGTACAGTGGCTCAGG + Intronic
1103342973 12:120230838-120230860 CAGCCCAGGGACCTAGGGCCTGG + Intronic
1103358191 12:120337222-120337244 CATCACAGGCACAGAGGCCTAGG - Intergenic
1103571274 12:121846752-121846774 CAGCCCAGAGAAACGGGCCCAGG + Intronic
1103612947 12:122135173-122135195 CAGCCCTGGGCCACAGGGCCTGG - Intronic
1103846272 12:123903808-123903830 CAGCACAGGGGCAGAGGCAGTGG - Intronic
1103926587 12:124426814-124426836 GAGGGCAGGGTCAGAGGCCCAGG + Intronic
1104042492 12:125139551-125139573 CAGCACAGAAACAGAGGCACGGG - Intronic
1104917515 12:132273535-132273557 CAGCACAGGGCCAGGGGCCAGGG - Intronic
1105255984 13:18744378-18744400 CACCCCAGGGACAGAGTTCTGGG + Intergenic
1105528943 13:21200788-21200810 CATCACAGGCCCAGAGGCCCAGG - Intergenic
1105874729 13:24541540-24541562 CAGCCCGGGGCCAGAGGAGCGGG - Intergenic
1106262346 13:28078552-28078574 CATCACAGGCCCAGAGGCCCAGG - Intronic
1106315860 13:28592621-28592643 CAGGCCAAGGACAGAGCCCTGGG - Intergenic
1106614412 13:31313832-31313854 CATCACAGGCCCAGAGGCCCAGG + Intronic
1106885050 13:34175890-34175912 CAGCCCAGGCACAGAAGCATTGG - Intergenic
1108586428 13:51874099-51874121 AAGAGCAGGAACAGAGGCCCTGG + Intergenic
1108621740 13:52191555-52191577 TGGGCCAGGGACAGTGGCCCAGG - Intergenic
1108750466 13:53442816-53442838 CAGGCCAGGCACAGTGGCTCAGG - Intergenic
1109169309 13:59075953-59075975 CACCACAGGGCCAGAGGCCTAGG - Intergenic
1109823933 13:67692610-67692632 CACCGCAGGTCCAGAGGCCCAGG - Intergenic
1109994728 13:70108253-70108275 AAGGCCAGGGACAGGGGCGCAGG - Exonic
1110543090 13:76727800-76727822 CATCACAGGCTCAGAGGCCCAGG + Intergenic
1110852790 13:80263515-80263537 CATCACAGGTACAGAGGCCTAGG - Intergenic
1111870862 13:93830487-93830509 CAGCCCCTGGACAAAGGTCCTGG - Exonic
1112101898 13:96198266-96198288 CATCACAGGCCCAGAGGCCCAGG - Intronic
1112451038 13:99509685-99509707 CACCACAGGCCCAGAGGCCCAGG - Intronic
1113280479 13:108782640-108782662 CATCACAGGCCCAGAGGCCCAGG + Intronic
1113794839 13:113050920-113050942 CTGCCGAGGGAGAGAGGGCCAGG + Intronic
1113850552 13:113415141-113415163 CAGCTCATGGACAGAGACACTGG + Intergenic
1113859676 13:113473057-113473079 GAGACGGGGGACAGAGGCCCAGG - Intronic
1114393334 14:22333654-22333676 GAGCCCAGGGACTCTGGCCCTGG - Intergenic
1114807112 14:25850443-25850465 CTGCCCAGGGACTGAAACCCAGG - Intergenic
1114898263 14:27022397-27022419 CTGCCCGGGCACAGTGGCCCAGG + Intergenic
1116010702 14:39348112-39348134 CAGGCCAGGCACAGTGGCTCAGG - Intronic
1117181907 14:53200262-53200284 CATCACAGGCCCAGAGGCCCAGG + Intergenic
1118014523 14:61645014-61645036 CAAGCCAGGGACAGGGGCTCAGG + Intronic
1118067740 14:62210469-62210491 AGGCCCAGGGACAGAGCCCAAGG - Intergenic
1118822768 14:69355784-69355806 AAGCCAAGTCACAGAGGCCCAGG - Exonic
1119521162 14:75286522-75286544 CAGCCTGGGGCAAGAGGCCCCGG - Intergenic
1119694406 14:76701295-76701317 CAAGCCAAGGACAGAGGCCTTGG + Intergenic
1119832678 14:77717267-77717289 CAGACCAGGGGCAGTGGCTCAGG - Intronic
1120083111 14:80237370-80237392 CATCACAGGCCCAGAGGCCCAGG - Intronic
1120141648 14:80936233-80936255 CAGGCCAGGCACAGTGGCTCAGG + Intronic
1120263904 14:82224729-82224751 CAGCCCAGTGAGAGAAGCGCAGG + Intergenic
1120324682 14:83009437-83009459 CATCACAAGCACAGAGGCCCAGG + Intergenic
1120761026 14:88285391-88285413 CAGGCCAGGCACAGTGGCTCAGG - Intronic
1121024740 14:90607267-90607289 CAACCCTGGGGCACAGGCCCAGG - Intronic
1121030194 14:90652183-90652205 CAGGTCAGGGACTGAGGCGCAGG - Intronic
1121211251 14:92209518-92209540 CAGCACAGGGCCAGAGGGTCTGG + Intergenic
1121506559 14:94482130-94482152 GTGCCCAGTGTCAGAGGCCCAGG - Intergenic
1121680217 14:95787512-95787534 GGTCCCAGGGACAGAGGTCCAGG + Intergenic
1121680246 14:95787695-95787717 GGTCCTAGGGACAGAGGCCCAGG + Intergenic
1121881846 14:97507982-97508004 CATCACAGGCCCAGAGGCCCAGG + Intergenic
1122270346 14:100566174-100566196 CAGCCCAGGAGCCCAGGCCCTGG + Intronic
1122271976 14:100572394-100572416 CATGCCAAGGACAGAGGCCTGGG + Intronic
1122640637 14:103157114-103157136 CTTCCCAGGGGGAGAGGCCCCGG + Intergenic
1122651544 14:103229544-103229566 CATCCCTGGCACACAGGCCCTGG + Intergenic
1122842064 14:104470814-104470836 AAGCCCCGGGGCAGAGGCCTTGG + Intergenic
1122938236 14:104969816-104969838 CAGCCCAGGGAAACTGGCTCAGG - Intronic
1124343839 15:28908103-28908125 CAGCTCAGGGACAACGGCTCGGG - Intronic
1124964086 15:34420443-34420465 CAGCTCAGGGCCAGCGGCGCAGG + Intronic
1124980699 15:34566671-34566693 CAGCTCAGGGCCAGCGGCGCAGG + Intronic
1125113548 15:36062379-36062401 CTGTCAAGGGACAGCGGCCCGGG + Intergenic
1125304258 15:38291809-38291831 CATCACAGGCCCAGAGGCCCAGG - Intronic
1125762377 15:42105408-42105430 CAGCCCAGAGGCAGAAGTCCTGG + Intergenic
1125827310 15:42687449-42687471 CAGCCCAGTGATGGTGGCCCAGG + Exonic
1126695630 15:51323124-51323146 AGGCCCAGAGACAGTGGCCCTGG - Intronic
1127576305 15:60295478-60295500 CATCACAGGCCCAGAGGCCCAGG - Intergenic
1127729854 15:61789768-61789790 CAGCCCAGGGGCAGAGAGCAGGG - Intergenic
1127995793 15:64152463-64152485 CAACCCACCCACAGAGGCCCGGG - Intronic
1128066302 15:64766808-64766830 CAGGCCAGGCACAGTGGCTCAGG - Intronic
1128067988 15:64775981-64776003 CCGCCCAGGGACCGGGGCGCTGG - Intergenic
1128235036 15:66061256-66061278 CAGAGCAGGGGCTGAGGCCCAGG + Intronic
1128238419 15:66082957-66082979 CAGGCCAGGGGCAGGGACCCAGG + Intronic
1128657771 15:69475031-69475053 CAGGACAAGGACAGAGCCCCAGG - Intergenic
1129185831 15:73905886-73905908 GATCCCTGGGACAGAGGCCAGGG - Intergenic
1129469406 15:75742474-75742496 CATCACAGGCCCAGAGGCCCAGG + Intergenic
1129608874 15:77037884-77037906 CAGCCCAGGCACGTTGGCCCCGG + Intergenic
1129785817 15:78309448-78309470 CAGCGGAGGGACTCAGGCCCTGG - Intergenic
1129847098 15:78772996-78773018 GAGGCCAAGGACAGGGGCCCAGG + Intronic
1130037542 15:80375387-80375409 CAGCCCATAGACATATGCCCTGG - Exonic
1130039875 15:80397542-80397564 CAGTCCAAGGGCAGAGGCTCTGG - Intronic
1130254804 15:82320894-82320916 GAGGCCAAGGACAGGGGCCCGGG - Intergenic
1130298938 15:82665779-82665801 CAGAGCAGGGACTGAGGGCCAGG + Intronic
1130409379 15:83631744-83631766 CATCACAGGCCCAGAGGCCCAGG - Intergenic
1130600169 15:85269112-85269134 GAGGCCAAGGACAGGGGCCCGGG + Intergenic
1131111402 15:89767270-89767292 TAGCCCAGGAACATAGGCCCTGG + Intronic
1131365248 15:91833507-91833529 CAGTCCAAGGCCAAAGGCCCAGG - Intergenic
1131455417 15:92579368-92579390 CTTCCCAAGGACAGGGGCCCTGG + Intergenic
1132124693 15:99212612-99212634 CAGCCCAGGGAGAAAGGCACTGG + Intronic
1132622431 16:874230-874252 CAGCTCTGGGACAGAGCCTCAGG + Intronic
1132649699 16:1014856-1014878 CTGCCCCGGGACAGAGGTCTGGG + Intergenic
1132656683 16:1044459-1044481 CAGCACAGGGACACCCGCCCGGG + Intergenic
1132658454 16:1051193-1051215 GACCCCAGGGACAGAGCCCCGGG - Intergenic
1132694079 16:1194419-1194441 CAGCCCTGGGACAGGGGCCCTGG + Intronic
1132735105 16:1382006-1382028 CAGCCCAGGGACAGAGCACTTGG - Intronic
1132735514 16:1384014-1384036 CAGCCCAGGGACAGAGAACTTGG + Intronic
1132747701 16:1443831-1443853 CTGCTCGGGGACAGAGGCCGTGG + Exonic
1132774627 16:1586186-1586208 CAGCCCCGGGGCAGAGGGCAAGG - Exonic
1133116055 16:3578609-3578631 GAGCCAAGGGACAGGGGTCCTGG + Intergenic
1133117551 16:3586527-3586549 CAGGCCAGGCACAGTGGCTCAGG + Intronic
1133129675 16:3669044-3669066 CAGCCCAGGGACATTGTACCTGG + Intronic
1133282784 16:4676602-4676624 CAGCCCAGGGACAGGGCCTCAGG - Intronic
1134388821 16:13799684-13799706 CAGGCCAGGCACAGAGGCTCAGG + Intergenic
1136106636 16:28034766-28034788 CAGCCAATGGGTAGAGGCCCTGG - Intronic
1136297069 16:29309706-29309728 CAGCACTGGTACAGAGCCCCAGG - Intergenic
1136377197 16:29872593-29872615 AAGCCCAGGGTTTGAGGCCCAGG - Intronic
1136475421 16:30510253-30510275 CATGACAGGGACAGAGCCCCTGG + Intronic
1136531919 16:30875544-30875566 CAGCCCTGAGACAAGGGCCCAGG + Intronic
1136533943 16:30888102-30888124 AAGCCCAGGGCCAGATGCCCAGG + Intronic
1136849298 16:33601125-33601147 GAGCACAGGAACAGAGGCCGAGG + Intergenic
1137436125 16:48455558-48455580 CAGCCCACAGACAGTGCCCCTGG - Intergenic
1137456607 16:48622735-48622757 CACCCCAGGGACAGAGTCCTCGG - Intergenic
1137528735 16:49262594-49262616 CAGCGCAGGGAGAGAGGCATGGG - Intergenic
1137892419 16:52176419-52176441 CAGCCCTGGAAGAGAAGCCCCGG + Intergenic
1138016064 16:53429850-53429872 CAGCTGAGGGCCAGAGGCCTTGG + Intergenic
1138106493 16:54289646-54289668 CAGCCCGGGGACTTAGGGCCTGG - Intergenic
1138613729 16:58147815-58147837 CAGGGCAGGGACAGAGGCAGAGG - Intergenic
1139312538 16:66039794-66039816 CATCCCAAGGTCAGAGGCACAGG + Intergenic
1139356864 16:66371786-66371808 CAGCCCAGGGGCTGAGGGGCTGG + Intronic
1139611411 16:68061566-68061588 CAGCCCTTGGAGAGAAGCCCGGG + Intronic
1140034745 16:71363660-71363682 CCGCCCAGGGCCAGTTGCCCAGG - Intronic
1140477182 16:75244775-75244797 GAGCACAAGGGCAGAGGCCCTGG + Intronic
1140580297 16:76223551-76223573 GAGCCTGGGGAGAGAGGCCCTGG - Intergenic
1141160490 16:81626138-81626160 CAGAGGAGGGACAGAGGCCTGGG - Intronic
1141410452 16:83829461-83829483 CAGCCCACAGACAGAGGCTTTGG + Intergenic
1141628689 16:85275329-85275351 CAGGCAGGGGACAGAAGCCCGGG + Intergenic
1141688169 16:85582058-85582080 GAGCCCAGGGATGGAGGCCCAGG - Intergenic
1142009735 16:87707740-87707762 CTGGCCCGGGGCAGAGGCCCCGG + Intronic
1142058620 16:88015810-88015832 CAGCACCGGTACAGAGCCCCGGG - Intronic
1142173605 16:88634995-88635017 CAGCCGAGGGAGGGAGGCCGGGG + Intergenic
1142242314 16:88953178-88953200 CAGCCGAGGGAGAGAGGCGATGG - Intronic
1203111005 16_KI270728v1_random:1449775-1449797 GAGCACAGGAACAGAGGCCGAGG + Intergenic
1142534790 17:606632-606654 CAGGCCATGGACTGTGGCCCAGG - Intronic
1143594590 17:7906753-7906775 CAACTCAGGGACAGAGGCAGAGG - Intronic
1143878405 17:10011166-10011188 CTGCCTAGGGACACAGGCACTGG + Intronic
1144081160 17:11765587-11765609 CTCCCCAGAGACAGATGCCCTGG + Intronic
1144127915 17:12220165-12220187 CAGCCCAGGTCCACAGCCCCTGG - Intergenic
1145208169 17:20995575-20995597 CAGCCCATGGACACAGTGCCCGG + Intergenic
1145209877 17:21004878-21004900 CAGCTCTTGGCCAGAGGCCCTGG + Intronic
1145270244 17:21401065-21401087 GAGCCCAAGGACAGAAGCCAGGG - Intronic
1145286133 17:21507106-21507128 TAGCCCAGGGTCAGAGGTCAGGG + Intergenic
1145289294 17:21530547-21530569 CAGTGCAGGATCAGAGGCCCAGG - Exonic
1145391468 17:22459186-22459208 TAGCCCAGGGTCAGAGGTCAGGG - Intergenic
1146054024 17:29572417-29572439 CAGCTCCAGGACAGAGGCTCAGG + Exonic
1146503392 17:33383660-33383682 CAGGCCAAGAGCAGAGGCCCAGG - Intronic
1146656731 17:34638963-34638985 CACCCCAGAGCCAGAGGCCTGGG + Exonic
1146833388 17:36089622-36089644 CATCCAAGGGACAGAGCTCCTGG + Intronic
1146917827 17:36689453-36689475 CAGCCGAGGCATAGAGGGCCCGG - Intergenic
1147456424 17:40541055-40541077 CTGCCCAGGGACAGTGCCTCTGG - Intergenic
1147571645 17:41575293-41575315 CAGCTCAGGGACCCAGGACCTGG - Intergenic
1147613040 17:41812710-41812732 CTGGCCAGGGAGAGAGGCTCGGG - Intronic
1147945603 17:44078499-44078521 CAGCCCGGGAACACAGCCCCAGG - Exonic
1148090883 17:45021934-45021956 CAGCCCAGGCTCAGAGGACGTGG + Intergenic
1148111178 17:45145262-45145284 CAGCCCAGGGTCACAAGCACAGG + Intergenic
1148142041 17:45335906-45335928 CAGACCACGGACAGAGGCCCAGG + Intergenic
1148343006 17:46884521-46884543 CAGCCTGATGACAGAGGCCCAGG + Intronic
1148384086 17:47221986-47222008 GAGCCCAGGGAGACAGGGCCTGG - Intronic
1148776174 17:50096797-50096819 TGGCCCAGGGTCAGGGGCCCTGG - Intronic
1148863625 17:50617611-50617633 CAGCCCAGGGAGAGAGAGCAAGG + Intronic
1149082035 17:52668610-52668632 CATCACAGGTCCAGAGGCCCAGG - Intergenic
1149305574 17:55343553-55343575 CAGCACAAGGAGAGAGGCCATGG + Intergenic
1149660461 17:58331847-58331869 GAGGCCAGGGCCTGAGGCCCTGG - Intergenic
1149849591 17:60026888-60026910 CAGGCAAGGGCCAGAGTCCCGGG + Intergenic
1149860577 17:60119636-60119658 CAGGCAAGGGCCAGAGTCCCGGG - Intergenic
1150135118 17:62691167-62691189 CAGCCCAGGACCAGCGGCACGGG - Intronic
1151216684 17:72581955-72581977 GGGCCCACAGACAGAGGCCCAGG + Intergenic
1151485141 17:74394306-74394328 CAACCAGGGGTCAGAGGCCCTGG + Intergenic
1151534568 17:74731354-74731376 CAGGGGAGGGACAGAGCCCCTGG + Intronic
1151906378 17:77052119-77052141 GAGCCCAGAGTCAGAGGCCTGGG - Intergenic
1151970942 17:77457091-77457113 CATCCCAGGCACACAGCCCCGGG - Intronic
1152224257 17:79085450-79085472 CAGCTCTGAGACAGAAGCCCAGG + Intronic
1152240364 17:79157664-79157686 CTGCCGGGGGACAGAGGCCAGGG + Intronic
1152258848 17:79255737-79255759 CAGCTCAGGGGCAGCGTCCCTGG + Intronic
1152344260 17:79741965-79741987 CAGCCCAGGTCCAGAGCCCCCGG + Exonic
1152426627 17:80221592-80221614 CATCCCGGGGCCAGAGGACCTGG - Exonic
1152666150 17:81570753-81570775 CAGCCCTGGGCCACAGGCGCTGG - Intronic
1153515072 18:5895123-5895145 GAGCGCAGGGACAGCGCCCCGGG + Exonic
1154093023 18:11382243-11382265 CCCCCCATGCACAGAGGCCCTGG - Intergenic
1154435049 18:14336300-14336322 CACCCCAGGGACAGAGTTCTGGG - Intergenic
1155174933 18:23293585-23293607 CAGCACAGGGCTAGAGGCACTGG + Intronic
1155345739 18:24855019-24855041 CAGCCCAAGTGCAGAGGCTCAGG - Intergenic
1155453517 18:25987280-25987302 CAGGCCAGGCACAGAGGCTCAGG + Intergenic
1157146360 18:45166856-45166878 CAGCTCAGGGACAGGGGCATAGG - Intergenic
1157408790 18:47446526-47446548 CAGCACAGGGACCCAGGGCCTGG - Intergenic
1158222014 18:55160102-55160124 CAGCACAGGCTCTGAGGCCCAGG + Intergenic
1158629405 18:59099194-59099216 CAGCCAAGGGAAAGAACCCCTGG - Intergenic
1159433310 18:68384119-68384141 CATCACAGGCCCAGAGGCCCAGG + Intergenic
1160291104 18:77594446-77594468 CTGTCCAGGGACAGTGGCCACGG - Intergenic
1160293431 18:77616522-77616544 CAGCCCTGGGGCAGTGGCACAGG + Intergenic
1160501557 18:79403609-79403631 CAGCCCAAACACAGAGGCCTTGG - Intronic
1160527779 18:79547566-79547588 CAGCCCCGGGACCCAGCCCCGGG - Intergenic
1160581777 18:79887322-79887344 CCGCCCTGGGCCAGAGGCCACGG + Intronic
1160747020 19:716578-716600 CCGGGGAGGGACAGAGGCCCAGG + Intronic
1160957225 19:1699337-1699359 CAGCCCAGGGTCACAGGACTGGG - Intergenic
1160973362 19:1780200-1780222 CAGCCCAGGGAGGGAGGCCGAGG - Exonic
1161396112 19:4045772-4045794 CAGGCCACGGACAGGGGCCGGGG - Exonic
1161697668 19:5778613-5778635 CAGGGCAGGCACAGAGCCCCCGG + Exonic
1161761126 19:6173400-6173422 CTTCCCAGGGACAGAGAACCAGG - Intronic
1162033079 19:7925688-7925710 TAGCCCGGGGACCGAGGCGCGGG - Intronic
1162178129 19:8846989-8847011 GAGCCCAGGGACACTGGCCCCGG - Intergenic
1162307521 19:9884294-9884316 AAGCCCAGGCACAGTGGCTCAGG + Intronic
1162766413 19:12922584-12922606 AATCCCAGGGACAGAGGACTGGG - Exonic
1163001675 19:14372213-14372235 CATCCAAGGGACAGAGCCCTGGG + Intergenic
1163064649 19:14784146-14784168 CATCCGAGGGACAGAGCCCTGGG - Intergenic
1163153818 19:15429495-15429517 TAGCCCAGGGACAGGGCCCAGGG - Intronic
1163273104 19:16266139-16266161 CGCCCCAGGGACTGAGTCCCTGG + Intergenic
1163359894 19:16839266-16839288 CAGGCCAGGGACAGTGGCTCAGG - Intronic
1163685881 19:18711363-18711385 CGGCCCAGGCACAGAGGCGCAGG - Intronic
1163692954 19:18746970-18746992 CAGCCCAGGGCAGGAAGCCCCGG - Intronic
1163755399 19:19103692-19103714 CAGCTGAGGGGCAGAGGGCCCGG - Intronic
1164210004 19:23090677-23090699 CATCACAGGCCCAGAGGCCCAGG + Intronic
1164512358 19:28907941-28907963 CAGCCCAGGTAAACAGGCACTGG - Intergenic
1164665318 19:30028502-30028524 CAGCCCAGGAAGAGAGCCCTCGG - Intergenic
1164724913 19:30459630-30459652 CAGGCCAGGTACAGTGGCACAGG - Intronic
1165125487 19:33593338-33593360 CAGGCCAGGTACAGTGGCTCAGG - Intergenic
1165227573 19:34365502-34365524 CAGGCCACGGACTGGGGCCCAGG + Intronic
1165247085 19:34503952-34503974 CAGCTCAGAGACATAGACCCTGG + Exonic
1165257824 19:34590234-34590256 CAGCCCAAGGACACAGGGCCTGG + Intergenic
1165305639 19:35000883-35000905 CAGCCCAGGCCCACAGGCCGCGG + Intronic
1165383211 19:35495404-35495426 CAGCCCAGTCACTGAGGCACCGG - Intronic
1166048470 19:40243498-40243520 CATGGCAGGGACAGAGGTCCTGG + Intronic
1166049144 19:40247831-40247853 CTGCCCACCGACAGAGGCCAGGG + Intronic
1166251648 19:41575699-41575721 TGACCCAGGGACAGAGACCCAGG - Intronic
1166533032 19:43553715-43553737 TGGCCCAAGGACAGAGGCCAGGG + Intronic
1167290886 19:48624688-48624710 GGACCCAGGGACAGAGACCCAGG + Intronic
1167403432 19:49288383-49288405 CATCACAGGCCCAGAGGCCCAGG + Intergenic
1167506377 19:49873154-49873176 CAGCATAGGCACAGGGGCCCGGG + Exonic
1167915234 19:52734933-52734955 CGTCCCAGGGACAGAAGCCCTGG + Intronic
1167991645 19:53365805-53365827 CGTCCCAGGGACAGAAGCGCCGG - Intronic
1168115571 19:54220033-54220055 CAGCCCAGCCTCAGAGCCCCTGG + Intronic
1168118558 19:54239779-54239801 CAGCCCAGCCTCAGAGCCCCTGG + Intronic
1168132917 19:54332344-54332366 CAGCCCAGCCTCAGAGCCCCGGG + Intergenic
1202711021 1_KI270714v1_random:19439-19461 CGGCCCAGGCAAAGCGGCCCCGG + Intergenic
925024094 2:594459-594481 TAGCCCAGCGACAGTGGCCAGGG + Intergenic
925298610 2:2794439-2794461 AAGAACAAGGACAGAGGCCCCGG + Intergenic
925443580 2:3908708-3908730 CATCACAGGCCCAGAGGCCCAGG - Intergenic
925444392 2:3915354-3915376 GAGCCCAAGCACAGTGGCCCAGG + Intergenic
925453767 2:3995871-3995893 TAGCCCAGAGACACAGGTCCAGG - Intergenic
925900350 2:8504784-8504806 CAGTCCAGGGAGAGAGGCCTTGG - Intergenic
926120791 2:10240287-10240309 CTGCACCGGGCCAGAGGCCCAGG + Intergenic
926272079 2:11374533-11374555 CAGGCCTGGGGCAGAGGGCCTGG + Intergenic
926863529 2:17334437-17334459 CAACCCAGGCTCAGAAGCCCAGG - Intergenic
927111248 2:19865020-19865042 GAGCCCAGGGACAGAGGACAGGG + Intergenic
927607637 2:24502058-24502080 CAGCCAAGGGATGGAGGGCCAGG - Intronic
928269994 2:29847305-29847327 GAGCCCAGGTCCAGAGGTCCTGG - Intronic
929600921 2:43204099-43204121 CAGGCCACGGCCAGAGGCTCAGG + Intergenic
930264689 2:49186111-49186133 CATCCCTGGGACAGAGCACCTGG - Intergenic
931252823 2:60549471-60549493 CAGGCCCGGGGCAGGGGCCCCGG + Intronic
932202619 2:69845244-69845266 CAGCGCAGAGCCAGAGGTCCTGG + Intronic
932304725 2:70693928-70693950 CAGCCCAGGGACATAGGGCTTGG + Intronic
932904439 2:75733995-75734017 CATCACAGGCACAGAAGCCCAGG - Intergenic
933386954 2:81622872-81622894 CAGCCTGGGCACAGAGGCTCCGG + Intergenic
934900867 2:98158885-98158907 CAGCCCAGGGAGCTGGGCCCTGG + Intronic
935327064 2:101947025-101947047 CAGCCCAGTGAGTGAGTCCCGGG - Intergenic
935436932 2:103045430-103045452 CATCACAGGCCCAGAGGCCCAGG + Intergenic
935623067 2:105145279-105145301 AAACACAGGGACAGAGCCCCAGG + Intergenic
935626013 2:105172786-105172808 CATCACAGGTCCAGAGGCCCAGG - Intergenic
935660244 2:105460609-105460631 CATACCAGGGTCAGAGGCCTTGG - Intergenic
936011136 2:108926108-108926130 CAGCCCAGGATGAGAGACCCAGG - Intronic
936022889 2:109008493-109008515 CAGGGCAGGGACAGAGACCTGGG + Intergenic
936082881 2:109446849-109446871 CAGCCCAGGGGCACAGACCCTGG + Intronic
936713566 2:115161277-115161299 CAGCCCGGGGACCGGGGTCCCGG - Intronic
936792266 2:116164370-116164392 CATCGCAGGTCCAGAGGCCCTGG + Intergenic
937085745 2:119170606-119170628 CCTCTCAGGGACAGAGGCCGTGG - Intergenic
937231365 2:120399980-120400002 CAGCCAGAGGACAGAGGTCCTGG + Intergenic
938212479 2:129480405-129480427 AAGCCCAGGAAGAGAGCCCCAGG - Intergenic
938218885 2:129548728-129548750 CAGCCCTGGGGCAGGGCCCCTGG + Intergenic
938686432 2:133742428-133742450 CATCACAGGCCCAGAGGCCCTGG - Intergenic
938968402 2:136408335-136408357 TGGCCCAGGGACAGAGGCAGAGG + Intergenic
938998237 2:136703380-136703402 ATGCCCATGAACAGAGGCCCTGG - Intergenic
939050187 2:137298562-137298584 CATCACAGGGCCAGAGGCCCAGG + Intronic
939559327 2:143714389-143714411 CATCACAGGCCCAGAGGCCCAGG - Intronic
941059303 2:160827481-160827503 CAGCTCAGGCACAGAGGGGCAGG + Intergenic
941306087 2:163869227-163869249 CAGCCCAGGGTCAGAAATCCAGG - Intergenic
941536027 2:166723091-166723113 CATCACAGGCCCAGAGGCCCAGG - Intergenic
942290530 2:174465534-174465556 CAGCCTAGAGCCACAGGCCCTGG + Intronic
942849079 2:180461486-180461508 CTGGCCAGCGACAGAGGCTCGGG + Intergenic
945433742 2:209795551-209795573 CATCACAGGCCCAGAGGCCCAGG + Intronic
945628211 2:212237692-212237714 CATCCCTGGGACAGAGCACCTGG - Intronic
946152782 2:217787524-217787546 CTGCCCAGGGCCAGCGGCACTGG + Intergenic
946163784 2:217851603-217851625 CAGCCCAGGGCCCAGGGCCCAGG + Intronic
946493478 2:220172238-220172260 CATCCCAGAGACTGTGGCCCAGG - Intergenic
946732612 2:222723828-222723850 CAGCACAGGGTCAGATGCTCAGG + Intergenic
946878024 2:224149864-224149886 CAGCCCGGGCTCAGAGGCCCTGG - Intergenic
946930169 2:224662889-224662911 CATCACAGGCCCAGAGGCCCAGG - Intergenic
946995262 2:225384035-225384057 CATCACAGGGCCAGAGGCCTAGG + Intergenic
948681977 2:239641221-239641243 CAGCACAGGGCTTGAGGCCCTGG - Intergenic
948740097 2:240040948-240040970 CAGCCCAGGGACCCAGGCACAGG - Intergenic
948793620 2:240391465-240391487 CAGCCCAGGGCCCGGGGCCTTGG + Intergenic
948809205 2:240466300-240466322 GGCCCCAGGGACAGAGGCCAAGG + Exonic
948936831 2:241171028-241171050 GAGTCCAGAGACAGAGGACCAGG + Intronic
949051995 2:241902482-241902504 GAGCCCAGGTACAGGGGCGCAGG - Intronic
1168842909 20:921188-921210 CAGCACAGGACCAGAGGCCTGGG - Intergenic
1169285083 20:4301091-4301113 CTGCCCAGAAACTGAGGCCCTGG - Intergenic
1169443086 20:5649254-5649276 CAGGCCAGGTACAGTGTCCCAGG - Intergenic
1170364977 20:15588331-15588353 CATCACAGGCTCAGAGGCCCGGG - Intronic
1170634632 20:18093592-18093614 CAGCCCAGGGGATCAGGCCCAGG + Intergenic
1170661428 20:18344159-18344181 CAGGCCAGGCACAGTGGCTCAGG - Intergenic
1171411031 20:24949237-24949259 CAGCCCAGGGGCAGGTGCCAGGG - Exonic
1171882745 20:30630643-30630665 CACCCCAGGGACAGAGTTCTGGG + Intergenic
1172044629 20:32071565-32071587 CAGCCCGGGGGCAGGGGACCTGG + Intronic
1172122392 20:32606128-32606150 CAGCCCAGGGATTGAGCCCACGG - Intronic
1172206558 20:33166835-33166857 CAGCCCAGGAACATAGCCCAGGG - Intronic
1172438541 20:34948359-34948381 GAGCCCTGGGACAGAGGCAGAGG - Intronic
1172474403 20:35226553-35226575 CAGCCCTGGGGCAGGGGCCGCGG - Intergenic
1172600507 20:36179657-36179679 CAGCCAAGGGGGAGGGGCCCTGG - Intronic
1172631508 20:36381621-36381643 CAGTCTAGGGGCAGAGGCACTGG + Intronic
1172657016 20:36543512-36543534 CAGCCGAGGGAAGGAGGCACTGG + Intronic
1173091458 20:39975972-39975994 CAGCCCAGGGGGAAAGGGCCAGG + Intergenic
1173347604 20:42215238-42215260 CAGTCCAGGGCCAGAGCCCATGG - Intronic
1173427474 20:42955726-42955748 CAGCCCAGGAACAGAGGCTGAGG + Intronic
1173649904 20:44656560-44656582 CTGCCCAGGGATAGAGCTCCAGG - Intergenic
1173820081 20:46013986-46014008 CAACCCAGGGGCAGAGGCGCTGG - Intronic
1173860203 20:46278141-46278163 GAGCCCAGGGGGAGAGGCCTGGG - Intronic
1174087232 20:48018111-48018133 CGACCCAGGGACTGAGCCCCAGG - Intergenic
1174129052 20:48328857-48328879 CAACCCAGGGACTGAGCCCCAGG + Intergenic
1175501991 20:59456961-59456983 CAGCCCGCGGGCGGAGGCCCAGG - Intergenic
1175854656 20:62113955-62113977 CAGGCACGGGACAAAGGCCCTGG + Intergenic
1175934244 20:62507784-62507806 CATCGCAGGGACAGTGGCCAGGG - Intergenic
1175976790 20:62714643-62714665 CACACCAGGGACAGAGGAACAGG + Intronic
1175987176 20:62769971-62769993 CAGCCCAGGCAGAGAGCCCTGGG - Intergenic
1176841988 21:13849402-13849424 CACCCCAGGGACAGAGTTCTGGG + Intergenic
1178123528 21:29493531-29493553 CAGCCCGGGCACAGTGGCTCAGG - Intronic
1178187853 21:30244014-30244036 TATACCAGGGAGAGAGGCCCTGG - Intergenic
1178829523 21:36044239-36044261 CAGCCCAGGGAAGGAGGACATGG + Intronic
1178898336 21:36579057-36579079 CAAGCCAGGGAGAGAGGCCTCGG - Intergenic
1179235349 21:39540617-39540639 CATCACAGGCCCAGAGGCCCAGG - Intergenic
1179541810 21:42087839-42087861 CAGGCCAAGGAGAGAGGCCTGGG - Intronic
1179594820 21:42436412-42436434 CAAGCCAGGGACAGAGGCCTGGG - Intronic
1179712822 21:43272945-43272967 TACCCCAGGAACAGGGGCCCGGG + Intergenic
1179801560 21:43813660-43813682 CAGCCTAGGGACAGGGCCACTGG - Intergenic
1179818662 21:43923769-43923791 CTCCCCAGGGACAGAAGCCCTGG - Intronic
1179968954 21:44823755-44823777 CAGCAGAGGGAAAGTGGCCCTGG + Intergenic
1180089972 21:45529002-45529024 CAGCACAATGGCAGAGGCCCTGG + Intronic
1180746147 22:18090401-18090423 GAGCCAAGGCACAGAGGCCAAGG - Exonic
1180882892 22:19218996-19219018 CAGCCCAGGAAGAGAGTACCTGG - Intronic
1180995366 22:19962840-19962862 CAGCTCTGGGACAGGGACCCAGG + Intronic
1181027304 22:20133351-20133373 CCGCCCAAGGACAGAGGCCCTGG - Intronic
1181038841 22:20182434-20182456 CAGACCAGGTCCAGAGTCCCAGG - Intergenic
1181314492 22:21962647-21962669 AGGCCCAGGGTCTGAGGCCCCGG - Intronic
1181786735 22:25232546-25232568 CTGGCCAGGGATAGAGGCTCAGG + Intergenic
1181852832 22:25762214-25762236 CTGCCCAGGGACAGAGAAGCAGG - Intronic
1182502233 22:30755928-30755950 CCGACCAGGGAACGAGGCCCAGG - Intronic
1182532080 22:30968654-30968676 CGGCCACGGGACCGAGGCCCGGG - Intergenic
1182892879 22:33833485-33833507 CAAGCCAAGGAGAGAGGCCCTGG + Intronic
1183360554 22:37380900-37380922 CAGACAAGGAACTGAGGCCCAGG - Intronic
1183395895 22:37570575-37570597 CAGCCCAGGGTCAGAGGTCAAGG - Exonic
1183481596 22:38068458-38068480 CACCCTAGGGCCAGAGGCCAAGG + Intronic
1183525340 22:38319292-38319314 GAGCCCAGGCAGAGAGGCCTGGG + Intronic
1183582272 22:38733118-38733140 CAGCCAAGAGACAGAGGACCAGG - Exonic
1183648632 22:39141120-39141142 CAGCAGAGAGACTGAGGCCCGGG + Intronic
1183950289 22:41348920-41348942 CAGCGCTGGGACCCAGGCCCAGG + Intronic
1183986936 22:41575254-41575276 CAGCTCAGGGGCGGAGGCCAGGG - Exonic
1184104122 22:42357636-42357658 CAGCCCTGGGTTAGAGCCCCTGG + Intergenic
1184204708 22:42994625-42994647 ATGCACAGGGACAGAGACCCTGG - Intronic
1184358689 22:44000037-44000059 GAGCCCAGGGTCAGGGGCCCTGG + Intronic
1184384492 22:44166575-44166597 CAGGCCAGAGGCAGAGGCACTGG + Intronic
1184712595 22:46262075-46262097 CAGTACAGGGCCCGAGGCCCAGG + Exonic
1184724817 22:46337658-46337680 CAGGCCAGGCACAGAGGCACAGG + Intronic
1184752650 22:46497452-46497474 GAGACCCGGGACAGAGGCCTGGG - Intronic
1185050382 22:48551199-48551221 CAGGTCAGGGTCAGGGGCCCTGG - Intronic
1185062099 22:48612474-48612496 GTGCCCAGGGACAGGGCCCCAGG - Intronic
1185106715 22:48875065-48875087 CTTCCCAGGAACAGACGCCCAGG + Intergenic
1185127995 22:49022422-49022444 CAGGCCAGAGGAAGAGGCCCCGG + Intergenic
949693009 3:6662314-6662336 CAGCCCAGGGACCCTGGGCCTGG + Intergenic
950045156 3:9944713-9944735 CAGCCCAGGTACCCAGGCCCGGG + Exonic
950479679 3:13236702-13236724 CAGCCCTAGCACAGGGGCCCGGG - Intergenic
950529158 3:13543189-13543211 CAGCCCAGAGACAGGGGGCCTGG - Intergenic
950612305 3:14134294-14134316 AGGCCCAGGAACAGAGCCCCAGG - Intronic
951549745 3:23865224-23865246 CAGCTATGGGACTGAGGCCCAGG + Intronic
952139124 3:30458908-30458930 CATCACAGGCCCAGAGGCCCAGG + Intergenic
952756602 3:36874388-36874410 CAGCCCAGGGCAAGAGGACTAGG + Intronic
953055258 3:39382853-39382875 CAGGCCGGGGGCAGTGGCCCAGG - Intergenic
953232301 3:41075902-41075924 CAGCCCAGGCACTGAGGGACTGG - Intergenic
953805093 3:46061784-46061806 GAGACCAGGGAAAGAAGCCCAGG - Intergenic
953901541 3:46846560-46846582 CCACTCAGGGACACAGGCCCCGG - Intergenic
954038130 3:47864214-47864236 AAGGCCAGGTACAGTGGCCCTGG - Intronic
954444587 3:50539901-50539923 CTGCCCAGGTCCAGAGGCCTGGG - Intergenic
954557935 3:51532960-51532982 AAGCCCAGGGCCAGATACCCGGG - Intergenic
955239061 3:57164296-57164318 CCGCCCAAGGCCAGAAGCCCAGG + Intronic
955397328 3:58566495-58566517 CAGCCCTGGGCCCCAGGCCCTGG - Exonic
956909989 3:73807444-73807466 CATCACAGGTCCAGAGGCCCAGG + Intergenic
958146484 3:89631401-89631423 CATCACAGGCATAGAGGCCCAGG + Intergenic
958152136 3:89704319-89704341 CATCACAGGCCCAGAGGCCCAGG - Intergenic
958611942 3:96436979-96437001 CATCACAGGCCCAGAGGCCCAGG - Intergenic
959172074 3:102855365-102855387 CATCACAGGTTCAGAGGCCCAGG - Intergenic
959172570 3:102860316-102860338 CATCACAGGCACAGAGGCCTAGG - Intergenic
959470858 3:106748194-106748216 CAGCCTAGGGGCAGTGACCCAGG - Intergenic
959893705 3:111583824-111583846 CATCACAGGTCCAGAGGCCCAGG - Intronic
960255330 3:115505659-115505681 CATCACAGGCACAGAGGCCTAGG + Intergenic
960592407 3:119378684-119378706 GAGCCAAGGGAGAGAAGCCCCGG - Intronic
961326509 3:126112365-126112387 CTGACCATGGACAGGGGCCCTGG - Intronic
961452376 3:127008209-127008231 CAGCCCCCACACAGAGGCCCAGG - Intronic
962045729 3:131757723-131757745 CATCTCAGGCCCAGAGGCCCAGG + Intronic
962769914 3:138602673-138602695 CATCACAGGCCCAGAGGCCCAGG + Intergenic
962806292 3:138929860-138929882 CAGGCCAGTGACAGAGAGCCAGG - Intergenic
963397870 3:144756984-144757006 CTGCCCAGGGCCAGCGGCGCCGG - Intergenic
964108725 3:153067241-153067263 CAGCCGTGGGACATAGGCACTGG - Intergenic
964520718 3:157563641-157563663 CAGCACAGGGACCCTGGCCCTGG + Intronic
964945414 3:162217782-162217804 CAGCTCTGGGAAAGAAGCCCAGG + Intergenic
965439865 3:168699419-168699441 CAGGGCAGGCACAGGGGCCCTGG - Intergenic
965768827 3:172159321-172159343 CAAGCCAGGAACAGAGGACCTGG - Intronic
966446618 3:180007886-180007908 CATCACAGGCCCAGAGGCCCAGG - Intronic
966912747 3:184568665-184568687 CTGCCCAGGCACAGAGGACGGGG - Intronic
966931388 3:184678019-184678041 CAGCCCTGGGGCAAAAGCCCCGG - Intronic
967218222 3:187227904-187227926 CAGCCAAGGGACAGAGGAAGGGG - Intronic
967316888 3:188158161-188158183 CGGCCCAGGGTCAAAGTCCCAGG - Intronic
967388079 3:188929710-188929732 CAGCCCACTGCCAGAGGCCAGGG + Intergenic
968449402 4:668142-668164 CAGTGCAGGGAGAGAGGCCACGG + Intronic
968453649 4:686712-686734 CAGCGCAGGGCCACAGACCCCGG + Intronic
968516477 4:1017726-1017748 CAGCACAGGGAGAGACACCCAGG - Intronic
968525081 4:1052614-1052636 CAGCCCAGGAACAGCAGCGCAGG - Intergenic
968585779 4:1415330-1415352 CAGGCCCACGACAGAGGCCCCGG - Intergenic
968610612 4:1555280-1555302 CTGCCCAGGGACTGAGACCCTGG + Intergenic
968661298 4:1799887-1799909 CAGCTGAGGGACTAAGGCCCCGG + Intronic
968936526 4:3614012-3614034 GAGCCCAGGGGCAGAGTCACTGG - Intergenic
969107751 4:4820633-4820655 CACCCCAGCCACAGAGGCCTTGG + Intergenic
969476249 4:7424089-7424111 CAGGCCAGGGACCAAGGTCCTGG - Intronic
969638413 4:8382500-8382522 CTGCCCAGGCACAGAGGGCCTGG + Intronic
970326329 4:14928759-14928781 CAGAGCAGGGCCAGGGGCCCAGG + Intergenic
970443716 4:16107107-16107129 CACTCCAGGGACAAAGTCCCGGG - Intergenic
971309628 4:25514361-25514383 CAGCCAAGAGACAGTGACCCTGG + Intergenic
971343152 4:25789083-25789105 CAGACCAAGGACATATGCCCAGG + Intronic
971409114 4:26351660-26351682 AAGGCCAGGGACAGTGGCTCAGG - Intronic
971831890 4:31705129-31705151 CATCACAGGCCCAGAGGCCCAGG - Intergenic
972002717 4:34058783-34058805 CATCACAGGCCCAGAGGCCCAGG - Intergenic
972832654 4:42832661-42832683 CATCACAGGGCCAGAGGCCTAGG + Intergenic
973366421 4:49213082-49213104 CACCCCAGGGACAGAGTTCTGGG + Intergenic
974016900 4:56656193-56656215 CAGTCCAGGGAGGGAGGCCCGGG - Intronic
974972238 4:68844754-68844776 CATCACAGGCTCAGAGGCCCAGG + Intergenic
975632369 4:76416525-76416547 CAACACAGGCCCAGAGGCCCAGG + Intronic
976366776 4:84241424-84241446 CCGCCCAGAGACAGAGGCACCGG - Intergenic
977996498 4:103502410-103502432 CATCACAGGCCCAGAGGCCCAGG + Intergenic
978611297 4:110543823-110543845 CAACCCAGAGAAAGAGGCCATGG - Intronic
979390159 4:120118212-120118234 CATCACAGGTCCAGAGGCCCAGG - Intergenic
979409742 4:120362117-120362139 CAAGCCAAGGACAGAGGCCTTGG + Intergenic
979829751 4:125284871-125284893 AAGCCCTGGGACGGAGACCCTGG - Intergenic
980202751 4:129677126-129677148 CAGCACAGGGACACTGGGCCTGG - Intergenic
980448225 4:132939138-132939160 CAGCTCAGGCACAGAGGGCCAGG - Intergenic
980727807 4:136787709-136787731 CATCTCAGGCCCAGAGGCCCAGG + Intergenic
981121038 4:141051234-141051256 CATCACAGGCCCAGAGGCCCAGG - Intronic
981545818 4:145892177-145892199 CAGACCATGTACAGAAGCCCTGG + Intronic
981663121 4:147190399-147190421 CAGTTCAGGGACAGAGGCCCAGG - Intergenic
981799382 4:148637654-148637676 CATCACAGGCCCAGAGGCCCAGG - Intergenic
982178216 4:152726473-152726495 CATGCCAGGGACAGAGACCTAGG + Intronic
982948939 4:161664096-161664118 CATCACAGGGCCAGAGGCCCAGG - Intronic
983671843 4:170246751-170246773 CAGTGCAGGGACAGAAGCCAGGG - Intergenic
984331652 4:178328216-178328238 CAGGCCAAGAAGAGAGGCCCCGG + Intergenic
984774244 4:183466950-183466972 CAGCACAGGGACCCTGGCCCTGG - Intergenic
984882831 4:184425505-184425527 CCGCCCTGGAACAGAGGCCGAGG - Intronic
985201391 4:187488688-187488710 CAGCACAGGGACCCAGGGCCTGG - Intergenic
985498664 5:226348-226370 CAGGCCAGGCACAGTGGCTCAGG + Intronic
985541792 5:490821-490843 CAGCCCAGGGAAAGCTGCCGAGG - Intronic
985593224 5:775976-775998 CTGCCCATGGAGAGAGGACCAGG - Intergenic
985757247 5:1726269-1726291 GAGCCCTGGGACACAGGCGCAGG - Intergenic
985793329 5:1944478-1944500 CTGTTCAGGCACAGAGGCCCTGG + Intergenic
985853127 5:2403462-2403484 CAGCCCAGGGGCAGTGGCCTGGG - Intergenic
986482380 5:8202363-8202385 CAGCCCAGGGACTGCTGTCCAGG - Intergenic
986541207 5:8845463-8845485 AAGGCCAAAGACAGAGGCCCGGG - Intergenic
988009165 5:25461562-25461584 CATCACAGGCCCAGAGGCCCAGG + Intergenic
988020531 5:25614813-25614835 CTGCCCAGGGCCAGTGGCGCTGG + Intergenic
989104065 5:37844290-37844312 CAGTCCAGGGACCGGGGTCCTGG - Intergenic
991161418 5:63507793-63507815 CACCCCTGGGACAGAGCACCTGG + Intergenic
991595944 5:68305674-68305696 CTGTCCAGGGACAGATGCCAGGG + Intergenic
991679951 5:69129087-69129109 CAGGCCAGGCACAGTGGCCCAGG - Intronic
992080094 5:73228305-73228327 CAGTTCAGGGCCCGAGGCCCAGG - Intergenic
992175585 5:74146194-74146216 CAGCCCAGGGACAAGGGCAGGGG + Intergenic
992384755 5:76273757-76273779 CATCCCAGGGAGAGAGTCCAGGG - Intronic
993500281 5:88659855-88659877 GAGCCCAGGGACTGAGGCCCAGG - Intergenic
993671361 5:90764883-90764905 CTTCCCAGGGACAGAGAACCAGG - Intronic
994494186 5:100488905-100488927 CATCACAGGCCCAGAGGCCCAGG - Intergenic
994831195 5:104785923-104785945 CATCACAGGCCCAGAGGCCCAGG + Intergenic
995469380 5:112484419-112484441 CATCCCAGGGAGAGAGGAGCGGG + Intergenic
995678899 5:114695562-114695584 CTGCCCAGGGCCAGTGGCACCGG - Intergenic
995724688 5:115170299-115170321 CAGCGCAGGGCCAGGGGCCAGGG - Intronic
996011300 5:118483877-118483899 CATCACAGGCCCAGAGGCCCAGG - Intergenic
996179939 5:120406976-120406998 CAGCACAGGGACCCAGGGCCTGG - Intergenic
996340938 5:122438222-122438244 CTCCACAGGGACAGTGGCCCTGG - Intronic
996460136 5:123732433-123732455 CATCACAGGCCCAGAGGCCCAGG + Intergenic
996617356 5:125457772-125457794 CATCACAGGCCCAGAGGCCCAGG + Intergenic
997368367 5:133340129-133340151 AGGCCCAGGGAGAGAAGCCCTGG - Intronic
998285032 5:140850814-140850836 CAGCACAAGGAGAAAGGCCCGGG - Exonic
998889305 5:146729542-146729564 CATCACAGGCCCAGAGGCCCAGG + Intronic
999314424 5:150574945-150574967 CAGCCCAGGGCCAGGGGCAGGGG - Intergenic
999346139 5:150820954-150820976 CATCACAGGCCCAGAGGCCCAGG - Intergenic
999737559 5:154523973-154523995 AAGTCCAGGGAGAGAGGCCCAGG - Intergenic
999753637 5:154648335-154648357 CCGGCCAGGCACAGTGGCCCAGG - Intergenic
1000226480 5:159266647-159266669 CAGCACAGGCCCGGAGGCCCAGG + Intronic
1001403436 5:171460018-171460040 CAGACCCAGGACAGAGGCCTGGG - Intergenic
1001843551 5:174901621-174901643 CTGCCCAGGGCCAGCGGCGCCGG - Intergenic
1001934361 5:175694070-175694092 CAGCCCTGGGAGGGAGGCCCTGG - Intergenic
1002164548 5:177336330-177336352 CAGGGCTGGCACAGAGGCCCTGG + Intronic
1002330806 5:178439231-178439253 CAGGCAAGAGCCAGAGGCCCCGG + Intronic
1002343994 5:178535581-178535603 CAGGCCAGGGTCAGAAGCCTGGG + Intronic
1002376775 5:178794671-178794693 CAGCCCTGGGTCAGAACCCCTGG + Intergenic
1002416119 5:179121802-179121824 CACCCCAGGCAGAGAGGCTCCGG + Intronic
1002839856 6:896302-896324 AAGCCCAGGGATAGAGGAGCAGG - Intergenic
1002922862 6:1585536-1585558 CAGGCTAGGGACTGAGGCTCGGG + Intergenic
1003157589 6:3609433-3609455 CAGCCCAGGGCCTGGGGCCTAGG - Intergenic
1003167812 6:3696718-3696740 CAGCACTGGGACAGCTGCCCTGG + Intergenic
1003322503 6:5063943-5063965 CAGGCCAGGGGCAGTGGCTCCGG + Intergenic
1003403018 6:5806581-5806603 CATCACAGGCCCAGAGGCCCAGG + Intergenic
1004310322 6:14539877-14539899 CAAGCCAAGGAGAGAGGCCCCGG + Intergenic
1005637636 6:27766770-27766792 CAGGGCAGGGTCAGAGGGCCAGG - Intergenic
1005755778 6:28923901-28923923 TAGCCGAGGGTCAGAGTCCCAGG + Exonic
1006851736 6:37103387-37103409 CTGCCCAAGGACACATGCCCTGG + Intergenic
1006922717 6:37637184-37637206 GAGGCCAGGCACTGAGGCCCTGG - Exonic
1007357542 6:41332475-41332497 CAGCACAGAGACCGGGGCCCTGG + Intergenic
1008226156 6:48919713-48919735 CATCACAGGTACAGAGGCCTAGG + Intergenic
1008807992 6:55454961-55454983 CAGGCCAGGCACAGTGGCTCAGG + Intronic
1009740203 6:67734180-67734202 TCTCCCTGGGACAGAGGCCCTGG - Intergenic
1010636093 6:78260645-78260667 CATCACAGGCCCAGAGGCCCAGG - Intergenic
1011131069 6:84052288-84052310 CACCCCAGGGAGTGAGGCTCAGG + Intronic
1011136262 6:84104298-84104320 CATCCCAGGCACAGAGGCCTAGG - Intergenic
1013404560 6:109831517-109831539 CATCACAGGCCCAGAGGCCCAGG + Intergenic
1013864201 6:114675151-114675173 GAGCCCAGGGACATATTCCCAGG + Intergenic
1014068173 6:117150905-117150927 CAGCACAGGGACCCAGGACCTGG + Intergenic
1014134013 6:117866768-117866790 CATCACAGGCCCAGAGGCCCAGG - Intergenic
1014527175 6:122514740-122514762 CAGCCCAGGGATAGGGAACCAGG + Intronic
1016029820 6:139325796-139325818 CAGCCAAGAGACACAGACCCAGG - Intergenic
1016176267 6:141081188-141081210 CATCACAGGCCCAGAGGCCCAGG + Intergenic
1016533794 6:145089053-145089075 CTGACCATAGACAGAGGCCCTGG + Intergenic
1017228578 6:152047883-152047905 GACCCCAGGCACAGTGGCCCTGG - Intronic
1018866947 6:167753557-167753579 CATCACAGGTCCAGAGGCCCAGG - Intergenic
1019181135 6:170187841-170187863 CAGCTCAGGGACAAGGGGCCCGG - Intergenic
1019232984 6:170584430-170584452 CAGGCCAGGGCCTGGGGCCCCGG + Exonic
1019264761 7:108508-108530 CTCACCAGGGACAGAGGCCCAGG + Intergenic
1019316648 7:390078-390100 CAGCCGAGGGACAGGGGACCAGG + Intergenic
1019382542 7:731929-731951 CAACCCAGGGACTGGTGCCCTGG + Intronic
1019406170 7:885423-885445 CCGCACGGGGACAGAGGCACGGG - Intronic
1019423464 7:962525-962547 GAGCCCAGGAACAGAGGTGCTGG + Intronic
1019508715 7:1406434-1406456 AAAGCCAGGGACAGAGGCCAGGG - Intergenic
1019545085 7:1570235-1570257 CAGCAGAGGGGCTGAGGCCCGGG - Intronic
1019623269 7:2002867-2002889 AACCGCAGGGGCAGAGGCCCAGG - Intronic
1019699733 7:2468844-2468866 CAGCCCCTGGACTCAGGCCCAGG + Intergenic
1019979054 7:4607522-4607544 CAGCCACGGCACAGAGGCCGTGG - Intergenic
1019996115 7:4725471-4725493 CTGCCCACAGGCAGAGGCCCGGG + Intronic
1020127131 7:5539270-5539292 CAGCTGAGGGCAAGAGGCCCAGG - Intronic
1020238591 7:6374887-6374909 CCGCCCCGCGACACAGGCCCAGG - Intronic
1020470069 7:8525555-8525577 CATCACAGGCCCAGAGGCCCAGG + Intronic
1020537909 7:9424518-9424540 CATCACAGGCCCAGAGGCCCAGG - Intergenic
1021450285 7:20778088-20778110 TTGCCCAAGGTCAGAGGCCCGGG + Intergenic
1021689808 7:23221072-23221094 CAGCCCACTGACAGAGGCTTCGG - Intergenic
1021750534 7:23795135-23795157 CATCACAGGCACAGAGGCCTAGG + Intronic
1022001232 7:26228406-26228428 CAGGCCACAGACTGAGGCCCTGG - Intergenic
1022003730 7:26248532-26248554 AAGCCCAGGGCCAGTTGCCCGGG + Intergenic
1022257339 7:28672586-28672608 CAGCCTTGGGTCTGAGGCCCAGG - Intronic
1023816124 7:43951350-43951372 CAGCACTGTGAAAGAGGCCCAGG + Intronic
1023879186 7:44308873-44308895 CTGGCCATGGACAGAGGCCCCGG - Intronic
1023950611 7:44841158-44841180 CAGAACAGAGACACAGGCCCTGG - Intronic
1023967375 7:44969966-44969988 CAGCCCATGGGGAGGGGCCCGGG - Intronic
1024084020 7:45878690-45878712 CAACACAGGCCCAGAGGCCCAGG - Intergenic
1024227278 7:47335570-47335592 CCACCCAGGGCCAGATGCCCAGG + Intronic
1024306414 7:47932918-47932940 AGGCCCAGGGTCAGAGGCTCTGG + Intronic
1024566852 7:50688513-50688535 CAGCCCATAGACAAAGGCCGGGG + Intronic
1024610316 7:51058769-51058791 CAGCCCACGCTCAGAGGCTCCGG - Intronic
1024926372 7:54619381-54619403 CATCCCAGAGCCAGAGACCCAGG - Intergenic
1025230160 7:57198569-57198591 CAGCCGATGGACAGGGGACCAGG - Intergenic
1025320368 7:58088020-58088042 CAGCCCAGGAACAGAGCCTGGGG - Intergenic
1025478676 7:60957008-60957030 CAGCCCAGGAACAGAGCCTGGGG - Intergenic
1025929696 7:65983689-65983711 CAGGCCAGGCACAGAGGTTCAGG + Intergenic
1026709342 7:72723218-72723240 AACCCCAGGGACAGGGGACCAGG - Intronic
1027233929 7:76286891-76286913 CAGCCCAGGGTCACAGGCATAGG + Exonic
1027704319 7:81510214-81510236 CATCACAGGCCCAGAGGCCCAGG + Intergenic
1028291840 7:89075318-89075340 CAGCACAGGGACCCAGGGCCTGG - Intronic
1029225933 7:99028482-99028504 CAGCCCAGAGCCAGAGGGCTGGG - Exonic
1029260510 7:99299502-99299524 CAGCCTAGAGGCAGAGGCCAAGG + Intergenic
1029583434 7:101453687-101453709 CAGCCCAGGCTCAGACTCCCAGG - Intronic
1029647630 7:101868371-101868393 CAGCCCAGGGGAGGAGGCGCTGG - Intronic
1029711772 7:102303745-102303767 GAGGGCAGGGACAGAAGCCCAGG + Intronic
1032797139 7:135287106-135287128 CAGCCCATGCACAGATGCCATGG + Intergenic
1032875946 7:136038214-136038236 CAGGCCAGGCACAGTGGCTCAGG - Intergenic
1033201841 7:139379845-139379867 CAGACCAGGCACAGTGGCTCAGG - Intronic
1033232688 7:139614030-139614052 CTGGCCAGGGACACAGTCCCTGG + Intronic
1033686727 7:143647138-143647160 CAGCCAAGGGGCAGTGGCCAGGG + Intronic
1033689007 7:143720169-143720191 CAGCCAAGGGGCAGTGGCCAGGG - Exonic
1033697882 7:143810476-143810498 CAGCCAAGGGGCAGTGGCCAGGG - Intergenic
1034037492 7:147839630-147839652 CACCTCATGGACAGAGGCCAGGG - Intronic
1034268157 7:149791096-149791118 CACCACAGGGAAAGAGGCCAGGG - Intergenic
1034273067 7:149812494-149812516 CATTCCAGGGAGAGAGGCCAGGG + Intergenic
1034474553 7:151275071-151275093 CAGCCCAGGAGCAGAAGCTCTGG - Intronic
1034623031 7:152471154-152471176 CATCACAGGCCCAGAGGCCCAGG + Intergenic
1034739637 7:153462260-153462282 CATCCCAGGCCCAGAGGCCTAGG + Intergenic
1034819771 7:154205958-154205980 CAGGCAAGGGTCAGAGGCCGAGG - Intronic
1035246620 7:157566545-157566567 CACCCCAGGGAAAGAGGAGCAGG + Intronic
1035337338 7:158138354-158138376 CAGCCCTGGGAGAGCGGCCCTGG - Exonic
1035436788 7:158865446-158865468 AAATCGAGGGACAGAGGCCCTGG + Intronic
1036140300 8:6201430-6201452 AGACCCAGGGACAGAGACCCAGG - Intergenic
1036280253 8:7394102-7394124 CAGGCAATGGACAGAGCCCCTGG + Intergenic
1036341274 8:7917781-7917803 CAGGCAATGGACAGAGCCCCTGG - Intergenic
1037467740 8:19176423-19176445 TTGCCCAGAGACAGAGACCCAGG - Intergenic
1037746643 8:21650614-21650636 CATCACAGGGCCAGAGGCCTAGG - Intergenic
1037770906 8:21799066-21799088 TAGCACAGGGTCTGAGGCCCAGG + Intronic
1037855566 8:22368365-22368387 CAGAGCAGGGACAGAGGCCAGGG - Intronic
1037882631 8:22580348-22580370 CAGCCCAGGGAGCGACTCCCAGG - Intronic
1037902048 8:22694159-22694181 CAGCGCCGGGTCAGGGGCCCAGG - Intergenic
1038446306 8:27606597-27606619 CTGCCCTGGGGCAGAGGGCCTGG - Intronic
1038708494 8:29919708-29919730 CAGCCCAGAGACATAGGCGGAGG + Intergenic
1038753192 8:30315985-30316007 CTGCCATGGCACAGAGGCCCTGG - Intergenic
1038861316 8:31391937-31391959 CTGCTCAGTGACAGAGGCTCAGG + Intergenic
1039379545 8:37072123-37072145 GAGCCCTGGGTCAGAGGCCAGGG - Intergenic
1039914436 8:41849318-41849340 CAGCCCAAGGCCAAAGGCCAAGG - Intronic
1040676587 8:49757665-49757687 CAGCCCAGGGAGAGGGACTCTGG - Intergenic
1040946845 8:52893430-52893452 CAGCCCAGGGTCAGCGGGCAGGG + Intergenic
1041163837 8:55072088-55072110 TACCCCAGGGACACAGGCTCAGG + Intergenic
1041715454 8:60927945-60927967 CAAGCCAGGGAGAGAGGCCCTGG - Intergenic
1041881065 8:62750568-62750590 CCTCCCAGGGACAGAGGCGCCGG - Intronic
1042024816 8:64411784-64411806 CAGCTCAGGGGCAGATGCTCCGG + Intergenic
1042498987 8:69488763-69488785 CAGCCCAGGGAAGGAGGATCAGG + Intronic
1042953646 8:74225676-74225698 CACCACAGGCCCAGAGGCCCAGG - Intergenic
1044718525 8:95123659-95123681 CATCACAGGCCCAGAGGCCCAGG + Intergenic
1045214203 8:100130365-100130387 CAGCCCAGGGACCCTGGGCCAGG + Intronic
1045437054 8:102173874-102173896 CATCACAGGTACAGAGGCCTAGG - Intergenic
1047021707 8:120782080-120782102 CAAGCCATGGAGAGAGGCCCAGG - Intronic
1047212454 8:122850906-122850928 CAGCACAGTGACAGAGGGGCAGG - Intronic
1048130779 8:131694399-131694421 CATCCCAGGCTCAGAGGCCTAGG - Intergenic
1048275405 8:133062250-133062272 CCTACCAGGGTCAGAGGCCCTGG - Intronic
1048506533 8:135026899-135026921 CATTCCAGAGACAGAAGCCCAGG - Intergenic
1048516123 8:135113416-135113438 TATCACAGGGCCAGAGGCCCAGG + Intergenic
1048675181 8:136770178-136770200 CATCACAGGCCCAGAGGCCCAGG - Intergenic
1048806497 8:138246313-138246335 CATCACAGGCCCAGAGGCCCAGG + Intronic
1048923322 8:139250090-139250112 CATCACAGGCCCAGAGGCCCAGG + Intergenic
1049001570 8:139828622-139828644 CAGCCCAGTGTCAGACACCCTGG - Intronic
1049312970 8:141943154-141943176 CAGCTGTGGGACAGAGGCCGTGG - Intergenic
1049320025 8:141991357-141991379 CAGCCTCAGGCCAGAGGCCCAGG + Intergenic
1049425085 8:142534360-142534382 CTGCCCAGAGAGTGAGGCCCAGG - Intronic
1049536229 8:143183704-143183726 CAACCCTGTGGCAGAGGCCCAGG + Intergenic
1049563870 8:143327371-143327393 CAGCCCATGGACAAAAGCCCAGG + Intronic
1049593909 8:143474820-143474842 CAGCCCAGGGAAACAGGCTCAGG - Intronic
1049682538 8:143926087-143926109 CAGCCTGGGGAAGGAGGCCCAGG + Intronic
1049749485 8:144276541-144276563 CAGCCCAGGGACAGAGGCCCCGG - Intronic
1049872333 8:144990428-144990450 CCTCCCTGGGACAGAGCCCCTGG - Intergenic
1049936483 9:505132-505154 CATCCGAGGGACAGAGCGCCGGG - Intronic
1050021906 9:1293175-1293197 CATCCCAAGGACAGAGGCTGGGG + Intergenic
1050239205 9:3616635-3616657 AAGCCCAGGACCAGAGGTCCTGG - Intergenic
1050905054 9:10993643-10993665 CATCACAGGCCCAGAGGCCCAGG + Intergenic
1052614483 9:30821022-30821044 CATCACAGGCCCAGAGGCCCAGG + Intergenic
1052989095 9:34508283-34508305 CTGCCCAGGCACAGGGGCCATGG + Intronic
1053053520 9:34980053-34980075 CAGCCCAAGGCCAGTGGCACAGG - Exonic
1053384215 9:37673915-37673937 CATCACAGGCACAGAGGCTCAGG - Intronic
1053489760 9:38489517-38489539 CAGGCCAAGGTCAGAGCCCCAGG + Intergenic
1053802446 9:41772983-41773005 CTCCCCAGGGGCAGAGGCCAGGG - Intergenic
1054142792 9:61542087-61542109 CTCCCCAGGGGCAGAGGCCAGGG + Intergenic
1054190755 9:61984329-61984351 CTCCCCAGGGGCAGAGGCCAGGG - Intergenic
1054462540 9:65473237-65473259 CTCCCCAGGGGCAGAGGCCAGGG + Intergenic
1054647619 9:67603388-67603410 CTCCCCAGGGGCAGAGGCCAGGG + Intergenic
1054702553 9:68427711-68427733 CAGCCCAGAGTCTGAGGCCAAGG - Intronic
1055878424 9:80970537-80970559 CATCACAGGCCCAGAGGCCCAGG + Intergenic
1056129265 9:83567345-83567367 CAGCACAGGCCCAGAGGCCTAGG - Intergenic
1056436328 9:86578663-86578685 CAGCTCAGTGACAGACACCCTGG + Intergenic
1056442488 9:86634703-86634725 CAAGCCAGGGAGAGAGGCCTCGG - Intergenic
1057495766 9:95559895-95559917 CCTCCGAGGGACAGAGGACCTGG + Intergenic
1057670094 9:97078826-97078848 CAGGCCAAGGTCAGAGCCCCAGG + Intergenic
1057695295 9:97318695-97318717 CAGCCCAGGGCCAGAGAGCTGGG - Intronic
1057695366 9:97319098-97319120 CAGCCCAGGGCCAGAGAGCTGGG + Intronic
1057797501 9:98169360-98169382 CCGCCCAGGGACGGTGGCTCTGG - Intronic
1058076484 9:100657022-100657044 CATCACAGGCCCAGAGGCCCAGG + Intergenic
1058589468 9:106547230-106547252 CAGGCCAGGCACAGTGGCGCAGG - Intergenic
1058834496 9:108848961-108848983 CATCACAGGCCCAGAGGCCCAGG - Intergenic
1058985969 9:110208405-110208427 CAGCCATGGGACAGAGCCCAGGG + Intergenic
1059391361 9:114001522-114001544 CAGAACAGGGACAGGGACCCAGG + Intronic
1060221213 9:121765031-121765053 TAGCCCAGGGGCTAAGGCCCTGG - Intronic
1060404655 9:123367382-123367404 CAGCCCATGTCCAGATGCCCAGG + Intronic
1060965173 9:127708195-127708217 CAGGCCAGGCACAGTGGCTCAGG + Intronic
1061010299 9:127950691-127950713 GGACCCAAGGACAGAGGCCCCGG + Intronic
1061028087 9:128063467-128063489 CTGCCCAGGGTCAGAGGCGGGGG + Exonic
1061542047 9:131282832-131282854 CAGCCCAGGTCCGGAGGCTCAGG + Intergenic
1061633517 9:131889848-131889870 GAGCACAGCCACAGAGGCCCTGG - Intronic
1061669318 9:132179801-132179823 CAGGACAGTGACGGAGGCCCTGG - Intronic
1061878075 9:133554735-133554757 CAGCCCAGGGAAGGGGGCCTTGG + Intronic
1061939267 9:133875330-133875352 CAGCCCAGCGCCACAGCCCCGGG + Intronic
1062000569 9:134213857-134213879 CAGCCCCGGGACAGAATCCTAGG + Intergenic
1062005173 9:134235279-134235301 CAGCCCAGGAGCAGGAGCCCTGG - Intergenic
1062076100 9:134590772-134590794 CCGCCCACAGAGAGAGGCCCTGG + Intergenic
1062094527 9:134695979-134696001 CAGGCCCAGGGCAGAGGCCCAGG - Intronic
1062204163 9:135326495-135326517 CAGGCTCTGGACAGAGGCCCTGG + Intergenic
1062230949 9:135480841-135480863 CAGGCCAGGGAGAGGAGCCCCGG - Intronic
1062353430 9:136150141-136150163 CAGCCCCGGGGCTGGGGCCCTGG + Intergenic
1062464298 9:136674367-136674389 CAGCCCAGGGGCACAGGCTGCGG - Intronic
1062568567 9:137174045-137174067 CACCTCTGGGACAGAGGCCCAGG + Intergenic
1062590845 9:137273937-137273959 CACACCAGGGACAGGAGCCCTGG + Intergenic
1185700212 X:2225998-2226020 CAACCCAAGGAGAGAGGCCTCGG + Intronic
1186471126 X:9822850-9822872 CAGAGAAGGGACAGAGCCCCAGG - Intronic
1186788727 X:12976183-12976205 CAGCCCAGAGACAGCGGGGCGGG + Exonic
1187133640 X:16526262-16526284 CATCACAGGCACAGAGGCCTGGG - Intergenic
1187787934 X:22914297-22914319 CTGATCAGGGACAGAGGCACGGG + Intergenic
1188755212 X:33953255-33953277 CATCACAGGCCCAGAGGCCCAGG - Intergenic
1188765049 X:34080631-34080653 CATCACAGGCCCAGAGGCCCAGG - Intergenic
1188804529 X:34570641-34570663 CAGCACAGGGACCTAGGACCTGG + Intergenic
1188925979 X:36044183-36044205 CATCACAGGGCCAGAGGCCTAGG - Intronic
1189371242 X:40431337-40431359 CATCACAGGCCCAGAGGCCCAGG + Intergenic
1189642105 X:43084416-43084438 CAGACCAGGGACGGGGGCCAGGG + Intergenic
1190729718 X:53217629-53217651 CTGCTCAGGGTCAGAGGTCCTGG - Intronic
1191089253 X:56602533-56602555 CATCACAGGCACAGAGTCCCAGG - Intergenic
1191089940 X:56609048-56609070 CATCACAGGCCCAGAGGCCCAGG - Intergenic
1191850384 X:65581778-65581800 CAGCCCAGCAACACAGGCCCAGG + Intergenic
1192965095 X:76168953-76168975 CAGGCCAGGCACAGTGGCTCAGG - Intergenic
1193080345 X:77400245-77400267 CAGCCCTGGGGGAGAGGCCTGGG + Intergenic
1194626038 X:96227637-96227659 CATCACAGGCCCAGAGGCCCAGG - Intergenic
1195154500 X:102109820-102109842 CATCACAGGCCCAGAGGCCCAGG + Intergenic
1195961688 X:110393754-110393776 CTGTCCATGGACAGTGGCCCTGG - Intronic
1196684299 X:118496842-118496864 CAGTCCAGGGATGGAGGACCTGG + Intronic
1197464230 X:126783933-126783955 CATCACAGGGTCAGAGGCCTAGG + Intergenic
1197511162 X:127371079-127371101 CATCACAGGCCCAGAGGCCCAGG - Intergenic
1198735002 X:139775745-139775767 CTTCCCAGGGACAGAGATCCAGG + Intronic
1199325450 X:146493437-146493459 CATCACAGGTCCAGAGGCCCAGG + Intergenic
1199711624 X:150473622-150473644 CAGACCAGGGCCCGAGCCCCAGG - Intronic
1199850419 X:151721903-151721925 CAACCCAGGGACAGATGCAGTGG + Exonic
1199868818 X:151877922-151877944 CAGCACAGGGACAGTGGACCTGG + Intergenic
1200234030 X:154459692-154459714 GAGCCCTGGGACAGAGGTCTGGG - Intronic
1200387248 X:155906167-155906189 CAGGCCAAGGACAGAGCCCGAGG - Intronic
1201707182 Y:16950116-16950138 CATCCCTGGGACAGAGGACCTGG + Intergenic